Bitki büyüme ve Floral daldırma dönüşümün Agrobacterium aracılı Extremophyte Schrenkiella parvula

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Agrobacterium aracılı dönüşümü daldırma çiçek yöntemini kullanarak başarılı bir şekilde Schrenkiella parvulaextremophyte modelinin kararlı transgenik satırları oluşturmak için istihdam edilebilir. Biz bundan farklı büyüme alışkanlıkları ve extremophyte fizyolojik özellikleri dikkate alınarak Arabidopsis thalianaiçin değiştirilmiş bir iletişim kuralı mevcut.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Wang, G., Pantha, P., Tran, K. N., Oh, D. H., Dassanayake, M. Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula. J. Vis. Exp. (143), e58544, doi:10.3791/58544 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Schrenkiella parvula bir extremophyte birden fazla iyon toksisite gerilmeler de dahil olmak üzere çeşitli abiyotik stres için adapte olduğunu. Rağmen yüksek kaliteli genomik kaynakları kullanılabilir nasıl bitkiler için çevre uyum çalışmaya vurguluyor, fonksiyonel genomik model olarak değerini ve aracı uygun dönüşüm sistemi eksikliği tarafından sınırlı. Bu protokol için biz nasıl istikrarlı transgenik S. parvula oluşturmak için raporu bir Agrobacterium aracılı çiçek daldırma yöntemiyle hatları. S. parvula, benzersiz özellikleri bir belirsiz çiçekli alışkanlık ve yapraklarda yüksek epicuticular balmumu içeriği gibi hesaba A. thaliana için kullanılan dönüştürme iletişim kuralını değiştiren. Kısaca, S. parvula tohum dikim önce beş gün boyunca 4 ° C'de tabakalı. Bitkiler bir photoperiod 14 h ışık ve 10 h karanlık ve bir 130 µmol m-2s-1 ışık şiddeti, 22 ° c ile 24 ° c de yetiştirilmiştir Sekiz dokuz haftalık bitkiler birden fazla çiçek ile dönüşüm için seçildi. Bu çiçek pMP90RK plazmid taşıyan bir infiltrasyon çözümde Agrobacterium tumefaciens GV3101, daldırma. Çiçek üç ila dört hafta dönüşüm verimliliği artırmak için zaman aralığı ile daldırma iki tur gerçekleştirilen. T1 tohum toplanmış ve çimlenme için aday ekran satırları dönüşüm önce dört hafta için bir konteyner Nem Çekiciler ile kurutulmuş. BASTA direnç T1 bitkiler ekran için kullanıldı. BASTA çözüm üç kez üç gün yanlış pozitif azaltmak için iki haftalık bitkiler başlangıç aralığı ile püskürtülür. BASTA damla test gerçek pozitif transformants tanımlamak için bireysel bitkiler kalan gerçekleştirildi. Dönüşüm verimliliği %0.033 3-4 transgenik bitkiler başına 10.000 T1 tohumları yayılır verimli oldu.

Introduction

Bu protokol için büyüme ve extremophyte model Schrenkiella parvulaiçin kararlı transgenik hatları kurulması açıklanmaktadır. Verimli dönüştürme sistemin herhangi bir çok yönlü genetik model damgasını olduğunu. Aşırı ortamlarda gelişirler bitkiler extremophytes, kritik bir kaynak sağlamak bitki uyarlamaları için çevresel stresleri anlamak için kabul edilir. Schrenkiella parvula (eski adıyla Thellungiella parvula ve Eutrema parvulum) genomik kaynakları1,2,3,4,5genişletilmesi ile böyle bir extremophyte model, olduğunu. Ancak, dönüşüm protokolleri henüz S. parvula için yayınlanmış çalışmalarda bildirilmiştir değil.

S. parvula genom Turpgiller (hardal-lahana aile) ilk yayımlanan extremophyte genom olup geniş bir genel genom synteny sigara extremophyte modeli, Arabidopsis thaliana1ile gösterir. Böylece, A. thaliana ve S. parvula arasında karşılaştırmalı çalışmalar genetik çalışmalar parvula S. genom nasıl gelişti ve düzenlenmiş bilgilendirici hipotezler yapmak A. thaliana üzerinde gerçekleştirilen zenginliği yarar farklı şekilde başa çıkmak için5,6,7aşırı çevre vurguluyor. S. parvula (toprak NaCl LD50 dayalı) tuz en dayanıklı türlerin bilinen yabani akrabaları arasında A. thaliana8biridir. Ek olarak NaCl hoşgörü, S. parvula ve hayatta yüksek konsantrasyonlarda toksik çoğu bitkiler7' ye birden çok tuz iyonları huzurunda ömrünü tamamlayan. Abiyotik stres doğal tabiatında yaygın yanıt olarak, çeşitli özellikleri, aralarında birkaç biyokimyasal ya da fizyolojik düzey 8,9,10okudu gelmifltir, 11.

2010 yılından bu yana, S. parvula bir hedef tür olarak ya bir karşılaştırma ile diğer bitki genom kullanılan 400'den fazla eş-reveiwed yayınları olmuştur. Ancak, açık bir performans sorunu ne tür çalışmalar yürütülen bir daha yakından bakmak ile belirlenmiştir. Bu raporlar çoğunluğu S. parvula potansiyelini kullanmak gelecek çalışmalarda tartışmak veya karşılaştırmalı genomik veya phylogenomic çalışmalar kullanın. Bir kanıtı-of-concept dönüştürme iletişim kuralı olmaması nedeniyle kurulan S. parvulaiçin o değil kullanılan en yüksek kalite bitki genom bugüne kadar mevcut biri olmasına rağmen fonksiyonel genomik çalışmalar (> 5 Mb dokunma N50) toplandı ve kromozom düzeyi pseudomolecules1açıklamalı.

Agrobacterium aracılı daldırma çiçek dönüşüm yöntemi A. thalianaiçinde trasngenic satırları oluşturmak için en geniş kullanılan yöntem haline gelmiştir ve dönüşümünün bir tekrarlanabilir sisteminin geliştirilmesi başarısını kritik bir faktör oldu bir genetik model12,13. Ancak, tüm turpgiller türler başarıyla A. thalianaiçin geliştirilen çiçek daldırma yöntemiyle dönüştürülmesi için gösterilmiştir. Özel olarak, S. parvula dahil turpgiller Lineage II tür çiçek daldırma tabanlı dönüştürme yöntemleri14,15' e inatçı oldu.

S. parvuladar yaprak morfolojisi ile kombine, belirsiz çiçekli büyüme alışkanlığı zorlu standart Agrobacterium aracılı daldırma çiçek dönüşüm yöntemi benimsemeye yaptı. Bu çalışmada, S. parvulatekrarlanabilir dönüşüm için geliştirdiğimiz değiştirilmiş Protokolü rapor.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. bitki büyüme

  1. Tohum sterilizasyon (isteğe bağlı)
    1. 1 çift-distile su (GKD2O) % 50 çamaşır suyu hazırlamak veya 2 damla non-iyonik bir deterjan ( Tablo malzemelerigörmek) 50 mL tüp içinde. Tüp birkaç kez çözüm karıştırmak için tersine çevirin.
      Not: Tohum sterilizasyon 15dk için bir UV steril yüzey ile kabine laminar akışı yapmak için tercih edilir.
    2. Çamaşır suyu çözüm ~ 100-200'e ekleyin S. parvula tohumları bir 1,5 mL tüp. İyice karıştırın ve 5 min için oturup tüp izin.
    3. Çamaşır suyu tüm tüpünden kaldırın ve % 70 etanol ekleyin. Birkaç kez pipetting tarafından tohum yıkama ve etanol çözüm hemen kaldırın.
    4. Fazla çamaşır suyu ve etanol kaldırmak için steril su içinde tohum yıkayın, sonra su kaldırın. Bu 5-6 kez tekrarlayın.
  2. Tohum stratifikasyon
    1. Steril su içinde tohum bırakın ve 5-7 gün 4 ° C'de depolayın Alternatif olarak, doğrudan ıslak toprak üzerinde kurutulmuş unsterilized tohumları ekmek ve toprak tepsi 4 ° C'de 5-7 gün boyunca yer
  3. Büyüyen bitkiler dönüşümünün hazırlık
    1. Toprak ( Tablo malzemelerigörmek) 7 x 6 cm2 tencere karıştırmak, tencere suda ıslatın ve sprey su düzgün ıslak büyüme ortamı sağlamak için üst dolgu. (Bkz. Tablo reçetesi) 5-gübre boncuk her pot toprak yüzeyinde ekleyin.
      Not: Bildiğim kadarıyla biz yaşamış gibi S. parvula A. thaliana büyüdüğü yerde de herhangi bir toprak karışımı üzerinde büyür.
    2. Islak bir kürdan kullanarak transfer 20 ~ 25 tohum toprak yüzeyinin pot başına.
      Not: 4-5 tohum toplu dört köşe pot (Şekil 1, gün 15, sol panelde) ortasına koyup uygun bir uygulamadır.
    3. Pot tepsi tohum çimlenme sırasında altında yüksek nem tutmak için açık bir kubbe ile kapak.
    4. Bitki tepsileri 130 µmol m−2 s– 1 ışık, 22-24 ° C sıcaklık ve gece döngüsü başına gün/10 h başına 14 h ayarlamak bir ışık şiddeti ile bir büyüme odasında tutun. Kubbeleri 7-10 gün sonra çimlenme kaldırın. Düzgün bir arzu edilen düzeyde nemlendirilmiş toprak tutmak için tepsi altından su ekleyin.
    5. İlave fidan ot ve de (Şekil 1, gün 15, doğru kapı aynası) birbirinden pot başına sadece 4-5 sağlıklı fide bırakın.
    6. Yavaşça iki günde bitkiler su ve 0.2 x Hoagland'ın çözüm16 ile iki haftada döller.
      Not: Toprak nemi Tekdüzen bir düzeyde tutmak anahtarıdır S. parvula sürekli ve sağlıklı büyüyen.
    7. 8-10 hafta kadar birden fazla çiçek bitki (Şekil 1, gün 60-80) başına 100-150 çiçek tomurcukları üretmek için bitkileri büyümeye devam ediyor. Daldırma çiçek tabanlı dönüştürme (adım 4.5) için planlanan günde tüm olgun ve gelişmekte olan siliques bitkilerden kaldırın.

2. bitki dönüşümü için bir vektör faiz gen/genomik unsuru klonlama

  1. Polimeraz zincir reaksiyonu (PCR)17 ve izole bir jel çıkarma kullanarak PCR ürünü kiti ( Tablo malzemelerigörmek) kullanarak hedef DNA parçası yükseltmek göre kit Protokolü veya özel jel kullanarak DNA arındırmak için uygun başka yöntemi Elektroforez17,18. Sanger sıralama19yoluyla izole PCR ürün sırasını doğrulayın.
  2. İstenen PCR ürünü klonlama vektör ve yetkili E. coli içine klonlanmış yapı hücreleri bir klonlama topoizomeraz tabanlı kullanarak dönüşüm kiti ( Tablo malzemelerigörmek) klon üreticisinin yönergeleri izleyerek.
  3. Luria-Bertani20 (LB) agar bakteriyel büyüme medya (Tablo 1) uygun antibiyotiklerle dönüştürülmüş ürünlerin 50 µL yayılmış örneğin., 50 µg / mL spektinomisin (bkz. Tablo reçetesi) ve 37 ° kuluçkaya C gecede.
  4. Ertesi gün, 5-10 tek kolonileri seçin, uygun antibiyotikler ile sıvı LB orta içine aşılamak ve nazik 37 ° C'de gecede sallayarak ile kuluçkaya.
  5. Plazmid yalıtım kullanarak ayrı tut moduyla plazmid ( Tablo malzemelerigörmek) kiti ve Sanger sıralama19 arası 2.1 güçlendirilmiş hedef sıra düzgün kopyalanmış olup olmadığını doğrulayın.
  6. Klonlanmış ve doğrulanmış PCR ürünü aktarım bitki dönüşüm rekombinasyon tabanlı ( Tablo malzemelerigörmek) klonlama ile uyumlu bir hedef vector öğesine (bakınız Tablo malzemeler), aşağıdaki kit recombinase enzim karışımı kullanarak seti üreticisinin yönerge. 2.3 adımından için 2.5 yalıtmak ve uygun plazmid yapılarını barındıran klonlar doğrulamak için adımları yineleyin.

3. vektör oluşturmak için bitki dönüşüm Agrobacterium tumefaciens dönüştürme

  1. A. tumefaciens zorlanma GV3101:pMP90RK21rifampisin direnç geni kromozom arka plan seçimi için limanlar, vektör yapı üzerinden 2,6 plazmid dönüştürün. Uygun antibiyotik, örneğin viomisin veya sefaloridin kullanın (bkz. Tablo reçetesi) bitki seçimi için dönüşüm oluşturmak (Ti plazmid). A. tumefaciens dönüşüm Elektroporasyon ile kısa bir protokol Bölüm 3.2 dahildir.
  2. A. tumefaciens dönüştürme Elektroporasyon tarafından
    1. A. tumefaciens yetkili hücreleri22 tarihinde buz çözme. Mix 0.1-1 µg 2.6 hazırlanan plazmid, çözünmüş 1 – 2 µL GKD2O, buz üzerinde yetkili hücrelerle içinde. Karışımı bir Elektroporasyon küvet aktarmak ( Tablo malzemelerigörmek).
    2. Elektroporasyon plazmit ve yetkili bir electroporator kullanarak 3.2.1, hücrelerden karışımı gerçekleştirmek ( Tablo malzemelerigörmek) üreticinin yönergeleri izleyerek.
      Not: Küvet yüzeyini Elektroporasyon başlamadan önce temizlemek.
    3. Tepki karışımı küvet 1.5 mL sıvı LB de içerir bir microcentrifuge tüp transferi ve de pipetting ile karıştırın ve nazik sallayarak ile 28 ° c 1 h için kuluçkaya.
  3. Bölüm 3.2 uygun seçimi antibiyotik içeren LB tabaklarda gelen dönüştürülmüş A. tumefaciens aşılamak (örneğin sefaloridin 25 µg / mL, spektinomisin 50 µg / mL, viomisin 25 µg / mL ve rifampisin 50 µg / mL) ve 28 ° C'de 3 gün kuluçkaya.

4. Agrobacterium aracılı dönüşümü S. parvula

  1. Dönüştürülmüş tek aşılamak kolonileri 10 mL LB sıvı medya antibiyotik (3,3 ile aynıdır) içeren bir steril 50 mL konik kalıplara gelen tüp ( Tablo malzemelerigörmek). Titreyen bir kuluçka 24 h için kuluçkaya ( Tablo malzemelerigörmek), 250 r.p.m. 28 ° C'de
  2. Bakteriyel çözüm 3.4.1 bir steril 250 mL şişe transfer LB sıvı ortam uygun antibiyotikler ile 40 mL ekleyin ve 600 nm dalga boyu (OD600), optik yoğunluk yaklaşık 2.0 ulaşıncaya kadar 12 h kuluçkaya.
  3. A. tumefaciens cultureat 3100 x g 10 dk. Kaldır süpernatant santrifüj kapasitesi ve bakteri kültürü 40 mL A. tumefaciens infiltrasyon çözeltisi (Tablo 1) yeniden askıya alma.
  4. İnfiltrasyon çözüm 0,8 son OD600 ile resuspended A. tumefaciens sulandırmak. Yüzey aktif çözüm (Tablo 1) 25 µL seyreltilmiş A. tumefaciens 50 mL için eklemek çözüm ve mix tarafından birkaç kez ters çevirme.
  5. Önümüzdeki Bölüm 4.4 20 s. kullanım taze bir bakteriyel çözüm için önümüzdeki altı tencere üzerinden daldırma sonra hazırlanan A. tumefaciens solüsyona bitkilerin daldırma. Tüm çiçekler ile temas çözüm olduğundan emin olun. Damlalıklı bakteriyel çözümler üzerine doğrudan çözüm içine daldırma olamaz Eğer önümüzdeki alt kısmında bulunan çiçekler.
    Not: İlk turda dönüştürme için bir keskin neşter veya küçük makas kullanılarak tüm olgun ve gelişmekte olan siliques kaldırdığınızdan emin olun. Siliques ikinci kez dönüşüm gerçekleştirmek Eğer kaldırmaz.

5. sonrası dönüşüm tesisi bakım ve ikinci dönüştürme

  1. Daldırma çiçek bitki bitkiler kapak ve karanlık büyüme Oda 1-2 gün için yer için kubbe ile temiz kasetlerine yatay olarak yerleştirin.
    Not: Çiçekler yüksek oranda nem içeren altında tutmak (Şekil 1, bitkiler dönüştürme sonra) Bu aşamada önemlidir.
  2. Bitkiler bir dik konuma getirin ve 14 h gün/gece döngüsü, 130 µmol m-2 s-1 ışık şiddeti ve 22-24 ° C sıcaklık s 10 günlük bir büyüme Oda bitkiler aktarmak.
  3. Daldırma galvaniz çiçeklenme aşağıdaki hafta izleyin. Çok sayıda çiçek (Şekil 2) iptal olursa, çiçek DIP (adım 4) yaklaşık 4 hafta sonra veya çok sayıda çiçekler yeni geliştirdik sonra tekrarlayın.
    Not: İlk dönüştürme (adım 1.3.7) hazırlık adımda farklı olarak, önceden var olan veya siliques (Şekil 2) geliştirme dönüştürme ikinci turdan önce kaldırmayın.
  4. Tohumları olgun ve tohum ~ 21 haftalıkken hasat kadar bitkiler büyümek.
  5. İle hava geçirmez bir kap içinde oda sıcaklığında 2-3 hafta için kuru tohumlar ( Tablo malzemelerigörmek) Nem Çekiciler ile dolu.

6. pozitif Transformants yelpazesi

  1. Vahşi türü tohumları 1.2-1,3 adımda açıklandığı gibi bitki T1 tohumları.
  2. İlk 2 gerçek yaprakları geliştirmek, yaklaşık 10 – 14 gün sonra çimlenme kadar bitkiler büyümek.
  3. İlk seçim herbisit direnç (Şekil 3A ve 3B) ayrıntılı olarak aşağıdaki gerçekleştirin.
    1. Glufosinate-amonyum (% 11,3) herbisit (veya BASTA) seyreltik (Tablo 1) 1:1,000 (v/v) için. Sprey seyreltilmiş BASTA çözüm üzerinde fidan ve kubbeler bitkilerle gecede kapsar.
    2. 2-3 kat püskürtme BASTA tekrar her 5-7 gün.
  4. Aşağıda ayrıntılı olarak BASTA bırak testi kullanılarak ikinci seçim yapın.
    1. 3-4 kez BASTA çözüm püskürtme sonra hayatta bitkiler tanımlayın. Başka bir 2-3 3-5 yaprakları nispeten geniş bir yüzey alanı geliştirmek kadar hafta bitkiler büyümek.
    2. Bitki başına en büyük Olgun yaprak seçin, balmumu katman kaldırmak için hafifçe parmak ile yaprak yüzeyine ovmak ve bir damla seyreltik BASTA çözüm (Kimden adım 6.3.1) yerleştirin.
      Not: BASTA damla ile yakın kök üzerinde bir kâğıt şerit yerleştirerek uygulanan yaprak konumunu işaretleyin.
    3. Bir hafta kadar solan belirtileri BASTA damla ile uygulanan yaprakları izlemek. Yaprakları BASTA damla tarafından etkilenmemiş bitkilerle seçin.
      Not: Hatta BASTA çözüm damla (Şekil 3Ckadar) kuruduktan sonra true-mutlak yapraklarından bozulmamış ise iki gün içinde wilt için en yanlış pozitif bitki yapraklarından başlatın.
  5. Pozitif transformants genomik PCR kullanarak doğrulayın.
    1. Adım 6.4.5, hayatta kalan bitkilerden 2-3 yaprak toplamak.
    2. Genomik DNA CTAB yöntemi23 veya başka uygun DNA ekstraksiyon yöntemi kullanarak yapraklarından ayıklayın.
    3. PCR hedef bitkiler, vahşi-türü bitkisi (olarak negatif denetimleri) ve plazmid yapı adım 3.1 ayıklanan genomik DNA örnekleri (pozitif bir denetim olarak) kullanarak gerçekleştirin. Örneğin PCR astar için seçici marker gen, belirli uygun bir çift kullanmak, BASTA dirençli gen (bar), TCAGCAGGTGGGTGTAGA (ileriye doğru) ve GTCAACCACTACATCGAGACAA (tersi) için.
      1. Örnek PCR astar için bar gen hedeflemeyi kullanın aşağıdaki PCR koşullar: 30 98 ° C'de ilk denatürasyon adım s; 30 98 ° C'de denaturing 30 döngüleri ardından 30 59 ° C'de tavlama s, s ve 30 72 ° C'de uzanan s; ve 5 min için 72 ° C'de son uzantısı.
        Not: Tüm T-DNA ekleme emin olmak için aynı zamanda genomik PCR PCR astar seçici marker gen üzerinden kullanarak yapmak tavsiye ve başka bir PCR astar için hedef sıra belirli bitki dönüşüm vektör adımda klonlanmış
    4. Özel jel elektroforez17 hedef örnekleri (Şekil 4A) yanı sıra izole PCR ürünü19 kullanarak sıralama tarafından güçlendirilmiş bar PCR ürünü beklenen boyutu varlığını doğrulamak aynı prosedürü adım 2.1 olduğu gibi.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Geliştirdiğimiz T0 tohumları 150 gün içinde hasat sağlayan dönüştürme protokol bundan A. thalianaiçin değiştirilmiş bir çiçek daldırma yöntemiyle. Şekil 1 zaman çizelgesi ve dönüşümü daldırma çiçek üzerinden yürütmek için en iyi sahne temsil S. parvula bitkiler bir özetini gösterir. 60-80 gün sonra dönüştürme için hedef sahne olarak çimlenme sırasında birden fazla çiçek S. parvula bitkiler 70 –80 çiçekler ile seçilen. Az sayıda önceden varolan açık veya döllenmiş çiçek ve siliques bu aşamada A. tumefaciens infiltrasyonu önce çiçek daldırma yöntemi ile kaldırıldı. A. tumefaciens ile enfeksiyon çiçek (Şekil 2, köşeli ayraç (a)) kürtaj sonuçlandı. Çiçek daldırma sonra dönüştürülmüş tohumlar (Şekil 2, köşeli ayraç (b)) bulunma olasılığı siliques tam olarak gelişmiş. Dönüşüm sonra bile, S. parvula yeni çiçek ve çiçek bitkiler sağlıklı (Şekil 2, beyaz ok) tutuldu sürece geliştirmeye devam etti. Bitki stres veya yaşlanma belirtileri görünmüyorsa bu belirsiz çiçekli alışkanlık nedeniyle ikinci turunda dönüştürme gerçekleştirilebilir. Resim 2 A ve 2B göster: S. parvula bitki örnekleri dönüştürme, birinci ve ikinci turdan sonra sırasıyla, birbirinden 25 gün. Transgenik tohumlar içerebileceğinden ikinci dönüştürme, varolan siliques tamamen kaldırılmaması gerekir. Ayrıca, A. tumefaciens infiltrasyon çözüm (Tablo 1) pipetting tarafından yeni tüm çekime hasarı en aza indirmek için siliques ilk çözüm, içine daldırma yerine çiçek kümeleri, ortaya çıkan üzerine uygulanabilir dönüştürme.

Dönüşüm verimliliği %0.033, 3-4 transgenik bitkiler başına geçerli protokolü kullanılarak yayılır 10.000 T1 tohumlar verimli olduğunu. Bu tahmin ~ 50.000 T1 tohumlar 10 bağımsız dönüştürme girişimleri sırasında test temel alır. Verimliliği Arabidopsis thalianadaha düşük olmakla birlikte, başka bir extremophyte bitki Eutrema salsugenium24 dönüşümü ve bazı Arabidopsis thaliana ecotypes25karşılaştırılabilir. Dönüşüm verimliliği daha alternatif Agrobacterium suşları ve değişiklikler yüzey aktif ve infiltrasyon çözümleri kullanarak optimize. Birden çok BASTA sprey ve bırak testleri (adım 6.3 ve 6.4) gerçek pozitif transformants tanımlamak ve PCR onay adımı 6.5 (Şekil 4A) kullanarak test örnekleri sayısını azaltmak için kritik olacak. Klonlanmış sıra bir muhabir gen (Şekil 4B) içeriyorsa doğrulanmadı dönüşümünün bir muhabir gen ekspresyonu ile kontrol edilebilir.

Figure 1
Resim 1 : S. parvula dönüştürme kronolojisi. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Şekil 2: S. parvula bitkiler dönüştürme koklaşmak çiçek tarafından sonra Bitkiler çok fotoğrafı çekilen 10 gün sonra ilk çiçek daldırma gün 60(a)ve 25 gün sonra ikinci tur gün 85 (B), çiçekli daldırma olduğunu. İnfiltrasyon Agrobacterium ile çiçek silique geliştirme destekleri biriçinde gösterildiği gibi iptal. Çiçek daldırma sonra dönüştürülmüş tohumlar (köşeli ayraçlar b) bulunma olasılığı siliques tam olarak gelişmiş. Yeni çiçekler ve çiçek her dönüştürme sonra ortaya çıkan beyaz okları gösterir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3 : S. parvula transformants seçilmesi BASTA direnci üzerinde bağlı. (A)T1 fidan BASTA sprey önce. (B) kırmızı daire BASTA sprey tarafından ilk turda seçim yaşayan bir aday transformant gösterir. (C) ikinci tur seçim BASTA tarafından açılan testi. Yanlış pozitif (üst panel) ve gerçek transgenik bitkiler (alt paneli) bir örnek gösterilir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 4
Şekil 4 : S. parvula dönüşüm onayı. (A) PCR güçlendirme bar gen genomik DNA'lar S. parvula bitkilerden çıkarılan üzerinden. 1 yolu ve 13: boyut işaretleri; Lane 2: negatif kontrol; Lane 3-5: vahşi tipi S. parvula ; Lane 6-10: transgenik S. parvula adaylar; Lane 11, 12: vektör kontrolü. Şerit 7, 8 ve 9 olumlu transformants örnekler. GUS muhabir Gen ifadesinin bir pozitif örneği (B) S. parvula transformant. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Medya / çözüm Reaktif Tutar
Luria-Bertani (LB) bakterilerin büyüme medya NaCl
Tryptone
Maya ekstresi
Agar (tabak için)
GKD2O
10 g
10 g
5 g
20 g
955 mL
Agrobacterium infiltrasyon çözüm MS tuz (1/4 x)
B5 vitaminleri (1 x)
Sukroz (5%w/v)
MES
N6- benzylaminopurine (BA)
Silwet L-77 (0.05%v/v)
pH
2.16 g
1 mL
50 gr
0,5 g
10 ΜL
500 μL
5,7

Tablo 1: kompozisyon bakteriyel büyüme ortamının ve Agrobacterium infiltrasyon çözüm.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Bitkinin fizyolojik devlet dönüştürme25verimliliğini önemli ölçüde etkiler. Sağlıklı ve dinç bitkilerin kullanımı için dönüştürme başarılı dönüşüm içinde S. parvulaiçin anahtar bir gereksinimdir. Su veya hafif stresli bitkiler sağlıklı bitkiler için dönüşüm (Şekil 1, merkezi panel) ideal kıyasla daha az çiçek olacak. S. parvula hafif yoğunlukta büyüyebilir daha az 130 µmol m-2 s-1ama bitkiler frailer; olma eğilimi tür bitkiler için daha fazla yol açacak çiçek çiçek daldırma takip iptal edildi. S. parvula Agrobacterium daldırma çiçekler daha yüksek bir hızda iptal eğilimindedir A. thaliana. Bu nedenle, ne zaman A. tumefaciens infiltrasyon çözümde daldırma durdurulan çiçekler en aza indirmek için atılan her adımı daha yüksek bir dönüşüm verimliliği için katkıda bulunur. Günde 14 saat ışık dönemi artık tavsiye ediyoruz. Çoğu zaman, A. thaliana dönüşümün bir uzun günlük durumunun (18 h ışık ve 6 h karanlık gibi) veya sürekli ışık altında bile yetiştirilen bitkiler üzerinde gerçekleştirilir. Ancak, bu tür uygulamaları sonucu daha az dirençli S. parvula bitkilerde bulduğu ve düşük dönüşüm verimlilik için yol.

Çiçek tomurcukları S. parvula (Şekil 2, beyaz ok) önümüzdeki eksen üzerinde sürekli olarak üretilmektedir. Bu nedenle, dönüştürme yeni çiçek izin pozitif transformants alma olasılığını önemli ölçüde artıracak. Bir ikinci çiçek-Dalış (adım 5.3) önemli ama şiddetle önerilen değildir. S. parvula birden çok önümüzdeki eksenleri üretir çünkü ancak, bu adımı A. thaliana çiçek daldırma için karşılaştırıldığında nispeten zaman alıcıdır.

Vahşi-türü S. parvula BASTA için duyarlı olsa da ilk ekran BASTA sprey (adım 6.3) ile pozitif transformants için 5-8 hayatta kalan bitkiler 100 tohum germinated (Şekil 3vebir 3B) dışarı bırakacaktır. Bunların çoğu (> % 80) yanlış pozitif olacaktır. Bu büyük ölçüde dar yaprak şekli ve S. parvula, yaprak açısı yeterli yaprak yüzeyi bir fenotip gözlemlemek yeterli bir süre için BASTA çözüm korumak için uygun bir yönlendirmesi sağlamaz kaynaklanmaktadır. Ayrıca, S. parvula10adaxial yaprak yüzeyi yüksek balmumu içeriği nedeniyle, bu daha dayanıklı bir yüzey oluşturmak için BASTA eğilimindedir. Bu nedenle, ikinci tarama için olumlu transformants BASTA açılan bireysel yapraklarda (adım 6.4, Şekil 3C) kullanarak yanlış pozitif (adım 6.5) yüzlerce üzerinde test PCR önlemek için önemli bir adım.

Geçerli protokol A. tumefaciens zorlanma GV3101 pMP90RK plazmid taşıyan test edildi. Dönüşüm verimliliği suşları ABI, LMG20 ve C58C1 Rifr, A. thaliana dönüşüm verimliliği artırmak için bildirilen pMP90 virülans plazmid de dahil olmak üzere diğer A. tumefaciens suşları ile geliştirilmiş 25. Brassica ve Eutrema türlerinin taksonomik daha yakından ilgilidir A. thaliana1' e göre parvula S. için. Bu nedenle, A. tumefaciens zorlamalara başarıyla Brassica napus ve başarılı bir şekilde Eutrema salsugineum dönüştürmek için kullanılan EHA105 daha yüksek bir dönüşüm sunabilir zorlanma dönüştürmek için kullanılan LBA4404 verimlilik zorlanma bildirilen verimliliğini daha26,27,28kullanılmakta.

Zaman ve emek bir dönüşüm protokolü için gereken azaltarak dönüşüm verimliliği artırma başka bir önemli faktördür. Bireysel BASTA damlalar yapraklarda yerleştirerek ve birden çok bitkiler (adım 6.4) günü bir hafta için yaprak izleme sıkıcı. Gelecekteki bir çaba dönüşüm verimliliği artırmak için uygun alternatif seçilebilir marker gen29için arayabilirsiniz.

Bir kurulan dönüştürme Protokolü kullanılabilirliğini büyük ölçüde genler ve extremophyte modeli bitkiler birden çok abiyotik stres2,4hayatta kalmak izin roman mekanizmaları tanımlama yeteneği bizim ilerlemek olacaktır. S. parvula roman genetik varyasyon nispeten stres duyarlı modelinde, A. thaliana stres yanıt veren genler olarak tanımlanan kolektif allelic varyasyon dan mayınlı değil genetik varyasyon daha geniş bir havuzu sağlayacaktır Pan-genom5,6. Bu nedenle, bizim çiçek daldırma S. parvula için geliştirilen dönüştürme protokol tabanlı A. tumefaciens aracılı yakından ilgili A. extremophyte modelinde fonksiyonel genomik deneyler gerçekleştirmek bu araçları için ihtiyaç için bir boşluk doldurur thaliana.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa gerek yok.

Acknowledgments

Bu eser bir Ulusal Bilim Vakfı Ödülü MCB 1616827 tarafından desteklenmiştir.

Materials

Name Company Catalog Number Comments
Agar VWR International, Radnor, PA 90000-762 Bacto Agar Soldifying Agent, BD Diagnostics
B5 vitamins Sigma-Aldrich, St. Louis, MO G1019 Gamborg’s Vitamin Solution
Desiccant W A Hammond Drierite, Xenia, OH 22005 Indicating DRIERITE 6 mesh
Destination vector for plant transformation TAIR Vector:6531113857 pKGWFS7
Electroporation cuvette USA Scientific 9104-5050 Electroporation cuvette, round cap, 0.2 cm gap
Electroporator BIO-RAD Laboratories, Hercules, CA 1652100 MicroPulser Electroporator
Fertilizer beads Osmocote Garden, Marysville, OH N/A Osmocote Smart-Release Plant Food Flower & Vegetable
Gel extraction kit iNtRON Biotechnology, Boston, MA 17289 MEGAquick-spin Total fragment DNA purification kit
Gentamicin Sigma-Aldrich, St. Louis, MO G1914-5G Gentamicin sulfate
Glufosinate-ammonium (11.3%) herbicide (BASTA) Bayer environmental science, Montvale, NJ N/A FINALE herbicide
Kanamycin VWR International, Radnor, PA 200004-444 Kanamycin monosulfate
MES Bioworld, Dublin, OH 41320024-2 MES, Free Acid
MS salt MP Biomedicals, Santa Anna, CA 092621822 Hoagland's modified basal salt mixture
N6-benzylaminopurine (BA)  Sigma-Aldrich, St. Louis, MO B3274 6-Benzylaminopurine solution
NaCl Sigma-Alrich S7653 Sodium chloride
Non-ionic detergent Sigma-Aldrich, St. Louis, MO 9005-64-5 TWEEN 20 
Plasmid isolation kit Zymo Research, Irvine, CA D4036 Zyppy Plasmid Kits
Recombinase enzyme mix kit Life Technology 11791-020 Gateway LR Clonase II Enzyme mix
Rifampicin Sigma-Aldrich, St. Louis, MO R3501-1G Rifampicin, powder, ≥ 97% (HPLC)
Shaking incubator ThermoFisher Scientific, Waltham, MA SHKE4450 MaxQ 4450 Benchtop Orbital Shakers
Soil mix Sun Gro SUN239223328CFLP Sun Gro Metro-Mix 360 Grower Mix
Spectinomycin VWR International, Radnor, PA IC15206705
Sterile 50 mL conical tubes USA Scientific, Ocala, FL 1500-1811 50 mL conical screw cap tubes, copolymer, racks, sterile
Sucrose VWR International, Radnor, PA 57-50-1 Sucrose, ACS
Surfactant solution Lehle seeds, Round Rock, TX VIS-02 Silwet L-77
Topoisomerase-based cloning kit Life Technologies, Carlsbad, CA K240020 pENTR/D-TOPO Cloning Kit, with One Shot TOP10 Chemically Competent E. coli
Tryptone VWR International, Radnor, PA 90000-282 BD Bacto Tryptone, BD Biosciences
Yeast Extract VWR International, Radnor, PA 90000-722  BD Bacto Yeast Extract, BD Biosciences

DOWNLOAD MATERIALS LIST

References

  1. Dassanayake, M., et al. The genome of the extremophile crucifer Thellungiella parvula. Nature Genetics. 43, (9), 913-918 (2011).
  2. Oh, D. -H., Dassanayake, M., Bohnert, H. J., Cheeseman, J. M. Life at the extreme: lessons from the genome. Genome Biology. 13, (3), 241 (2012).
  3. Whited, J. The Next Top Models. Cell. 163, (1), 18-20 (2015).
  4. Dassanayake, M., Yun, D. O. D., Bressan, R. A., Cheeseman, J. M., Bohnert, J. H. The scope of things to come: New paradigms in biotechnology. Plant Biotechnology and Agriculture: Prospects for the 21st Century. 19-34 (2009).
  5. Dittami, S. M., Tonon, T. Genomes of extremophile crucifers: New platforms for comparative genomics and beyond. Genome Biology. 13, (8), 166 (2012).
  6. Amtmann, A. Learning from evolution: Thellungiella generates new knowledge on essential and critical components of abiotic stress tolerance in plants. Molecular Plant. 2, (1), 3-12 (2009).
  7. Oh, D. -H., Hong, H., Lee, S. Y., Yun, D. -J., Bohnert, H. J., Dassanayake, M. Genome structures and transcriptomes signify niche adaptation for the multiple-ion-tolerant extremophyte Schrenkiella parvula. Plant Physiology. 164, (4), 2123-2138 (2014).
  8. Orsini, F., et al. A comparative study of salt tolerance parameters in 11 wild relatives of Arabidopsis thaliana. Journal of Experimental Botany. 61, (13), 3787-3798 (2010).
  9. Uzilday, B., Ozgur, R., Sekmen, A. H., Yildiztugay, E., Turkan, I. Changes in the alternative electron sinks and antioxidant defence in chloroplasts of the extreme halophyte Eutrema parvulum (Thellungiella parvula) under salinity. Annals of Botany. 115, (3), 449-463 (2015).
  10. Teusink, R. S., Rahman, M., Bressan, R. A., Jenks, M. A. Cuticular waxes on Arabidopsis thaliana close relatives Thellungiella halophila and Thellungiella parvula. International Journal of Plant Sciences. 163, (2), 309-315 (2002).
  11. Jarvis, D. E., Ryu, C. H., Beilstein, M. A., Schumaker, K. S. Distinct roles for SOS1 in the convergent evolution of salt tolerance in Eutrema salsugineum and Schrenkiella parvula. Molecular Biology and Evolution. 31, (8), 2094-2107 (2014).
  12. Clough, S. J., Bent, A. F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant Journal. 16, (6), 735-743 (1998).
  13. Koornneef, M., Meinke, D. The development of Arabidopsis as a model plant. Plant Journal. 61, (6), 909-921 (2010).
  14. Bai, J., Wu, F., Mao, Y., He, Y. In planta transformation of Brassica rapa and B. napus via vernalization-infiltration methods. Protocol Exchange. 10, 1028 (2013).
  15. Sparrow, P. A. C., Goldsack, C. M. P., Østergaard, L. Transformation technology in the Brassicaceae. Genetics and Genomics of the Brassicaceae. 505-525 (2011).
  16. Hoagland, D. R., Arnon, D. I. The water-culture method for growing plants without soil. California Agricultural Experiment Station Circular. 347, (347), 1-32 (1950).
  17. Saiki, R., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, (4839), 487-491 (1988).
  18. Sun, Y., Sriramajayam, K., Luo, D., Liao, D. J. A Quick, cost-free method of purification of dna fragments from agarose gel. Journal of Cancer. 3, 93-95 (2012).
  19. Sanger, F., Nicklen, S., Coulson, A. R. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America. 74, (12), 5463-5467 (1977).
  20. Bertani, G. Studies on Lysogenesis I. The mode of phage liberation by lysogenic Eschericia coli. Journal of Bacteriolgy. 62, (3), 293-300 (1951).
  21. Koncz, C., Martini, N., Szabados, L., Hrouda, M., Bachmair, A., Schell, J. Specialized vectors for gene tagging and expression studies. Plant Molecular Biology Manual. 53-74 (1994).
  22. Weigel, D., Glazebrook, J. Transformation of Agrobacterium using electroporation. Cold Spring Harbor Protocols. 2006, (30), (2006).
  23. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Research. 8, (19), 4321-4326 (1980).
  24. Inan, G. Salt cress. a halophyte and cryophyte Arabidopsis relative model system and its applicability to molecular genetic analyses of growth and development of extremophiles. Plant Physiol. 135, (3), 1718-1737 (2004).
  25. Ghedira, R., De Buck, S., Nolf, J., Depicker, A. The efficiency of Arabidopsis thaliana floral dip transformation is determined not only by the Agrobacterium strain used but also by the physiology and the ecotype of the dipped plant. Molecular Plant-Microbe Interactions. 26, (7), 823-832 (2013).
  26. Shaohong, F. U., Xianya, W. E. I., Yingze, N. I. U., Shixing, G. U. O. Transformation of Brassica napus with the method of floral-dip. Biotechnology: Genomics and Its Applications. 45-49 (2005).
  27. Li, J., Tan, X., Zhu, F., Guo, J. A rapid and simple method for Brassica napus floral-dip transformation and selection of transgenic plantlets. International Journal of Biology. 2, (1), 127 (2010).
  28. Li, H. Q., Xu, J., Chen, L., Li, M. R. Establishment of an efficient Agrobacterium tumefaciens-mediated leaf disc transformation of Thellungiella halophila. Plant Cell Reports. 26, (10), 1785-1789 (2007).
  29. Wu, G., Rossidivito, G., Hu, T., Berlyand, Y., Poethig, R. S. Traffic lines: New tools for genetic analysis in Arabidopsis thaliana. Genetics. 200, (1), 35-45 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics