Synthèse et caractérisation d'un promédicament Aspirin-fumarate qui inhibe l'activité de NFkB et du sein des cellules souches du cancer

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Kastrati, I., Delgado-Rivera, L., Georgieva, G., Thatcher, G. R., Frasor, J. Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NFκB Activity and Breast Cancer Stem Cells. J. Vis. Exp. (119), e54798, doi:10.3791/54798 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

L'inflammation est une caractéristique du cancer qui sous-tend l'incidence et de la promotion du cancer, et la progression éventuellement à des métastases. Par conséquent, l'ajout d'un médicament anti-inflammatoire à des régiments de cancer standards peut améliorer les résultats des patients. Un tel médicament, l'aspirine (acide acétylsalicylique, ASA), a été explorée pour la chimioprévention du cancer et de l'activité anti-tumorale. Outre l'inhibition de l'axe 2-prostaglandine cyclooxygénase, les activités anti-cancéreuses de l'ASA ont également été attribués à facteur nucléaire ĸB (NFĸB) inhibition. Parce que l'utilisation de l'AAS prolongé peut causer une toxicité gastro-intestinale, une stratégie de promédicament a été mis en œuvre avec succès. Dans cette conception promédicament l'acide carboxylique est masqué de l'ASA et des pharmacophores supplémentaires sont incorporés.

Ce protocole décrit la façon dont nous avons synthétisé un promédicament aspirine fumarate, GTCpFE, et caractérisé l'inhibition de la voie NFĸB dans les cellules cancéreuses du sein et de l'atténuation du cancer de la tige en forme correcteliens, une importante phénotype NFĸB dépendant. GTCpFE inhibe efficacement la voie NFĸB dans des lignées cellulaires de cancer du sein tandis que l'AAS est dépourvue d'activité inhibitrice, ce qui indique que l'ajout à la structure du fumarate ASA contribue de manière significative à son activité. En outre, GTCpFE montre anti-cancer activité de cellules souches significative en bloquant la formation mammosphere et atténuer la CD44 associée aux cellules souches du cancer + CD24 - immunophénotypage. Ces résultats établissent une stratégie viable pour développer des médicaments anti-inflammatoires améliorés pour la chimioprévention et le traitement du cancer.

Introduction

L' inflammation est une caractéristique qui sous - tend plusieurs aspects de la tumorigenèse, tels que l' incidence et la promotion, et la progression éventuellement à des métastases 1. Dans le cancer du sein, il est en outre étayée par les observations épidémiologiques montrent que l'utilisation régulière de la non-stéroïdiens anti-inflammatoires de l'aspirine médicamenteuse classique (acide acétylsalicylique, ASA) est associée à une réduction à la fois l'incidence du cancer du sein et le risque de métastases et de la récurrence 2,3. ASA agit principalement en inhibant l' activité de la cyclooxygénase-2, qui est souvent régulé à la hausse dans le cancer du sein 4,5. Cependant, les effets anti-cancéreux d'ASA peuvent également être médiés par la suppression de facteur nucléaire kB aberrante (NFkB) de signalisation 6-8. Ceci est important car une voie de NFkB dérégulée favorise la survie des cellules tumorales, de la prolifération, la migration, l' invasion, l' angiogenèse et la résistance à la thérapie 11/09. activation de la voie NFkB est également critique pour le montageune réponse immunitaire. Par conséquent, pour un traitement anti-cancéreux, où l'inhibition de NFkB prolongée est requise, il faut tenir compte des effets secondaires néfastes impliquant une immunosuppression à long terme. Par conséquent, l'AAS peut servir comme un bon point de départ pour l'optimisation thérapeutique.

Une limitation à l' application ASA dans le traitement du cancer aux doses élevées requises pour l' inhibition de la cyclo - oxygénase 2 et de NFkB, qui sont associés à une toxicité gastro - intestinale, tels que les ulcères et les saignements de l' estomac 12,13. Toutefois, la conversion ASA en promédicament sous forme d'ester, peut réduire la toxicité gastro-intestinale de l'ASA. Afin d'améliorer davantage la puissance et / ou ajouter des fonctionnalités supplémentaires ou des éléments structuraux pharmacophores auxiliaires peuvent également être incorporés dans la conception de prodrogue ester. Un tel pharmacophore ajouté pour améliorer l' ASA puissance contre la voie NFkB est fumarate, que nous avons précédemment montré comme important pour l' inhibition de la voie NFkB 14,15.

15, GTCpFE, et émis l' hypothèse que cette molécule hybride serait sûr encore efficace contre la voie NFkB. Nous avons testé l'activité anti-NFkB dans les cellules cancéreuses du sein et de sa capacité à bloquer les cellules souches du cancer du sein (CCM) 15, qui reposent sur NFkB de signalisation pour la survie et la croissance 16-21. Nous constatons que la puissance de GTCpFE contre la voie NFkB est significativement améliorée par rapport à l' AAS 15. En outre, les blocs GTCpFE formation mammosphere et atténue la CSC marqueur de surface CD44 + CD24 - immunophénotypage, indiquant que GTCpFE est capable d'éradiquer CSCs 15. Ces résultats établissent le promédicament aspirine fumarate en tant qu'agent anti-inflammatoire efficace qui peut également cibler des cellules souches cancéreuses du sein. En termes de traitement du cancer du sein, GTCpFE peut avoir le potentiel pour traiter la maladie agressive et mortelle.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Synthèse de l'Aspirine-fumarate promédicament GTCpFE

  1. Au moyen d'un piston de seringue en matière plastique, la mesure de 0,81 ml (20 mmol) de methanol et mélanger dans de l'eau (10 ml) dans un ballon à fond rond. On refroidit le mélange résultant à 0 ° C en plaçant le ballon dans un bain d'eau glacée. Ajouter l'alcool 4-hydroxybenzylique (2,48 mg, 20 mmol) et agiter le mélange de réaction jusqu'à ce que la solution soit limpide.
  2. Préparer une solution de chlorure O -acetylsalicyloyl (3,77 mg, 19 mmol) dans du toluène anhydre (10 ml) en pesant la quantité désirée de chlorure O -acetylsalicyloyl et sa dissolution dans le solvant dans un ballon séparé. En utilisant une seringue de piston en plastique, ajouter cette solution au mélange préparé à l'étape 1.1, et de laisser la réaction sous agitation à 0 ° C.
  3. Surveiller la réaction par Chromatographie en couche mince (CCM). Les plaques de CCM devraient avoir la silice comme phase stationnaire.
    1. Préparer une phase mobile composée d'20:80 acétate d'éthyle (AcOEt) / hexane. Dans une chambre CCM(Ou petit récipient) ajouter 5 ml de phase mobile pour couvrir le fond de la chambre.
      NOTE: La quantité de phase mobile dépend de la chambre choisie. Toujours ajouter assez pour couvrir le fond, mais une fois que le CCM est placé à l'intérieur, la ligne de solvant ne doit pas dépasser la hauteur où les composés sont repérés.
    2. Prélever un échantillon de la réaction avec une seringue (0,2 ml), le placer dans un petit flacon et le diluer avec de l'acétate d'éthyle (2-3 gouttes). Avec un observateur TLC, prendre soin d'un échantillon du mélange réactionnel dilué et place dans le TLC.
      NOTE: Les taches doivent être 1-2 mm, ce qui devrait être fait au plus bas 1/4 de pouce de la plaque TLC.
    3. Sur le même TLC, placer un spot d'une solution de chlorure O-acetylsalicyloyl (0,2 mg dans 0,5 ml d'acétate d'éthyle) à titre de comparaison. Une fois que les taches sont sèches, placez-le dans la chambre et le laisser tourner jusqu'à ce que le front de solvant a presque atteint le sommet de la CCM.
    4. Prenez le CCM sur, laissez-le sécher et le visualiser sous une lampe UV. La REACtion est terminée lorsque le spot O -acetylsalicyloyl de chlorure disparaît à partir du mélange de réaction.
    5. Lorsque la réaction est terminée, on enlève le bain d'eau glacée, et laisser la réaction sous agitation à température ambiante pendant 20 h.
  4. Filtrer le précipité en utilisant un entonnoir Büchner avec un disque fritté de porosité moyenne. Placer le solide dans un flacon à scintillation, et laisser le composé sous vide pendant une nuit dans un dessicateur à température ambiante. Utiliser le pentoxyde de phosphore (P 2 O 5) en tant que desséchant.
  5. Sécher dans un ballon à fond rond, en le plaçant dans un four à 80 ° C pendant au moins deux jours avant la mise en place de cette réaction. En variante, sceller le flacon avec un septum et la percer avec une aiguille qui est reliée à un système de pompe à vide. Tourner la pompe à vide et sécher le flacon à l'aide d'un pistolet thermique. Laisser refroidir, et répétez cette étape 2 fois plus.
  6. Gonfler un ballon en utilisant du gaz argon, et le connecter à une seringue en plastique (dont le plongeur hcomme cela a été retirée) avec une aiguille. Éteignez la pompe à vide et retirer l'aiguille fixée à ce qui a été insérée dans le ballon à fond rond maintenant séché. Insérer l'aiguille reliée au ballon d'argon à travers la cloison étanche le ballon à fond rond.
    1. Ajouter l'ester 4-hydroxyméthyl phénol de 2-acetyloxybenzoic d'acide (100 mg, 0,349 mmol), de 4-diméthylaminopyridine (4 mg, 0,033 mmol) et de triéthylamine (53 mg, 0,523 mmol) dans un ballon séparé, puis les dissout dans du tétrahydrofuranne anhydre (5 mL). Avec une seringue en plastique fixée à une aiguille, ajouter cette solution dans le ballon à fond rond et fermé. On refroidit le mélange à 0 ° C en plaçant le ballon dans un bain d'eau glacée.
  7. Au mélange précédent, on ajoute une solution de chlorure de fumaroyle d'éthyle (68 mg, 0,419 mmol) dans du tétrahydrofurane anhydre (5 ml), goutte à goutte sur une période de 10 min. Agiter la solution résultante à 0-5 ° C pendant 2-4 heures.
  8. On extrait le mélange réactionnel avec de l'acétate d'éthyle (100 ml) et de la saumure (50 ml). <br /> Remarque: La saumure est une solution saturée de chlorure de sodium (NaCl). Pour le préparer, placer 200 ml d'eau dans un récipient en verre propre, puis commencer à ajouter NaCl (tout en agitant) jusqu'à ce qu'il ne se dissout pas plus.
    1. Après extraction, éliminer la phase aqueuse et répéter la dernière étape deux fois plus.
    2. Sécher le mélange en ajoutant du sulfate de sodium à la phase organique, jusqu'à ce que le solide ne Clump pas lorsque la verrerie est agité. En utilisant un autre entonnoir de Büchner avec un disque fritte, on filtre le mélange dans un ballon à fond rond pour éliminer le sulfate de sodium, puis on évapore à sec en utilisant un évaporateur rotatif, la température fixée à 40 ° C.
  9. En utilisant une Chromatographie sur couche mince, déterminer une phase mobile appropriée à utiliser dans la Chromatographie sur colonne.
    NOTE: Pour cette expérience un gradient de 20:80 AcOEt / hexane a été utilisé.
  10. Préparer une colonne de gel de silice et la phase solvant approprié. Une fois que le composé a été ajouté, ajouter une couche de sulfate de sodium (ou sable) pour protect la colonne en tant que le solvant est ajouté.
    1. Comme la colonne fonctionne, surveiller l'éluat par CCM. Repérer tous les autres tubes d'essai comme elles sont collectées à partir de la colonne. Lorsque le produit d'intérêt élué, mélanger tous les échantillons contenant le produit pur dans un grand ballon à fond rond, et les sécher à l'aide d'un évaporateur rotatif, la température du bain réglé à 40 ° C.
      NOTE: Le produit doit apparaître comme un solide blanc.
  11. Pour confirmer la structure de GTCpFE, collecter des protons et du carbone (1 H et 13 C, respectivement) par résonance magnétique (RMN) nucléaire selon les instructions du fabricant.
    NOTE: Dans cette étude , un 400 MHz FT spectromètre RMN a été utilisé pour recueillir les 1 H et 13 C spectres. Exécutez au moins 25 balayages à la température ambiante pour obtenir une résolution suffisante de données. Les pics de RMN observés ont été les suivants, 1 H RMN (CDCl 3): δ 1,29 (t, 3 H, 3J = 7,0 Hz, CH3); 2,31 (s, 3 H, CH3); 4,26 (q, 2 H, 3J = 7.0 Hz, COOCH 2); 5,25 (s, 2 H, OCH2); 6,89 (s, 2 H, HC = CH); 7,19 (m, 3 H, Ar); 7,42 (m, 3 H, Ar); 7,65 (m, 1 H, Ar); 8,22 (dd, 1 H, 3J = 7,8, 4J = 1,2 Hz, Ar). 13 C RMN (CDCI3) ô: 169,70, 164,86, 164,75, 162,89, 151,28, 150,69, 134,76, 134,32, 133,26, 133,16, 132,25, 129,81, 126,26, 124,11, 122,47, 122,04, 66,40, 61,43, 21,05, 14,15.
  12. En outre, de recueillir un spectre de masse à haute résolution en utilisant la chromatographie liquide spectrométrie de masse en combinaison avec un piège à ions et le temps de la technologie de vol (LCMS-IT-TOF) pour les mesures de masse précises que selon les instructions du fabricant.
    NOTE: Dans cette étude (M + NH4 +) calculé: 430,1496; observé: 430,1477.

2. GTCPFE inhibe l'activité NFĸB dans les cellules du cancer du sein

  1. Cellule Conditions de culture
    1. Maintenir des lignées cellulaires de cancer du sein humain, MCF-7 et MDA-MB-231 selon le cul de cellules standardet les techniques de tures se propager dans un incubateur humidifié à 37 ° C avec 5% de CO 2.
      1. Préparer MCF-7 milieu cellulaire de Roswell Memorial Institute Park (RPMI) 1640 milieu avec du rouge de phénol supplémenté avec 10% de sérum de fœtus bovin (FBS), 1% d'acides aminés non essentiels, 2 mM de L-glutamine, 1% d'antibiotique pénicilline-streptomycine et 6 ng / ml d'insuline. Préparer un milieu de cellules MDA-MB-231 de l'amélioration du milieu essentiel minimum (IMEM) supplémenté avec 5% de FBS, 1% d'acides aminés non essentiels, 2 mM de L-glutamine et 1% d'antibiotiques de pénicilline-streptomycine.
  2. NFkB-RE Luciferase Reporter Assay
    1. Trypsiniser cancer du sein MCF-7 cellules en utilisant 0,25% de trypsine pendant 5 min à 37 ° C, comptent manuellement à l'aide d'un hémocytomètre et des semences dans des plaques à 24 puits à 90.000 cellules par densité de puits.
    2. Les cellules jours, le co-transfecter suivants avec de l'ADN de plasmide d'un élément de réponse de NFkB (NFkB-RE), la luciférase de construction, 1 ug / puits, along avec le promoteur Renilla luciférase construction, 0,2 pg / puits. Effectuer transfections pour chaque groupe de traitement en triple exemplaire.
      1. Laver les cellules deux fois avec du PBS, et on incube avec des mélanges d'ADN de plasmide et 1 ul par puits de réactif de transfection (par exemple , la lipofectamine) dans un milieu sans sérum. Après 6 heures, changer le milieu à 1 ml de milieu ordinaire (sans antibiotiques pénicilline et de la streptomycine).
    3. Après 16 h, ajouter 1 pl de véhicule ou différentes solutions de stockage de l'GTCpFE ou de drogues ASA à chaque puits. Dissoudre solutions médicaments d'achat d'actions (100, 50, 20, 10 et 1 mM) dans le diméthylsulfoxyde à une concentration 1,000x. Après avoir ajouté les médicaments, incuber les cellules pendant 2 heures à 37 ° C.
    4. Pour activer la voie NFkB, ajoutez la cytokine pro-inflammatoire TNFa (10 pg / ml de solution de stock) dans chaque puits pour une concentration finale de 10 ng / ml et incuber pendant 4 heures. Inclure un seul contrôle TNFa. Aspirer le milieu et stocker la cellules à -80 ° C.
    5. Mesurer la luciférase en utilisant un système de dosage de rapporteur de la luciférase selon les instructions du fabricant.
      Remarque: Lors de l' utilisation du système de dosage de luciférase (par exemple à double luciférase du système de dosage) pour la première fois, de préparer une solution de luciférase réactif d'essai par remise en suspension dans 10 ml de tampon et de le stocker à -80 ° C en aliquots de 1 ml.
      1. Préparer un tampon de lyse 1x par dilution du stock régulateur 5x avec de l'eau. cellules Lyse dans chaque tampon de lyse 1x 100 pi puits à l'aide. Incuber sur un agitateur orbital pendant 15 minutes, à vitesse moyenne.
      2. Etiqueter un tube de 1,5 ml par échantillon. Thaw réactif d'essai luciférase à la température ambiante (50 pi par échantillon sera nécessaire) et garder à feuille. 1x préparer un réactif de trempe dans un flacon en verre, une dilution 1:49 dans du tampon et on tourbillonnaire (50 ul par échantillon sera nécessaire).
      3. Ajouter 10 pi de lysat cellulaire à un microtube marqué. Ensuite, ajouter 50 pi de réactif de dosage de luciférase etdoucement vortex. Immédiatement après, placer le tube dans un support et mesurer la luminescence par l'intermédiaire du programme de double luciférase dans le luminomètre. Sélectionnez et appuyez sur les éléments suivants: Run Promega Protocoles → double Glo → OK.
      4. Ajouter 50 pi du réactif d'extinction dans le tube d'essai et doucement vortex. Mesurer la luminescence. Répétez ces étapes pour chaque échantillon.
      5. Analyser les données en utilisant une feuille de calcul en normalisant NFkB-RE au contrôle interne Renilla (NFkB-RE / Renilla). Comparer inhibiteur données à TNFa seul contrôle (TNFa seulement est fixé à 100%).
  3. NFkB-cible Gene Transcription
    1. Seed cellules MCF-7 dans des plaques 6 puits à 250.000 cellules par puits dans 2 ml de volume moyen préparés comme décrit dans la section 2.1.
    2. Le jour suivant, ajouter 2 ul de différentes GTCpFE 1,000x stocks (100, 50, 20, 10 et 1 mM) pendant 2 h avant d'ajouter / ml de TNFa pour une autre de 2 heures. Exécutez chaque traitementen trois exemplaires. Inclure les véhicules et les contrôles TNFa seul.
    3. Isoler l' ARN en utilisant le procédé d'extraction thiocyanate de guanidinium-phénol-chloroforme selon les instructions du fabricant 22. Déterminer la concentration d'ARN (dans de diéthyle (DEPC) d'eau -Traité) et la pureté de l'ARN en utilisant un spectrophotomètre. Conserver les échantillons d'ARN sur la glace ou conserver à -80 ° C. Utilisez uniquement des conseils de barrière RNase-free lors de la manipulation de l'ARN.
    4. Transcription inverse 0,5 pg d'ARN total en utilisant un kit disponible dans le commerce du virus de la leucémie murine de Moloney (M-MLV), la transcriptase inverse.
      NOTE: Le kit comprend 5x tampon et dithiothréitol (DTT), conjointement avec le mélange de dNTP, et aléatoire mélange des hexamères.
      1. Ajouter 0,5 pg d'ARN à 200 unités de M-MLV, 0,5 mM de dNTP, 100 ng d'hexamères aléatoires, 10 mM de DTT, 1x de tampon et de l'eau DEPC à un volume final de réaction de 10 ul. Effectuer la réaction de transcriptase inverse en utilisant un cycleur de PCR pendant 50 minutes à 37 ° C, puis 15 minutes à 70 ° C et# 176; C à la chaleur-inactiver l'enzyme.
    5. On dilue le produit ADNc résultant à 100 ul avec de l'eau bidistillée et en utilisant 2 pi de chaque réaction quantitative en chaîne par polymérase (PCR), une réaction ultérieure.
      1. Mélanger avant et arrière amorces pour le gène d'intérêt à 1,25 concentration en uM chacun. Préparer un mélange maître avec 2 pi d'eau distillée deux fois, 1 pl de 1,25 uM mélange d'amorces et 5 pi de 2x du colorant pour permettre la détection de l'ADN double brin. Charger les 2 pl d'ADNc et 8 pi de mélange maître en plaques PCR 96 puits.
    6. Effectuer une PCR quantitative en utilisant un système PCR en temps réel (40 cycles, 95-60 ° C) selon les instructions du fabricant et analyser les données manuellement.
      NOTE: Toutes les amorces de PCR utilisées ont été validés et déclarés précédemment 23.
    7. Calculer l'expression des gènes fois le changement en utilisant une feuille de calcul par la méthode ΔΔCt, avec la protéine ribosomique 36ARNm B4 servant de contrôle interne 23.

3. GTCpFE inhibe les cellules souches du cancer du sein in vitro

  1. Mammosphere Formation Assay
    1. Préparer mammosphere (MS) en complétant milieu Eagle modifié Dulbecco: rouge moyen sans mélange nutritif F-12 (DMEM / F12) phénol avec 1% de méthylcellulose. Laisser dissoudre par agitation douce nuit à 4 ° C. Stériliser par filtration du milieu et supplément avec B27 1x, 1% de pénicilline et de la streptomycine, 5 pg / ml d'insuline, 1 ug / ml d'hydrocortisone, et 20 ng / ml de facteur recombinant de croissance épidermique humain.
    2. Préparer des cellules individuelles de la lignée cellulaire MDA-MB-231 par digestion à la trypsine (trypsine 0,25% pendant 5 min à 37 ° C) de cultures en monocouche et filtrer à travers un tamis à mailles. compter manuellement les cellules dissociées seule et plaque dans des plaques à 96 puits fixation ultra-basse à une densité de 400 cellules / puits. Le jour suivant, ajouter des concentrations différentes de GTCPFE (par exemple, les concentrations finales GTCpFE: 1, 10, 20, 50 pm) pour obtenir un volume final est de 100 ul. Effectuer tous les traitements en triple.
    3. Après 7 jours de culture dans l'incubateur, acquérir des images via un logiciel d'imagerie à l'aide d'un microscope inversé. compter manuellement le nombre MS> 75 um de diamètre. Comparer le traitement médicamenteux pour le contrôle du véhicule.
      NOTE: Le diamètre de MS> 75 pm est déterminée en utilisant le logiciel d'imagerie.
  2. CD44 + CD24 - CSC immunophénotypage
    1. Trypsiniser MDA-MB-231 cellules avec 0,25% de trypsine pendant 5 min à 37 ° C. Comptez en utilisant un hémocytomètre et de semences en boîtes de 10 cm à 3 millions de cellules par boîte dans 10 ml de milieu tel que décrit dans la section 2.1. Ajouter véhicule (10 pi diméthylsulfoxyde) ou GTCpFE (10 pi de 50 mM) aux cellules pendant 72 heures.
    2. Pour les groupes de véhicules ou de traitement de GTCpFE, Trypsiniser cellules (comme à l'étape 3.2.1) et distribuer 1 million de cellules dans 'Test & #39; ou 5 ml tubes de polystyrène 'Contrôle' contenant 2 ml de solution saline équilibrée de Hank 1x (HBSS) tampon additionné de 2% de FBS.
    3. Tacher pour les marqueurs de surface CD44 et CD24, des cellules de spin et ajouter 20 pi de chaque anticorps conjugué et HBSS + 2% de FBS tubes à essai d'un volume total de 100 ul finaux (1: 5 de dilution). Ajouter 100 ul de HBSS + 2% de FBS à commande tubes. Inclure CD44-APC anticorps conjugué et de l'anticorps CD24-PE contrôles de taches simples ou les contrôles de immunoisotype IgG.
    4. Incuber les cellules dans l'obscurité à 4 ° C pendant 30 min. Centrifuger les cellules pendant 5 min à 400 x g et à reconstituer dans un tampon HBSS 200 ul avec 2% de FBS. Gardez les cellules sur la glace dans l'obscurité.
    5. Effectuer un tri cellulaire activé par fluorescence (FACS) de cellules vivantes en utilisant un appareil d'analyse par FACS selon les instructions du fabricant. Recueillir au moins 50.000 événements pour chaque tube. traitements en triple.
      NOTE: Gating est basé sur le contrôle de pas de coloration (Control Tube), immunoisotypes IgG et le CD44-APC et CD24-PE taches simples.
    6. Analyser les données en utilisant un logiciel de cytométrie de flux disponibles.
      NOTE: Le pour cent des cellules GTCpFE traités avec le CD44 + CD24 - immunophénotypage est estimée et comparée à la maîtrise du véhicule.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Sur la figure 1, la structure chimique de l' aspirine fumarate promédicament GTCpFE et son activité inhibitrice de la cytokine induite NFĸB voie dans les cellules du cancer du sein sont indiqués. GTCpFE inhibe les deux points d'extrémité NFĸB, NFĸB-RE activité luciférase (figure 1B) et l' expression des gènes cibles NFĸB, comme molécule d' adhésion intercellulaire 1 (ICAM1), une chimiokine CC motif Ligand 2 (CCL2) et facteur de nécrose tumorale (TNF) (fig 1C) dans les cellules MCF-7 du cancer du sein. Calculé la concentration inhibitrice à 50% (CI 50) , la valeur des deux points d' extrémité est d' environ 20 uM. IC 50 valeur est calculée à l' aide d' un logiciel graphique. A titre de comparaison ASA lui - même , même à 200 um (10 x CI50 de GTCpFE) ne montre aucune activité inhibitrice (figure 1B, ligne bleue) dans les cellules cancéreuses du sein. Ceci indique que la stratégie de promédicament consistant à ajouter fumarate pharmacophore à l'AAS significantly améliore son activité anti-NFĸB.

Pour mesurer l'activité anti-CSC, nous avons utilisé deux tests: le mammosphere (MS) essai de formation et de la population de cellules exprimant le CD44 + CD24 - immunophénotypage, une bonne CSC marqueur de surface de bonne foi dans le cancer du sein 24. MS GTCpFE inhibe la formation de MDA-MB-231 cellules de cancer du sein d'une manière dépendante de la dose représentée sur la figure 2A. Semblable à NFĸB voie d' inhibition dans les cultures adhérentes, la valeur IC 50 pour la formation mammosphere est ~ 20 uM. Cette cohérence est attendue, étant donné que les CSC comptent sur NFĸB de signalisation pour la survie et la propagation 16-21. En outre, GTCpFE prétraitement a entraîné une diminution significative du CD44 + CD24 - population (figure 2B) dans la MDA-MB-231 cellules. Ensemble, ces résultats établissent la capacité de GTCpFE de cibler efficacement les CSCs mammaires.

Figure 1
Figure 1: GTCpFE inhibe la voie NFĸB dans les cellules cancéreuses du sein. (A) La structure chimique de l'aspirine promédicament fumarate, GTCpFE. (B - C) cellules MCF-7 ont été pré-traitées pendant 2 heures avec différentes concentrations de GTCpFE, ASA, ou d'un véhicule suivi d' un traitement avec du TNFa (10 ng / ml) pendant 2-4 heures. Activité (B) NFkB-RE a été mesurée par dosage double rapporteur luciférase. (C) L' expression de gènes cibles NFkB, ICAM1, CCL2 et du TNF a été mesurée par RT-QPCR. Médicament activité inhibitrice est représentée graphiquement en tant que% du TNFa seul. Les données sont présentées sous forme de moyenne ± SEM. Ce chiffre a été modifié par la référence 15. S'il vous plaît cliquer ici pour voir une version plus grande de cette figuré.

Figure 2
Figure 2: GTCpFE inhibe la formation de mammosphere et CD44 + CD24 - immunophénotypage dans les cellules cancéreuses du sein. (A) mammosphere (MS) la formation de MDA-MB-231 a été mesurée après un traitement avec des concentrations variables de GTCpFE. Quantification de la croissance MS (à gauche) et des images représentatives de MS à 20X (à droite) sont représentés. L'effet de GTCpFE est tracée en commande% du véhicule. (B) Le CD44 + CD24 - population a été déterminée par analyse FACS de MDA-MB-231 cellules traitées avec 50 uM GTCpFE pour 72 heures. Quantification de chaque pourcentage de la population (à gauche) et des diagrammes de dispersion représentatifs du FACS (à droite) sont représentés. Les données sont présentées sous forme de moyenne ± SEM et l'analyse statistique des deux ANOVA folldue par Tukey posttest. *** P <0,001. Ce chiffre a été modifié par la référence 15.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
RPMI 1640 Red Medium Life Technologies  11875-093 Warm up to 37 °C before use
IMEM Corning 10-024-CV Warm up to 37 °C before use
DMEM / F12 Medium ThermoFisher 21041-025 Warm up to 37 °C before use
MEM NEAA 10 mM 100x Life Technologies  11140
Penicillin Streptomycin Life Technologies  15140-122
L-Glutamine 100x Life Technologies  25030-081
Insulin Sigma-Aldrich I-1882
Fetal Bovine Serum  Atlanta Biologicals S11150
Trypsin 2.5% 10x Invitrogen 15090046
Methyl Cellulose Sigma  M0262
B27 Supplement 50x Gibco 17504-044
EGF Gibco PHG0311L
NFκB-RE Luciferase Construct  Clontech  pGL4.32
Renilla Luciferase Construct  Promega pGL4.70
Lipofectamine 2000 ThermoFisher 11668-019
Dual-Luciferase Reporter Assay  Promega 120000032
NanoDrop Spectrophotometer ThermoFisher
Eppendorf Mastercycler  Eppendorf
StepOne Real Time PCR System Thermo Scientific
Eclipse Microscope Nikon
CyAn ADP Analyzer  Beckman Coulter
QCapture Software QImaging
Summit Software Beckman Coulter
GraphPad Software Prism
TRIzol ThermoFisher 15596-018
M-MLV Reverse Transcriptase Invitrogen 28025-013
100 mM dNTP Set Invitrogen 10297-018
Random Hexamers  Invitrogen 48190-011
Fast SYBR Green Master Mix ThermoFisher 4385612
Costar 96W, ultra low attachment  Corning 3474
HBSS, 1x ThermoFisher 14025134
CD44-APC conjugated antibody  BD Pharmingen 560990 Store at 4 °C, protect from light
CD24-PE antibody BD Pharmingen 560991 Store at 4 °C, protect from light
Recombinant Human TNFα Fisher 210TA100 
CCL2 Primer Forward Sequence AGAATCACCAGCAGCAAGTGTCC
CCL2 Primer Reverse Sequence TCCTGAACCCACTTCTGCTTGG
ICAM1 Primer Reverse Sequence TGACGAAGCCAGAGGTCTCAG
ICAM1 Primer Forward Sequence AGCGTCACCTTGGCTCTAGG
TNF Primer Forward Sequence AAGGGTGACCGACTCAGCG
TNF Primer Reverse Sequence ATCCCAAAGTAGACCTGCCCA
36B4 Primer Forward Sequence GTGTTCGACAATGGCAGCAT
36B4 Primer Reverse Sequence GACACCCTCCAGGAAGCGA
Sodium Hydroxide Sigma-Aldrich S5881-500G
4-Hydroxybenzyl Alcohol Sigma-Aldrich 20806-10G
O-Acetylsalicyloyl Chloride Sigma-Aldrich 165190-5G
Phosphorous Pentoxide Sigma-Aldrich 79610-100G
Ethyl Fumaroyl Chloride Sigma-Aldrich 669695-1G
Sodium Sulfate Sigma-Aldrich 246980-500G
4-Dimethylaminopyridine Sigma-Aldrich 714844-100ML 0.5 M in tetrahydrofuran
Triethylamine Sigma-Aldrich T0886-100ML
Toluene Sigma-Aldrich 244511-100ML
Ethyl Acetate Sigma-Aldrich 270989-100ML
Tetrahydrofuran Sigma-Aldrich 401757-2L
400 MHz FT NMR spectrometer  See Bruker’s Avance User’s Manual, version 000822 for details

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, 646-674 (2011).
  2. Cuzick, J., et al. Aspirin and non-steroidal anti-inflammatory drugs for cancer prevention: an international consensus statement. Lancet Oncol. 10, 501-507 (2009).
  3. Terry, M. B., et al. Association of frequency and duration of aspirin use and hormone receptor status with breast cancer risk. JAMA. 291, 2433-2440 (2004).
  4. Wang, D., Dubois, R. N. Cyclooxygenase-2: a potential target in breast cancer. Semin Oncol. 31, 64-73 (2004).
  5. Howe, L. R. Inflammation and breast cancer. Cyclooxygenase/prostaglandin signaling and breast cancer. Breast Cancer Res. 9. 9, 210 (2007).
  6. Kopp, E., Ghosh, S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 265, 956-959 (1994).
  7. Yin, M. J., Yamamoto, Y., Gaynor, R. B. The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta. Nature. 396, 77-80 (1998).
  8. Pierce, J. W., Read, M. A., Ding, H., Luscinskas, F. W., Collins, T. Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration. J Immunol. 156, 3961-3969 (1996).
  9. Frasor, J., El-Shennawy, L., Stender, J. D., Kastrati, I. NFkappaB affects estrogen receptor expression and activity in breast cancer through multiple mechanisms. Mol Cell Endocrinol. 418, 235-239 (2014).
  10. Perkins, N. D. The diverse and complex roles of NF-kappaB subunits in cancer. Nat Rev Cancer. 12, 121-132 (2012).
  11. DiDonato, J. A., Mercurio, F., Karin, M. NF-kappaB and the link between inflammation and cancer. Immunol Rev. 246, 379-400 (2012).
  12. Scarpignato, C., Hunt, R. H. Nonsteroidal antiinflammatory drug-related injury to the gastrointestinal tract: clinical picture, pathogenesis, and prevention. Gastroenterol Clin North Am. 39, 433-464 (2010).
  13. Sostres, C., Gargallo, C. J. Gastrointestinal lesions and complications of low-dose aspirin in the gastrointestinal tract. Best Pract Res Clin Gastroenterol. 26, 141-151 (2012).
  14. Kastrati, I., et al. Dimethyl Fumarate Inhibits the Nuclear Factor kappaB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein. J Biol Chem. 291, 3639-3647 (2016).
  15. Kastrati, I., et al. A novel aspirin prodrug inhibits NFkappaB activity and breast cancer stem cell properties. BMC Cancer. 15, 845 (2015).
  16. Cao, Y., Luo, J. L., Karin, M. IkappaB kinase alpha kinase activity is required for self-renewal of ErbB2/Her2-transformed mammary tumor-initiating cells. Proc Natl Acad Sci U S A. 104, 15852-15857 (2007).
  17. Liu, M., et al. The canonical NF-kappaB pathway governs mammary tumorigenesis in transgenic mice and tumor stem cell expansion. Cancer Res. 70, 10464-10473 (2010).
  18. Korkaya, H., Liu, S., Wicha, M. S. Regulation of cancer stem cells by cytokine networks: attacking cancer's inflammatory roots. Clin Cancer Res. 17, 6125-6129 (2011).
  19. Hinohara, K., et al. ErbB receptor tyrosine kinase/NF-kappaB signaling controls mammosphere formation in human breast cancer. Proc Natl Acad Sci U S A. 109, 6584-6589 (2012).
  20. Kendellen, M. F., Bradford, J. W., Lawrence, C. L., Clark, K. S., Baldwin, A. S. Canonical and non-canonical NF-kappaB signaling promotes breast cancer tumor-initiating cells. Oncogene. 33, 1297-1305 (2014).
  21. Yamamoto, M., et al. NF-kappaB non-cell-autonomously regulates cancer stem cell populations in the basal-like breast cancer subtype. Nat Commun. 4, 2299 (2013).
  22. Rio, D. C., Ares, M., Hannon, G. J., Nilsen, T. W. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc. (2010).
  23. Frasor, J., et al. Positive cross-talk between estrogen receptor and NF-kappaB in breast cancer. Cancer Res. 69, 8918-8925 (2009).
  24. Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., Clarke, M. F. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A. 100, 3983-3988 (2003).
  25. Vandermeeren, M., et al. Dimethylfumarate is an inhibitor of cytokine-induced nuclear translocation of NF-kappa B1, but not RelA in normal human dermal fibroblast cells. J Invest Dermatol. 116, 124-130 (2001).
  26. Loewe, R., et al. Dimethylfumarate inhibits TNF-induced nuclear entry of NF-kappa B/p65 in human endothelial cells. J Immunol. 168, 4781-4787 (2002).
  27. Seidel, P., et al. Dimethylfumarate inhibits NF-{kappa}B function at multiple levels to limit airway smooth muscle cell cytokine secretion. Am J Physiol Lung Cell Mol Physiol. 297, L326-L339 (2009).
  28. Wilms, H., et al. Dimethylfumarate inhibits microglial and astrocytic inflammation by suppressing the synthesis of nitric oxide, IL-1beta, TNF-alpha and IL-6 in an in-vitro model of brain inflammation. J Neuroinflammation. 7, 30 (2010).
  29. Peng, H., et al. Dimethyl fumarate inhibits dendritic cell maturation via nuclear factor kappaB (NF-kappaB) and extracellular signal-regulated kinase 1 and 2 (ERK1/2) and mitogen stress-activated kinase 1 (MSK1) signaling. J Biol Chem. 287, 28017-28026 (2012).
  30. Li, H. J., Reinhardt, F., Herschman, H. R., Weinberg, R. A. Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling. Cancer Discov. 2, 840-855 (2012).
  31. Li, X., et al. Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J Natl Cancer Inst. 100, 672-679 (2008).
  32. Diehn, M., et al. Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature. 458, 780-783 (2009).
  33. Hollier, B. G., Evans, K., Mani, S. A. The epithelial-to-mesenchymal transition and cancer stem cells: a coalition against cancer therapies. J Mammary Gland Biol Neoplasia. 14, 29-43 (2009).
  34. Velasco-Velazquez, M. A., Popov, V. M., Lisanti, M. P., Pestell, R. G. The role of breast cancer stem cells in metastasis and therapeutic implications. Am J Pathol. 179, 2-11 (2011).
  35. Dontu, G., et al. In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells. Genes Dev. 17, 1253-1270 (2003).
  36. Charafe-Jauffret, E., et al. Cancer stem cells in breast: current opinion and future challenges. Pathobiology. 75, 75-84 (2008).
  37. Clayton, H., Titley, I., Vivanco, M. Growth and differentiation of progenitor/stem cells derived from the human mammary gland. Exp Cell Res. 297, 444-460 (2004).
  38. Ginestier, C., et al. ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell. 1, 555-567 (2007).
  39. Rosen, J. M., Jordan, C. T. The increasing complexity of the cancer stem cell paradigm. Science. 324, 1670-1673 (2009).
  40. Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer. 8, 755-768 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics