Unchelated Gadolinium के लिए एक Aptamer आधारित सेंसर (तृतीय)

Published 1/09/2017
0 Comments
  CITE THIS  SHARE 
Chemistry

You must be subscribed to JoVE to access this content.

Fill out the form below to receive a free trial:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit," you agree to our policies.

 

Summary

Cite this Article

Copy Citation

Edogun, O., Chan, T. Y., Nguyen, N. H., Luu, A., Halim, M. An Aptamer-based Sensor for Unchelated Gadolinium(III). J. Vis. Exp. (119), e55216, doi:10.3791/55216 (2017).

Please note that all translations are automatically generated through Google Translate.

Click here for the english version. For other languages click here.

Abstract

Introduction

नैदानिक निदान, जो तकनीक के निहित संवेदनशीलता द्वारा सीमित है में चुंबकीय अनुनाद इमेजिंग (एमआरआई) के बढ़ते महत्व, उपन्यास gadolinium आधारित विपरीत एजेंट (GBCAs) 1 के विकास में अनुसंधान का तेजी से विकास हुआ है। GBCAs अणुओं है कि छवि गुणवत्ता में सुधार करने के लिए प्रशासित रहे हैं, और वे आम तौर पर एक त्रिसंयोजक gadolinium आयन (जी डी 3) एक polydentate ligand के लिए समन्वित की रासायनिक संरचना है। इस complexation unchelated जी.डी. के रूप में 3 + विषैला होता है के महत्व का है; यह गुर्दे की बीमारी या विफलता 2 के साथ कुछ रोगियों में नेफ्रोजेनिक प्रणालीगत फाइब्रोसिस के विकास में फंसाया गया है। नतीजतन, जलीय मुक्त आयन का पता लगाने के GBCAs की सुरक्षा सुनिश्चित करने में महत्वपूर्ण भूमिका निभाई है। GBCA समाधान में unchelated जी.डी. 3 + की उपस्थिति अक्सर ligand और आयन, परिसर की हदबंदी, या displacemen के बीच एक अधूरी प्रतिक्रिया का परिणाम हैअन्य जैविक धातु फैटायनों 3 से टी।

कई तकनीकों वर्तमान में जी.डी. 3 +, बहुमुखी प्रतिभा और प्रयोज्यता 4 के मामले में क्रोमैटोग्राफी और / या स्पेक्ट्रोमेट्री रैंक उच्चतम पर भरोसा उन की उपस्थिति निर्धारित करने के लिए प्रयोग किया जाता है के अलावा। उनकी शक्तियों के बीच उच्च संवेदनशीलता और सटीकता, विभिन्न नमूना matrices, और कई जी.डी. 3 + परिसरों के एक साथ मात्रा का ठहराव (मानव सीरम 5, मूत्र और बालों 6, अपशिष्ट 7, और इसके विपरीत एजेंट योगों 8 सहित) एक सूची का विश्लेषण करने के लिए (क्षमता है अध्ययन के 2013 से पहले Telgmann एट अल।) 4 से एक व्यापक समीक्षा में वर्णित है। केवल दोष यह है कि इन तरीकों में से कई (जैसे उपपादन द्वारा मिलकर प्लाज्मा मास स्पेक्ट्रोमेट्री के रूप में) instrumentations 4 की आवश्यकता है कि कुछ प्रयोगशालाओं के लिए उपयोग नहीं हो सकता है। अनुसंधान और सबूत की अवधारणा के स्तर, एआर पर उपन्यास GBCA खोज के संदर्भ मेंelatively अधिक सुविधाजनक, तेजी से, और लागत प्रभावी स्पेक्ट्रोस्कोपी आधारित पद्धति (जैसे यूवी विज़ अवशोषण या प्रतिदीप्ति के रूप में) एक मूल्यवान विकल्प के रूप में सेवा कर सकते हैं। मन में इन अनुप्रयोगों के साथ, जलीय जी.डी. 3 + के लिए एक फ्लोरोसेंट aptamer आधारित सेंसर विकसित किया गया था 9।

Aptamer (जी.डी.-aptamer) अड्डों में से एक विशिष्ट अनुक्रम कि घातीय संवर्धन (SELEX) 9 से ligands के व्यवस्थित विकास की प्रक्रिया के माध्यम से अलग किया गया था के साथ एक 44 आधार लंबे एकल असहाय डीएनए अणु है। एक फ्लोरोसेंट सेंसर में aptamer अनुकूल करने के लिए, एक fluorophore किनारा, जो फिर एक शमन किनारा (क्यूएस) 13 पूरक कुर्सियां (चित्रा 1) के माध्यम से के साथ संकरित है 5 'टर्मिनस से जुड़ा हुआ है। क्यूएस 3 'टर्मिनस पर एक काले पेय अणु के साथ टैग है। जी.डी. 3 +, सेंसर (जी.डी.-सेंसर) के अभाव में, एक 1 के शामिल में: क्रमश: जी.डी.-aptamer और क्यु के 2 तिल अनुपात, कम से कम प्रतिदीप्ति उत्सर्जन की वजह से टी होगापीने की वस्तु को fluorophore से o ऊर्जा हस्तांतरण। जलीय जी.डी. 3 + के अलावा जी.डी.-aptamer से क्यु विस्थापित, प्रतिदीप्ति उत्सर्जन में वृद्धि में जिसके परिणामस्वरूप।

आकृति 1
चित्रा 1. सेंसर (जी.डी.-सेंसर) है कि 44 आधार लंबे aptamer (जी.डी.-aptamer) fluorescein (एक fluorophore) और 13 आधार लंबे शमन किनारा (क्यूएस) dabcyl के साथ टैग के साथ टैग (एक अंधेरे पीने की वस्तु) के होते हैं । Unchelated जी.डी. 3 + के अभाव में, सेंसर की रोशनी कम है। जी.डी. 3 + के अलावा के साथ, क्यु के विस्थापन होता है और प्रतिदीप्ति उत्सर्जन में वृद्धि मनाया जाता है। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

वर्तमान में नहीं है, के लिए पता लगाने के लिए एक अधिक इस्तेमाल किया स्पेक्ट्रोस्कोपी आधारित पद्धतिजलीय जी.डी. 3 + हैैं। इस परख अणु xylenol नारंगी, जो आयन 10 के लिए 433 573 एनएम से अधिकतम अवशोषण तरंग दैर्ध्य में बदलाव केलेशन पर से होकर गुजरती है का उपयोग करता है। इन दो absorbance Maxima के अनुपात unchelated जी.डी. 3 + की राशि यों इस्तेमाल किया जा सकता है। aptamer सेंसर, एक विकल्प (भी पूरक हो सकता है) xylenol नारंगी परख करने के लिए है के रूप में दो अलग अलग तरीकों प्रतिक्रिया की स्थिति, लक्ष्य selectivities, मात्रा का ठहराव के रैखिक पर्वतमाला, और पता लगाने के तौर-तरीकों (जैसे पीएच और इस्तेमाल बफर समाधान की संरचना के रूप में) है 9।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

नोट: आणविक जीव विज्ञान ग्रेड पानी सब बफर और समाधान की तैयारी में प्रयोग किया जाता है। सभी डिस्पोजेबल ट्यूब (microcentrifuge और पीसीआर) और pipet सुझावों DNase- और RNase मुक्त कर रहे हैं। उपयोग करने से पहले सभी रसायनों के लिए सामग्री सुरक्षा डाटा शीट (MSDS) से परामर्श करें। उपयुक्त व्यक्तिगत सुरक्षा उपकरण (पीपीई) का उपयोग पुरजोर सिफारिश की है।

1. Aptamer स्टॉक समाधान की तैयारी

  1. व्यावसायिक रूप से polydeoxynucleotide के 2 किस्में खरीदें। शुद्धि के साथ दोनों किस्में आदेश में उच्च प्रदर्शन तरल क्रोमैटोग्राफी (एचपीएलसी) के माध्यम से।
    किनारा 1 (जी.डी.-aptamer):
    5 '- / 56-परिवार / AGGCTCTCGGGACGACCAGTTGGTCCCGCTTTATGTGTCCCGAG -3'
    कतरा 2 (क्यूएस):
    5'-GTCCCGAGAGCCT / 3Dab / -3 '
  2. जी.डी.-aptamer और क्यु की 100 माइक्रोन के अलग-अलग स्टॉक समाधान बनाने के लिए पानी में हर कतरा भंग।
  3. -20 डिग्री सेल्सियस पर इन समाधान स्टोर। समाधान इस प्रकार अब तक, 3 साल के लिए स्थिर रहे हैं।
  4. freez कम करने के लिएई-पिघलना चक्र, 10 μL aliquots में स्टॉक समाधान की दुकान।

2. 2x जी.डी.-सेंसर समाधान की तैयारी

  1. परख बफर तैयार (20 मिमी HEPES, 2 मिमी 2 MgCl, 150 मिमी NaCl, 5 मिमी KCl)। NaOH और एचसीएल के साथ पीएच 7.4 ~ समायोजित करें, और 0.2 माइक्रोन PES झिल्ली के साथ बाँझ डिस्पोजेबल बोतल शीर्ष फिल्टर के माध्यम से फिल्टर। बाँझ बोतल में स्टोर। अगर फ़िल्टर और (कमरे के तापमान पर) ठीक से संग्रहीत, बफर इस प्रकार अब तक, 2 साल के लिए स्थिर है।
  2. जी.डी.-aptamer शेयर समाधान परख बफर के 497 μL में और क्यु शेयर समाधान (1.2 कदम से) के 2 μL (1.2 कदम से) के 1 μL पतला। अच्छी तरह मिक्स एक भंवर का उपयोग। 2x जी.डी.-सेंसर समाधान में उनकी सांद्रता 200 एनएम और 400 एनएम, क्रमशः रहे हैं।
    नोट: - अंशांकन वक्र और विपरीत एजेंट के समाधान के लिए जी.डी. की 3 + 7 अलग सांद्रता 2x जी.डी.-सेंसर समाधान इस चरण में तैयार की मात्रा 500 μL, जो 6 का परीक्षण करने के लिए पर्याप्त है(चरण 3)। प्रत्येक नमूना एक 384 अच्छी तरह से थाली में डुप्लिकेट कुओं दे देंगे।
    1. परीक्षण किया जाना चाहिए कि जी.डी. 3 + समाधान की संख्या के अनुसार 2x जी.डी.-सेंसर समाधान की मात्रा समायोजित करें।
  3. प्रत्येक ट्यूब में 50 μL के साथ 9 पीसीआर ट्यूबों में 2x जी.डी.-सेंसर समाधान स्थानांतरण,। एक थर्मल cycler में ट्यूबों रखें।
  4. थर्मल cycler में कार्यक्रम निर्धारित 95 डिग्री सेल्सियस के लिए ट्यूब में समाधान करने के लिए गर्मी, 5 मिनट के लिए पकड़ है, और फिर धीरे धीरे समाधान 25 डिग्री सेल्सियस ~ 15 मिनट (की दर से शांत ~ 0.05 - 0.1 डिग्री सेल्सियस / s)। हीटिंग और ठंडा चक्र जी.डी.-aptamer और क्यु बीच इष्टतम संकरण सुनिश्चित करने के लिए है। अधूरा शमन और सेंसर के एक उच्च पृष्ठभूमि प्रतिदीप्ति में आंशिक संकरण का परिणाम है। अगर एक थर्मल साइक्लर उपलब्ध नहीं है, इस प्रक्रिया के बजाय एक गर्म पानी से स्नान का उपयोग कर बाहर ले।
  5. एक बार 25 डिग्री सेल्सियस तक ठंडा, तुरंत समाधान का उपयोग करें, या (लगभग 2 घंटे तक) तक होने के लिए तैयार थर्मल cycler में रखनाउपयोग किया गया। एक पानी के स्नान गर्म करने के लिए प्रयोग किया जाता है, स्नान में ट्यूबों को छोड़ के रूप में पानी धीरे-धीरे कमरे के तापमान को ठंडा।

3. प्रतिदीप्ति अंशांकन वक्र का निर्माण और जी.डी. विपरीत एजेंट का एक समाधान में 3 + Unchelated जी.डी. की उपस्थिति का पता लगाने

  1. GdCl 3 परख बफर में ठोस (2.1 कदम के रूप में ही बफर) भंग।
  2. धारावाहिक कमजोर पड़ने के माध्यम से, अंशांकन वक्र (2x समाधान) के लिए अंतिम वांछित सांद्रता के डबल से कम 100 μL 6 अलग जी.डी. 3 + microcentrifuge ट्यूब में समाधान के प्रत्येक तैयार करते हैं।
    1. उदाहरण के लिए, 0 के लिए एक अंशांकन निर्माण, 50, 100, 200, 400 (कोई GdCl 3 के साथ ही बफर), और जी.डी. 3 + की 800 एनएम, 0, 100, 200, 400, 800, और 1600 एनएम युक्त समाधान तैयार करने के लिए आयन की। सुनिश्चित करें कि हमेशा नकारात्मक नियंत्रण के रूप में 0 एनएम जी.डी. 3 + के साथ 'खाली' शामिल करने के लिए सुनिश्चित करें।
  3. इसके विपरीत एजेंट भंग होने का परीक्षणपरख बफर में एड। धारावाहिक कमजोर पड़ने के माध्यम से विपरीत एजेंट के समाधान के लिए 2 या 3 अलग सांद्रता तैयार करें।
    नोट: विपरीत एजेंट समाधान के 3 अलग अलग सांद्रता परीक्षण की सिफारिश की है। यह सुनिश्चित करें कि इन सांद्रता रैखिक सीमा के भीतर कर रहे हैं। नमूनों की जांच एक रैखिक संबंध प्रदर्शित नहीं करते, इसके विपरीत एजेंट की सांद्रता को कम तो किया करते थे।
  4. 2.5 कदम से 2x जी.डी.-सेंसर समाधान थर्मल साइक्लर से बाहर युक्त पीसीआर नलियों ले लो।
  5. 3.2 कदम से प्रत्येक जी.डी. 3 + समाधान के 50 μL 2x जी.डी.-सेंसर युक्त समाधान 9 पीसीआर नलियों के 6 में जोड़ें। ऊपर और नीचे pipetting द्वारा मिक्स। प्रत्येक पीसीआर ट्यूब अब जी.डी. 3 + के वांछित एकाग्रता का परीक्षण किया जा करने के लिए, 100 एनएम जी.डी.-aptamer, और 200 एनएम क्यु होता है।
  6. 2x जी.डी.-सेंसर समाधान युक्त शेष पीसीआर ट्यूबों के लिए, 3.3 कदम से विपरीत एजेंट के समाधान के 50 μL जोड़ें। ऊपर pipetting द्वारा और एक बार कुछ नीचे अच्छी तरह से मिलाएं।
  7. सेते रोंकमरे के तापमान पर लगभग 5 मिनट के लिए पीसीआर नलियों में olutions। वे अप करने के लिए 30 मिनट के लिए खड़े करने के लिए छोड़ा जा सकता है।
  8. 384 अच्छी तरह से थाली में प्रत्येक ट्यूब के हस्तांतरण के 45 μL। प्रत्येक पीसीआर ट्यूब डुप्लिकेट कुओं दे देंगे।
  9. एक प्लेट रीडर पर अच्छी तरह से प्रत्येक के प्रतिदीप्ति रिकॉर्ड। fluorophore (परिवार) जी.डी.-सेंसर डिजाइन में इस्तेमाल आपूर्तिकर्ता की वेबसाइट पर सूचीबद्ध के रूप में क्रमश: 495 और 520 एनएम का उत्तेजना और उत्सर्जन Maxima है। उचित उत्तेजना और उत्सर्जन तरंग दैर्ध्य या फिल्टर है कि क्या प्लेट पाठक monochromator- या फिल्टर आधारित है पर निर्भर करता है चुनें।
  10. जी.डी. 3 + की एकाग्रता के खिलाफ मनमाना प्रतिदीप्ति इकाइयों (AFU) में प्रतिदीप्ति का ग्राफ प्लॉट।
  11. जी.डी. 3 + की एकाग्रता के खिलाफ प्रतिदीप्ति गुना परिवर्तन के रूप में ग्राफ प्लॉट। 'खाली' समाधान की AFU (जी डी 0 एनएम 3 + के साथ) द्वारा प्रत्येक एकाग्रता की AFU विभाजित करके प्रतिदीप्ति गुना परिवर्तन की गणना। प्रतिदीप्ति गुना परिवर्तन N के लिए अनुमति देगापरिणामों की ormalization, AFU प्रदर्शन कुछ आवधिक (अलग-अलग दिन, आदि) बदलाव करना चाहिए।
  12. जो युक्त 0 एनएम GdCl 3 (केवल बफर) समाधान है समाधान विपरीत एजेंट युक्त और 'खाली' की प्रतिदीप्ति उत्सर्जन की तुलना करें।
    नोट: GBCA समाधान के एक उच्च प्रतिदीप्ति unchelated जी.डी. 3 + की उपस्थिति है, जो विपरीत एजेंट के आगे शुद्धि की जरूरत हो सकती निकलता है। Unchelated जी.डी. 3 + वर्तमान की राशि अंशांकन वक्र कदम 3.10 या 3.11 में निर्माण का उपयोग कर अनुमान लगाया जा सकता है।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Unchelated जी.डी. 3 + की उपस्थिति में जी.डी.-सेंसर समाधान का एक विशिष्ट प्रतिदीप्ति परिवर्तन चित्रा 2 में दिखाया गया है। उत्सर्जन प्रतिदीप्ति गुना परिवर्तन (2A चित्रा) या मनमाना इकाइयों में कच्चे प्रतिदीप्ति पढ़ने (चित्रा 2 बी) के रूप में साजिश रची जा सकता है (AFU)। दोनों भूखंडों> 3 सुक्ष्ममापी पर 1 माइक्रोन और संकेत के संतृप्ति नीचे जी.डी. की सांद्रता के लिए एक रैखिक सीमा 3 + के साथ बहुत समान अंशांकन घटता निकलेगा। पता लगाने की सीमा 3 के एक संकेत करने वाली शोर अनुपात के साथ ~ 100 एनएम है।

ब्याज की GBCA युक्त समाधान में, unchelated जी.डी. 3 + की उपस्थिति में जब 'खाली' समाधान की तुलना में सेंसर की एक प्रतिदीप्ति वृद्धि में अनुवाद किया जाएगा। जी.डी.-DOTA जटिल है, अन्य की तुलना में अधिक शुद्धता से एक के 2 अलग बैचों के समाधान में प्रतिदीप्ति परिवर्तन, शो कर रहे हैंn प्रतिनिधि परिणामों के उदाहरण के रूप में (चित्रा 3)। जी.डी.-DOTA (gadoteric एसिड) जी.डी. की एक gadolinium जटिल 3 + एक कार्बनिक ligand DOTA है कि एक व्यावसायिक विपरीत एजेंट में पाया जाता है से घिरा हुआ है। उच्च शुद्धता के बैच जी.डी.-DotA की 20 मिमी के लिए उत्सर्जन अप में एक उल्लेखनीय वृद्धि प्रदर्शित नहीं करता है। जब unchelated जी.डी. 3 + मौजूद है, एक परिवर्तन है कि यहां तक कि 5 मिमी नीचे जी.डी.-DOTA सांद्रता में ध्यान देने योग्य है मनाया जाता है। इस उदाहरण है जहां डाटा अंक सेंसर की प्रतिदीप्ति गुना परिवर्तन के रूप में प्लॉट किए जाते हैं में, unchelated जी.डी. 3 + की राशि की मात्रा का ठहराव चित्रा 2A में अंशांकन वक्र का उपयोग कर अनुमान लगाया जा सकता है।

चित्र 2
चित्रा 2. प्रतिनिधि जी.डी.-सेंसर प्रतिदीप्ति अंशांकन वक्र भूखंडों। सभी डेटा अंक डुप्लिकेट में कम से कम प्रदर्शन किया गया और औसत साजिश मूल्योंत्रुटि सलाखों के रूप में मानक विचलन के साथ टेड। (ए) एक अंशांकन वक्र 100 एनएम जी.डी.-aptamer और 200 एनएम क्यु उपयोग कर प्राप्त किया। ग्राफ वाई अक्ष के रूप में प्रतिदीप्ति गुना परिवर्तन के साथ साजिश रची है। (बी) वाई अक्ष के रूप में मनमाना इकाइयों (AFU) में कच्चे प्रतिदीप्ति के साथ (ए) के रूप में ही अंशांकन वक्र। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र तीन
चित्रा 3. प्रतिनिधि जी.डी.-सेंसर प्रतिदीप्ति परिवर्तन जब जी.डी.-DOTA अणु के नमूनों में unchelated जी.डी. 3 + की उपस्थिति का परीक्षण। जी.डी.-DOTA जटिल समाधान के दो अलग अलग बैचों इस साजिश में दिखाया जाता है, उच्च शुद्धता (वृत्त मार्कर) और अन्य युक्त unchelated जी.डी. 3 + में से एक (नीला trianglई मार्कर)। प्रत्येक डेटा बिंदु त्रुटि सलाखों के रूप में मानक विचलन के साथ दो रीडिंग के एक औसत है। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Aptamer आधारित जी.डी.-सेंसर, प्रतिदीप्ति उत्सर्जन में वृद्धि हुई है कि unchelated जी.डी. 3 + की एकाग्रता मनाया जाता है के लिए आनुपातिक है का उपयोग करना। इस्तेमाल नमूना की मात्रा को कम करने के लिए, परख अच्छी तरह से प्रति 45 μL की कुल नमूना मात्रा के साथ एक 384 अच्छी तरह से microplate में चलाया जा सकता है। इस डिजाइन में, fluorescein (परिवार) और dabcyl (थपका) के चुनाव के लिए मुख्य रूप से अभिकर्मकों की लागत के आधार पर किया गया था; उत्सर्जन तरंगदैर्ध्य, fluorophore का एक अलग बाँधना को संशोधित करने और पेय 11 में इस्तेमाल किया जा सकता है।

यह ध्यान रखें कि सेंसर के साथ सबसे अच्छा परिणाम प्राप्त करने के लिए महत्वपूर्ण है, महत्वपूर्ण कदमों में से एक परख बफर में 95 डिग्री सेल्सियस और धीमी गति से ठंडा (2.4 कदम) के लिए हीटिंग जी.डी.-aptamer और क्यु बीच इष्टतम संकरण को प्राप्त करने के लिए है किस्में। पहले से प्रोटोकॉल में उल्लेख किया है, अगर एक थर्मल साइक्लर उपलब्ध नहीं है, 95 डिग्री सेल्सियस पर ऊष्मायन बाहर एक पानी के स्नान में किया जा सकता है। नियंत्रित करने के लिए एक और महत्वपूर्ण पैरामीटर टी हैवह बफर समाधान की रचनाओं; 2.1 कदम विपरीत एजेंट को भंग करने में सूचीबद्ध परख बफर के उपयोग की सिफारिश की है, या विआयनीकृत पानी भी इस्तेमाल किया जा सकता है। हालांकि, समाधान है कि संभावित interferents शामिल नहीं होना चाहिए। इस तरह के एक बफर का एक उदाहरण है कि एक फॉस्फेट anions, जो unchelated जी.डी. करने के लिए समन्वय कर सकते हैं 3 + अघुलनशील gadolinium फॉस्फेट 12 फार्म के लिए होता है। वेग एक झूठी नकारात्मक परिणाम में जिसके परिणामस्वरूप सेंसर के साथ प्रतिक्रिया नहीं देंगे।

प्रयोगों में कुछ कदम परिणाम को प्रभावित किए बिना संशोधित किया जा सकता है। सबसे पहले, परख और गणना को आसान बनाने के लिए, दोनों जी.डी.-सेंसर समाधान और 2x सांद्रता में अंशांकन वक्र के लिए जलीय GdCl 3 तैयार करते हैं। अगर वांछित, अन्य कमजोर पड़ने कारकों प्रदान की है कि जी.डी.-aptamer के अंतिम परख सांद्रता और क्यु क्रमश: 100 एनएम और 200 एनएम पर रखा जाता है, (उदाहरण के लिए, 10x समाधान) का इस्तेमाल किया जा सकता है। दूसरा, परख बफर घOES बिल्कुल 7.4 पीएच होने की जरूरत नहीं। 7 के बीच कोई मान - 7.4 के रूप में लंबे समय के रूप में एक ही बफर प्रयोग भर में प्रयोग किया जाता है वांछित प्रतिदीप्ति वृद्धि का उत्पादन होगा। तीसरा, एक बार प्रतिदीप्ति उत्सर्जन पढ़ने प्राप्त की है, डेटा अंक या तो मनमाना इकाई में कच्चे प्रतिदीप्ति (AFU) के रूप में या प्रतिदीप्ति गुना परिवर्तन के रूप में साजिश रची जा सकता है। प्रतिदीप्ति गुना परिवर्तन की गणना करने के लिए, प्रत्येक एकाग्रता के कच्चे प्रतिदीप्ति पढ़ने (से विभाजित) नकारात्मक नियंत्रण (0 एनएम जी.डी. 3) के पढ़ने के लिए सामान्यीकृत है। के रूप में आंकड़े 2A और बी में दिखाया गया है, दोनों भूखंडों में प्रतिदीप्ति उत्सर्जन प्रवृत्तियों लगभग समान हैं। गुना परिवर्तन डेटा का विश्लेषण करने के लिए एक और अधिक सुविधाजनक तरीका प्लेट पाठक अलग अलग समय पर दर्ज कच्चे रीडिंग में कुछ बदलाव को प्रदर्शित करता है, तो हो सकता है। अंत में, यदि प्रयोगशाला एक fluorometer नहीं, बल्कि एक प्लेट रीडर के साथ सुसज्जित है, प्रत्येक डेटा बिंदु एक क्युवेट का उपयोग कर, एक microplate के बजाय मापा जा सकता है। आकार ओ पर निर्भर करता हैच उपलब्ध cuvettes, परख में तैयार समाधान की मात्रा समायोजित करने की आवश्यकता हो सकती है।

विधि के साथ साथ सूचना chromatographic- के लिए एक विकल्प प्रदान करता है और / या जलीय जी.डी. 3 + पता लगाने के लिए spectrometric आधारित तकनीक। उत्तरार्द्ध की तुलना में, जी.डी.-सेंसर परख कई प्रजातियों के एक साथ पता लगाने के लिए संवेदनशीलता, सटीकता और क्षमता के मामले में और अधिक सीमित है। दूसरी ओर, स्पेक्ट्रोस्कोपी आधारित सेंसर एक उपकरण संभवतः अधिक आसानी से उपलब्ध, एक कम समय अवधि के भीतर किया जा सकता है हो सकता है कि आवश्यकता है, और नमूना तैयार करने में कम है। इसके विपरीत एजेंट बस बफर समाधान में भंग किया जा सकता है, जी.डी.-सेंसर समाधान के साथ मिश्रित, और प्रतिदीप्ति उत्सर्जन सीधे मापा। इसके अलावा, सेंसर 3 + unchelated जी.डी. का एक बहुत कम एकाग्रता का पता लगाने के xylenol नारंगी सूचक (दो तरीकों के बीच परिमाण अंतर के बारे में 2 आदेश) की तुलना में सक्षम है और एक हैकई अन्य जैविक रूप से महत्वपूर्ण है और संक्रमण धातु आयनों अधिक 9 जी.डी. 3 + के लिए उच्च चयनात्मकता।

इस परख है कि कुछ प्रयोगात्मक परिस्थितियों में इसके उपयोग को प्रतिबंधित कर सकते हैं की दो कमियां हैं। एक सीमा है कि सेंसर जी.डी. के लिए 3 + विशिष्ट नहीं है; यह अन्य lanthanide आयनों 9 (जैसे यूरोपीय संघ 3 + 3 + और टीबी के रूप में) के लिए एक प्रतिक्रिया को प्रदर्शित करता है। हालांकि, इन आयनों आमतौर पर विपरीत एजेंटों में पाया या जैविक प्रणालियों नहीं हैं और इसलिए, उनके हस्तक्षेप कम कर रहे हैं। नोट करने के लिए दूसरी बात यह है कि जी.डी. 3 +, जी.डी.-सेंसर प्रतिदीप्ति उत्सर्जन में एक क्रमिक कमी की उच्च सांद्रता में (ऊपर ~ 10 माइक्रोन) के लिए मनाया जाता है। Lanthanide आयनों द्वारा शमन का असर एक अच्छी तरह से प्रलेखित घटना 13 है कि यह भी पता लगाने और उन्हें 14 बढ़ाता के लिए एक तकनीक के रूप में इस्तेमाल किया गया है। इस जी.डी. की उच्च सांद्रता को मापने के लिए सेंसर की उपयोगिता को सीमित करता है जबकि 3 +

इस काम में, जलीय घोल में विषाक्त unchelated जी.डी. 3 + का पता लगाने के लिए एक सुविधाजनक प्रतिदीप्ति आधारित तकनीक का उपयोग वर्णित किया गया है। इस परख gadolinium आधारित विपरीत एजेंट पवित्रता के प्रारंभिक चरण के मूल्यांकन के लिए है, विशेष रूप से संश्लेषण और इन विट्रो प्रयोगों के लिए तैयार करने के दौरान। निदान में चुंबकीय अनुनाद इमेजिंग की वर्तमान विकास के साथ, उपन्यास विपरीत एजेंटों की संख्या बढ़ रही लगातार बनाया गया है और परीक्षण किया जा रहा है। Aptamer आधारित जी.डी.-सेंसर तेजी से परिवेश पीएच पर जलीय घोल में unreacted या अलग जी.डी. 3 + के उप-micromolar सांद्रता की उपस्थिति का पता लगाने के लिए एक साधन उपलब्ध कराने के द्वारा इस विकास की सुविधा होगी। इसके अलावा, के बाद से सेंसर अन्य त्रिसंयोजक lanthanide आयनों के साथ पार जेट को प्रदर्शित करता है, अपने आवेदन किया जा सकता हैअनुसंधान के इन क्षेत्रों के लिए बढ़ा दिया।

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Gd-aptamer IDTDNA Input sequence and fluorophore modification in the order form A fluorophore with a different emission wavelength may be used. The aptamer may also be ordered from another company.
Quenching strand IDTDNA Input sequence and quencher modification in the order form A different quencher for optimal energy transfer from the fluorophore may be used. The aptamer may also be ordered from another company.
Molecular biology grade water No specific manufacturer, both DEPC or non-DEPC treated work equally well
Gadolinium(III) chloride anhydrous Strem 936416 Toxic
HEPES Fisher Scientific BP310-500
Magnesium chloride anhydrous MP Biomedicals 0520984480 - 100 g
Sodium Chloride Acros Organics 327300025
Potassium chloride Fisher Scientific P333-500
Sodium hydroxide, pellets Fisher Scientific BP359 Corrosive
Hydrochloric acid Fisher Scientific SA49 Toxic and corrosive
384-well low flange black flat bottom polystyrene NBS plates Corning 3575 Plates which are suitable for fluorescence reading are required.
Nalgene Rapid-Flow sterile disposable bottle top filter Thermo Scientific 5680020 The bottle top is fitted with 0.2 micron PES membrane
Disposable sterile bottles 250 mL Corning 430281 A larger or smaller bottle may be used
1.5 mL microcentrifuge tubes No specific manufacturer, as long as they are DNAse and RNAse-free
0.2 mL PCR tubes No specific manufacturer, as long as they are DNAse and RNAse-free
Micropipets No specific manufacturer
Pipet tips (non filter) of appropriate sizes No specific manufacturer, as long as they are DNAse and RNAse-free
Equipment
Plate reader Biotek Synergy H1 Plate readers from other manufacturers would work equally well

DOWNLOAD MATERIALS LIST

References

  1. Shen, C., New, E. J. Promising strategies for Gd-based responsive magnetic resonance imaging contrast agents. Curr. Opin. Chem. Biol. 17, (2), 158-166 (2013).
  2. Cheong, B. Y. C., Muthupillai, R. Nephrogenic systemic fibrosis: a concise review for cardiologists. Tex. Heart Inst. J. 37, (5), 508-515 (2010).
  3. Hao, D., Ai, T., Goerner, F., Hu, X., Runge, V. M., Tweedle, M. MRI contrast agents: basic chemistry and safety. J Magn. Reson. Imaging. 36, (5), 1060-1071 (2012).
  4. Telgmann, L., Sperling, M., Karst, U. Determination of gadolinium-based MRI contrast agents in biological and environmental samples: a review. Anal. Chim. Acta. 764, 1-16 (2013).
  5. Frenzel, T., Lengsfeld, P., Schirmer, H., Hütter, J., Weinmann, H. -J. Stability of gadolinium-based magnetic resonance imaging contrast agents in human serum at 37 degrees C. Invest. Radiol. 43, (12), 817-828 (2008).
  6. Loreti, V., Bettmer, J. Determination of the MRI contrast agent Gd-DTPA by SEC-ICP-MS. Anal. Bioanal. Chem. 379, (7), 1050-1054 (2004).
  7. Telgmann, L., et al. Speciation and isotope dilution analysis of gadolinium-based contrast agents in wastewater. Environ. Sci. Technol. 46, (21), 11929-11936 (2012).
  8. Cleveland, D., et al. Chromatographic methods for the quantification of free and chelated gadolinium species in MRI contrast agent formulations. Anal. Bioanal. Chem. 398, (7), 2987-2995 (2010).
  9. Edogun, O., Nguyen, N. H., Halim, M. Fluorescent single-stranded DNA-based assay for detecting unchelated gadolinium(III) ions in aqueous solution. Anal. Bioanal. Chem. 408, (15), 4121-4131 (2016).
  10. Barge, A., Cravotto, G., Gianolio, E., Fedeli, F. How to determine free Gd and free ligand in solution of Gd chelates. A technical note. Contrast Med. Mol. Imaging. 1, (5), 184-188 (2006).
  11. Johansson, M. K. Choosing reporter-quencher pairs for efficient quenching through formation of intramolecular dimers. Methods Mol. Biol. 335, 17-29 (2006).
  12. Sherry, A. D., Caravan, P., Lenkinski, R. E. A primer on gadolinium chemistry. J. Magn. Reson. Imaging. 30, (6), 1240-1248 (2009).
  13. Shakhverdov, T. A. A cross-relaxation mechanism of fluorescence quenching in complexes of lanthanide ions with organic ligands. Opt. Spectrosc. 95, (4), 571-580 (2003).
  14. Brittain, H. G. Submicrogram determination of lanthanides through quenching of calcein blue fluorescence. Anal. Chem. 59, (8), 1122-1125 (1987).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats