Vekst og Agrobacterium-mediert Floral-dip transformasjonen av Extremophyte Schrenkiella parvula

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Agrobacterium-mediert transformasjon bruke en floral-dip kan brukes å opprette stabil transgene linjer av extremophyte modellen Schrenkiella parvula. Vi presenterer en protokoll endret fra det for Arabidopsis thaliana, vurderer ulike vekst vaner og fysiologiske kjennetegner extremophyte.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Wang, G., Pantha, P., Tran, K. N., Oh, D. H., Dassanayake, M. Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula. J. Vis. Exp. (143), e58544, doi:10.3791/58544 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Schrenkiella parvula er en extremophyte tilpasset ulike abiotiske påkjenninger, inkludert flere ion toksisitet påkjenninger. Til tross for høy kvalitet genomisk ressurser tilgjengelig til å studere hvordan planter tilpasse seg miljøet understreker verdien som funksjonell genomforskning modell og verktøyet har vært begrenset av mangel på en mulig transformasjon system. I denne protokollen, rapporterer vi hvordan å generere stabil transgene S. parvula linjer med en Agrobacterium-mediert blomster-dip-metode. Vi endret transformasjon protokollen som brukes til A. thaliana konto for unike trekk av S. parvula, for eksempel en ubestemmelig blomstrende vane og en høy epicuticular voksen innhold på bladene. Kort, S. parvula frø var lagdelt på 4 ° C i fem dager før planting. Planter ble dyrket på en fotoperiode av et 14 h lys og 10t mørke og 130 µmol m-2s-1 lav intensitet, på 22 ° C til 24 ° C. Åtte til ni uke-gamle planter med flere inflorescences ble valgt for transformasjon. Disse inflorescences var dyppet i en infiltrasjon av Agrobacterium tumefaciens GV3101 bærer pMP90RK plasmider. Vi utført to rundene blomst dipping med et intervall på tre til fire uker å effektivisere transformasjon. T1 frø var samlet og tørket i fire uker i en container med desiccants før spiring skjermen kandidat forvandlet linjer. Motstand mot BASTA ble brukt til skjerm T1 planter. Vi sprayet BASTA løsningen tre ganger med et intervall på tre dager starter på to uke gamle planter å redusere falske positiver. En BASTA drop test ble utført på overlevende personlige planter for å identifisere ekte positiv transformants. Transformasjon effektiviteten var 0.033%, gir 3-4 transgene planter per 10 000 T1 frø overført.

Introduction

I denne protokollen beskriver vi vekst og etablering av stabil transgene linjer for extremophyte modell Schrenkiella parvula. Tilgjengeligheten av en effektiv transformasjon system er et kjennetegn på en allsidig genetisk modell. Plantene som trives i ekstreme miljøer, referert til som extremophytes, gir en kritisk ressurs for å forstå anlegget tilpasninger mot miljømessige belastninger. Schrenkiella parvula (tidligere Thellungiella parvula og Eutrema parvulum) er en slik extremophyte modell, med å utvide genomisk ressurser,1,,2,,3,,4,,5. Men har transformasjon protokoller ikke ennå blitt rapportert for S. parvula i publiserte studier.

Genomet av S. parvula er første publiserte extremophyte genomet i Korsblomstfamilien (sennep-kål familien) og viser en omfattende totale genom synteny med ikke-extremophyte modell, Arabidopsis thaliana1. Dermed komparative studier mellom A. thaliana og S. parvula kan ha nytte av vell av genetiske studier utført på A. thaliana å gjøre informativ hypoteser om hvordan S. parvula genomet har utviklet seg og regulert annerledes for å tåle understreker ekstreme miljø5,6,7. S. parvula er en av de mest salt-tolerant artene (basert på jord NaCl LD50) blant kjente ville slektninger av A. thaliana8. NaCl toleranse, S. parvula overlever og livssyklusen i nærvær av flere salt ioner ved høye konsentrasjoner giftig for de fleste planter7er fullført. Svar på abiotiske stress utbredt i sitt naturlige habitat, den har utviklet seg ulike egenskaper, hvorav flere har blitt studert på biokjemiske eller fysiologiske nivå 8,9,10, 11.

Siden 2010, har det vært over 400 peer-reveiwed publikasjoner som brukes S. parvula som mål art eller brukt i en sammenligning med andre plante genomer. Men kan en tydelig flaskehals identifiseres med en nærmere titt på hva slags studier har vært gjennomført. Fleste av disse rapportene diskutere benytte S. parvula i fremtidige studier eller bruke den i sammenlignende genomisk eller phylogenomic studier. På grunn av mangel på en proof-of-concept transformasjon protokoll etablert for S. parvula, den ikke er brukt i funksjonelle genomisk studier, til tross for at en av høyeste kvalitet anlegget genomer tilgjengelig ennå (> 5 Mb contig N50) samlet og kommentert i kromosom nivå pseudomolecules1.

Metoden Agrobacterium-mediert blomster-dip transformasjon har blitt den mest brukte metoden til å opprette trasngenic i A. thalianaog utvikling av en reproduserbar system transformasjon var en kritisk faktor i suksessen som en genetisk modell12,13. Ikke alle Korsblomstfamilien arter har imidlertid vist forvandles lykkes med metoden blomster-dip utviklet for A. thaliana. Spesielt, har Brassicaceae Lineage II arter som inkluderer S. parvula vært gjenstridige til blomster-dip basert transformasjon metoder14,15.

Ubestemte blomstrende vekst vane S. parvula, kombinert med sine smale blad morfologi har gjort det utfordrende å vedta den standard Agrobacterium-mediert blomster-dip transformasjon metoden. I denne studien rapporterer vi endret protokollen har vi utviklet for reproduserbar transformasjon av S. parvula.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. plantevekst

  1. Frø sterilisering (valgfritt)
    1. Forberede 50% blekemiddel i dobbel-destillert vann (ddH2O) med 1 eller 2 dråper av en ikke-ioniske vaskemiddel (se Tabell for materiale) i et 50 mL tube. Invertere røret flere ganger for å blande løsningen.
      Merk: Det anbefales å gjennomføre frø sterilisering en laminær strømning kabinett med UV sterilitet overflate i 15 min.
    2. Legg den bleike løsningen til ~ 100-200 S. parvula frø i en 1,5 mL tube. Bland godt og la røret sitte i 5 minutter.
    3. Fjern blekemiddel fra røret og legge 70% etanol. Vask frøene av pipettering flere ganger og deretter fjerne etanol løsningen umiddelbart.
    4. Vask frøene i steriliserte vann for å fjerne overflødig blekemiddel og etanol, deretter fjerne vannet. Gjenta dette trinnet 5 til 6 ganger.
  2. Frø lagdeling
    1. Fordype frøene i steriliserte vann og lagre for 5 til 7 dager på 4 ° C. Alternativt så tørket unsterilized frø direkte på våt jord, og plassere jord skuffen for 5 til 7 dager på 4 ° C.
  3. Voksende planter i utarbeidelsen av transformasjon
    1. Fyll jorden blande (se Tabell for materiale) i 7 x 6 cm2 Potter, suge potter i vann og sprøyte vann fra toppen å sikre et enhetlig våt vekst medium. Legge til 5-gjødsel perler (se Tabell for materiale) på overflaten av hver pott.
      Merk: Som vi har opplevd, vokser S. parvula på noen jord blanding der A. thaliana kan vokse.
    2. Bruke en våt tannpirker, overføre 20 ~ 25 frø per pott på overflaten.
      Merk: En enkel praksis er å sette et parti av 4-5 frø i de fire hjørnene og midten av potten (figur 1dag 15, venstre panel).
    3. Dekk potten skuffen med en klar kuppel holde frøene under høy luftfuktighet under spiring.
    4. Holde plant skuffer i en vekst kammer med lav intensitet satt til 130 µmol m2 s−1 lys, 22-24 ° C temperatur og 14 h per dag/10 t per natt syklus. Fjerne kupler etter 7-10 dager etter spiring. Legge til vann fra bunnen av skuffen for å holde jorda fuktet jevnt på ønsket nivå.
    5. Luke ut ekstra seedlings og la bare 4 – 5 friske planter per pott godt atskilt fra hverandre (figur 1, dag 15, høyre panel).
    6. Forsiktig vanne plantene annenhver dag og gjødsle med 0,2 x Hoaglands løsning16 en gang annenhver uke.
      Merk: Holde jordfuktighet på en ensartet nivå er nøkkelen til voksende S. parvula konsekvent og sunt.
    7. Fortsette å vokse planter i 8-10 uker til flere inflorescences produsere 100-150 blomster knopper per plante (figur 1, dagen 60 – 80). På dag planlagt blomster-dip basert transformasjonen (trinn 4.5), fjerne alle eldre og utvikle siliques fra planter.

2. kloning Gene/genomisk Element av interesse i en vektor for plante transformasjon

  1. Forsterke målet DNA fragmentet polymerase kjedereaksjon (PCR)17 og isolere PCR produktet bruker en gel utvinning kit (se Tabell for materiale) etter kit protokollen eller andre aktuelle metoden til å rense bruker agarose gel geleelektroforese17,18. Kontrollere rekkefølgen av isolerte PCR produktet gjennom Sanger sekvensering19.
  2. Klone ønsket PCR produktet i kloning vektor og transformering klonet Konstruer i den kompetente E. coli celler ved hjelp av en topoisomerase-basert kloning kit (se Tabell for materiale) etter produsentens retningslinjer.
  3. Spre 50 µL av transformert produkter på Luria-Bertani20 (LB) agar bakterievekst media (tabell 1) med aktuelle antibiotika, f.eks., 50 µg / mL Spectinomycin (se Tabell for materiale), og Inkuber på 37 ° C over natten.
  4. Dagen velge 5-10 enkelt kolonier, vaksinere til flytende LB medium med aktuelle antibiotika og ruge med mild rister på 37 ° C over natten.
  5. Isolere plasmider bruker en plasmider isolering kit (se Tabell for materiale) og kontroller gjennom Sanger sekvensering19 om målet sekvensen i 2.1 er riktig klonet.
  6. Overføre klonet og bekreftet PCR produktet til en destinasjon vektor for plante transformasjon kompatibel med rekombinasjon-basert kloning (se Tabell for materiale), bruker en recombinase enzym blanding kit (se Tabell for materiale), følgende kit produsentens instruksjoner. Gjenta fra trinn 2.3 til trinn 2.5 å isolere og bekrefte kloner skjuler riktig plasmider konstruksjoner.

3. transformere vektor konstruere for plante transformasjon til Agrobacterium tumefaciens

  1. Forvandle plasmider av vektor Konstruer fra 2.6 A. tumefaciens belastningen GV3101:pMP90RK21, som et og motstand gen for chromosomal bakgrunn utvalg. Bruk aktuelle antibiotika, f.eks Gentamycin eller Kanamycin (se Tabell for materiale), for valg av anlegget transformasjon konstruere (Ti plasmider). En kort protokoll for A. tumefaciens transformasjon via electroporation er inkludert i del 3.2.
  2. A. tumefaciens transformasjon av electroporation
    1. Tine A. tumefaciens kompetent celler22 på is. Mix 0,1 til 1 µg av plasmider forberedt fra 2.6, oppløst i 1 – 2 µL av ddH2O, med kompetente celler på is. Overføre blandingen i en electroporation cuvette (se Tabell for materiale).
    2. Utføre electroporation på blanding av plasmider og kompetent celler fra 3.2.1, bruker en electroporator (se Tabell for materiale) etter produsentens retningslinjer.
      Merk: Rengjøre cuvette før electroporation.
    3. Overføre reaksjonsblandingen fra cuvette slik microcentrifuge som inneholder 1,5 mL væske LB og bland godt med pipettering og ruge 1t på 28 ° C med mild risting.
  3. Vaksinere transformert A. tumefaciens fra delen 3.2 på LB plater som inneholder riktig valg antibiotika (f.eks Kanamycin 25 µg / mL, Spectinomycin 50 µg / mL, Gentamycin 25 µg / mL og og 50 µg / mL) og Inkuber på 28 ° C i 3 dager.

4. Agrobacterium-mediert transformasjon av S. parvula

  1. Vaksinere én transformeres kolonier fra platene i 10 mL av LB flytende mediet som inneholder antibiotika (det samme som i 3.3) i et sterilt 50 mL konisk tube (se Tabell for materiale). Inkuber 24 h i en risting inkubator (se Tabell for materiale) 250 kraftuttaksakselens på 28 ° C.
  2. Overføre bakteriell løsningen fra 3.4.1 til en steril 250 mL kolbe, legger 40 mL av LB flytende media med aktuelle antibiotika og ruge 12t til optisk densitet ved 600 nm bølgelengde (OD600) når rundt 2.0.
  3. Sentrifuge A. tumefaciens cultureat 3100 x g for 10 min. Fjern nedbryting og å suspendere bakteriell kultur i 40 mL av A. tumefaciens infiltrasjon løsning (tabell 1).
  4. Fortynne den resuspended A. tumefaciens infiltrasjon løsning til en siste OD600 på 0.8. Legge til 25 µL surfactant løsning (tabell 1) 50 mL av utvannet A. tumefaciens løsning og bland ved å snu flere ganger.
  5. Dypp sitter av planter i A. tumefaciens løsningen utarbeidet i delen 4.4 for 20 s. Bruk en frisk bakteriell løsning etter sitter fra seks potter. Kontroller at alle blomster er i kontakt med løsningen. Pipetter bakteriell løsninger direkte på blomster ligger i nedre del av sitter hvis de ikke kan være dyppet i løsningen.
    Merk: For første runde transformasjon, sørg for å fjerne alle eldre og utvikle siliques bruker en kraftig skalpell eller liten saks. Ikke Fjern siliques hvis utfører transformasjon for andre gang.

5. etter transformasjon Plant Care og andre endringen

  1. Sett blomster-dyppet plantene vannrett i ren skuffer med domer å dekke planter og Legg i en mørk vekst rom for 1-2 dager.
    Merk: Holde blomstene under svært høy luftfuktighet er viktig på dette stadiet (figur 1, planter etter transformasjon).
  2. Tilbake planter til stående og overføre planter til vekst rom med en 14 h per dag/10 h per natt syklus, 130 µmol m-2 s-1 lysintensitet og 22 til 24 ° C temperatur.
  3. Overvåke dyppet inflorescences i neste uke. Hvis et betydelig antall blomster avbryte (figur 2), må du gjenta floral dip (trinn 4) etter ca 4 uker eller etter et stort antall blomster har nylig utviklet.
    Merk: I motsetning til forberedelse skritt for første transformasjonen (trinn 1.3.7), Fjern ikke eksisterende eller utvikle siliques (figur 2) før den andre runden av transformasjon.
  4. Vokse planter til frø modne og høste frø for ~ 21 ukens.
  5. Tørre frø for 2-3 uker i romtemperatur i en lufttett beholder med fylt med desiccants (se Tabell for materiale).

6. utvalg av positiv Transformants

  1. Plante T1 frø som vill type frø i trinn 1.2 og 1.3.
  2. Vokse planter til 2 første sanne bladene utvikler, ca 10-14 dager etter spiring.
  3. Utføre første valg for herbicid motstanden (Figur 3A og 3B) som beskrevet nedenfor.
    1. Fortynn glufosinate-ammonium (11,3%) ugressmiddel (eller BASTA) (tabell 1) å 1:1,000 (v/v). Spray utvannet BASTA løsning på seedlings og dekke planter med kupler over natten.
    2. Gjenta BASTA sprøyting 2 – 3 ganger hver 5-7 dager.
  4. Utføre andre valg med en BASTA-drop test som beskrevet nedenfor.
    1. Identifisere planter som overlever etter tilværelse sprøytelakkerer 3-4 ganger med BASTA løsning. Vokse planter for en 2-3 uker til 3 – 5 blader utvikler en relativt stor overflate.
    2. Velg den største modne bladet per plante, gni overflaten av bladet forsiktig med en finger for å fjerne voks laget, og Plasser en dråpe fortynnet BASTA løsningen (fra trinn 6.3.1).
      Merk: Merk plasseringen av bladet brukes med BASTA slipp ved å plassere en papirremse på nærmeste stammen.
    3. Overvåke bladene brukes med BASTA slipp for underskriver av wilting i opptil en uke. Velg planter med blader upåvirket av BASTA dråper.
      Merk: Blader fra mest falske positive planter begynner å vil. innen to dager, mens bladene fra sann-positive er intakt selv etter fall på BASTA løsning tørker opp (Figur 3C).
  5. Bekrefte positive transformants bruker genomisk PCR.
    1. Samle 2-3 blader fra overlevende planter på trinn 6.4.5.
    2. Pakk ut genomisk DNA fra bladene bruker CTAB metoden23 eller andre passende DNA utvinning metoden.
    3. Utføre PCR bruker utdraget genomisk DNA-prøver fra målet planter, vill-type planter (som negative kontroller) og plasmider Konstruer fra trinn 3.1 (som en positiv kontroll). Bruke en riktig par PCR primere gjelder for selektiv markør genet, f.eks, for BASTA-resistente genet (bar), TCAGCAGGTGGGTGTAGA (fremover) og GTCAACCACTACATCGAGACAA (bakover).
      1. For eksempel PCR primere målretting bar genet, bruker PCR følgende: innledende rødsprit trinnet på 98 ° C for 30 s; etterfulgt av 30 sykluser av denaturing på 98 ° C for 30 s, annealing på 59 ° C for 30 s, og utvide ved 72 ° C for 30 s; og endelig utvidelse ved 72 ° C i 5 minutter.
        Merk: For å sikre innsetting av hele T-DNA, vi anbefaler også utføre genomisk PCR bruker en PCR primer fra selektiv markør genet og en annen PCR primer gjelder for målet sekvensen klonet til anlegget transformasjon vektor ved trinn
    4. Bekrefte tilstedeværelse av forventet forsterket bar PCR produktet agarose gel geleelektroforese17 for målet prøvene (Figur 4A) og sekvensering isolert PCR produktet19 hjelp samme fremgangsmåte som i trinn 2.1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Vi utviklet en transformasjon protokoll som høsting av T0 frø innen 150 dager, bruke en floral-dip endret fra det for A. thaliana. Figur 1 viser en oppsummering av tidslinjen og S. parvula planter som representerer optimal scenen for å utføre transformasjonen gjennom blomster-dip. Vi valgte S. parvula planter med 70 –80 blomster i flere inflorescences 60 – 80 dager etter spiring som mål scenen for transformasjon. Et lite antall eksisterende åpen eller befruktet blomster og siliques på dette stadiet var fjernet før infiltrasjon av A. tumefaciens metoden blomster-dip. Infeksjon med A. tumefaciens resulterte i abort av noen blomster (figur 2, braketten (a)). Siliques fullt utviklet etter blomster-dip er sannsynlig å inneholde transformert frø (figur 2, braketten (b)). Selv etter transformasjon, S. parvula fortsatte å utvikle nye inflorescences og blomster som plantene ble holdt sunn (figur 2, hvite pilene). På grunn av ubestemt blomstrende vane, kan en ny runde med transformasjon utføres hvis anlegget ikke viser tegn på stress eller senescence. Figur 2 A og 2B viser eksempler på S. parvula planter etter den første og andre runden av transformasjon, henholdsvis 25 dager fra hverandre. I andre transformasjonen, bør ikke eksisterende siliques fjernes fordi de kan inneholde transgene frø. Også kan A. tumefaciens brukes av pipettering infiltrasjon løsningen (tabell 1) på nye blomster klynger, i stedet for dipping hele skyte i løsningen, å minimere skaden å siliques fra første transformasjon.

Transformasjon effektiviteten er 0.033%, gir 3-4 transgene planter per 10 000 T1 frø overført med gjeldende protokollen. Dette anslaget er basert på ~ 50.000 T1 frø testet under ti uavhengig transformasjon forsøk. Effektiviteten er lavere enn Arabidopsis thaliana, er det sammenlignbare til transformasjon av en annen extremophyte anlegget Eutrema salsugenium24 og noen av Arabidopsis thaliana ecotypes25. Transformasjon effektiviteten kan bli ytterligere optimalisert ved bruk av alternativ Agrobacterium stammer og modifikasjoner av surfactant og infiltrasjon. Flere BASTA spray og slipp tester (trinn 6.3 og 6.4) er avgjørende for å identifisere ekte positiv transformants og redusere antall prøvene testet bruker PCR bekreftelse i trinn 6.5 (Figur 4A). Ytterligere bekreftelse av transformasjon kan kontrolleres med en reporter genuttrykk, om klonet rekkefølgen inneholder en reporter genet (Figur 4B).

Figure 1
Figur 1 : Tidslinjen S. parvula transformasjon. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: S. parvula planter etter transformasjon av floral-dip. Planter ble fotografert 10 dager etter første blomster-dukkert i dag 60 (A) og 25 dager etter andre runden av blomster-dukkert i dag 85 (B). Infiltrasjon med Agrobacterium kan avbryte silique utvikling av blomster som vises i parentes en. Siliques fullt utviklet etter blomster-dip er inneholder transformert frø (parentes b). Hvite pilene angir blomster og inflorescences nylig dukket opp etter hver transformasjon. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3 : Utvalg av S. parvula transformants basert på BASTA motstand. (A) T1 seedlings før BASTA spray. (B) rød sirkel angir en kandidat transformant overlevende første-runde valg av BASTA spray. (C) andre-runde valg av BASTA drop test. Et eksempel på falske positiver (topp panel) og sanne transgene planter (nedre panel) vises. Klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4 : Bekreftelse av S. parvula transformasjon. (A) PCR forsterkning av bar genet fra genomisk DNAs utvunnet fra S. parvula planter. Lane 1 og 13: størrelse markører; Lane 2: negative kontroll; Lane 3-5: vill-type S. parvula ; Lane 6-10: transgene S. parvula kandidater; Lane 11, 12: vector kontroll. Baner 7, 8 og 9 eksemplifiserer positiv transformants. (B) eksempel på GUS reporter byggkorn under en positiv S. parvula transformant. Klikk her for å se en større versjon av dette tallet.

Media / løsning Reagens Beløp
Luria-Bertani (LB) bakterievekst media NaCl
Tryptone
Gjærekstrakt
Agar (for plater)
ddH2O
10 g
10 g
5 g
20 g
955 mL
Agrobacterium infiltrasjon løsning MS salt (1/4 x)
B5 vitaminer (1 x)
Sukrose (5%w/v)
MES
N6- benzylaminopurine (BA)
Silwet L-77 (0.05%v/v)
pH
2,16 g
1 mL
50 g
0,5 g
10 ΜL
500 ΜL
5.7

Tabell 1: sammensetningen av bakterievekst media og Agrobacterium infiltrasjon løsning.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Fysiologisk tilstand av anlegget betydelig påvirker effektiviteten av transformasjon25. Bruk av sunn og livskraftig planter for transformasjon er viktig for vellykket transformasjon i S. parvula. Vann eller lette stresset planter vil ha færre blomster sammenlignet med de friske plantene ideelt for transformasjon (figur 1, midtre panel). S. parvula kan vokse i lav intensitet mindre enn 130 µmol m-2 s-1, men de pleier å være frailer; slike anlegg vil føre til mer avbrutt blomster følge floral-dip. S. parvula tendens til å avbryte Agrobacterium-dyppet blomster på en høyere rente enn A. thaliana. Derfor bidrar hvert skritt tatt å minimere avbrutt blomster når dyppet i A. tumefaciens infiltrasjon løsningen til en høyere transformasjon effektivitet. Vi anbefaler en lys periode ikke lenger enn 14 h per dag. Transformasjon av A. thaliana utføres ofte på planter dyrket i en lang dag tilstand (18 h lys og 6 h mørket), eller selv under kontinuerlig lys. Men vi fant slik praksis resultat i mindre robust S. parvula planter og føre til en lav transformasjon effektivitet.

Blomsterknopper produseres kontinuerlig på sitter aksene av S. parvula (figur 2, hvite pilene). Derfor vil slik at transformasjonen av nye blomster vesentlig øke sjansen for å positiv transformants. En andre blomster-dukkert (trinn 5.3) er ikke viktig, men sterkt foreslått. Dette trinnet er imidlertid relativt tidkrevende sammenlignet A. thaliana floral dipping, fordi S. parvula produserer flere sitter akser.

Vill-type S. parvula er følsom for BASTA, selv om den første skjermen for positiv transformants med BASTA spray (trinn 6.3) vil forlate 5-8 overlevende planter av 100 frø spirer (Figur 3A og 3B). De fleste av dette (> 80%) vil være falske positive. Dette er smal blad form og bladet vinkelen på S. parvula, som ikke gir tilstrekkelig blad overflaten i en riktig retning beholde BASTA løsningen for tilstrekkelig tid observere en fenotypen. I tillegg, på grunn av høy voksen innholdet av adaxial blad overflaten av S. parvula10pleier det å skape et mer ugjennomtrengelig underlag for BASTA. Derfor er andre screening for positiv transformants bruke en BASTA dråpe på individuelle blader (trinn 6.4, Figur 3C) et viktig skritt å unngå PCR testing på hundrevis av falske positiver (trinn 6.5).

Gjeldende protokollen ble testet med A. tumefaciens belastningen GV3101 bærer pMP90RK plasmider. Effektiviteten av transformasjon kan forbedres med andre A. tumefaciens stammer, inkludert stammer ABI, LMG20 og C58C1 Rifr, med pMP90 virulens plasmider rapportert å øke transformasjon effektivitet i A. thaliana 25. Brassica og Eutrema arter er taksonomisk tettere knyttet til S. parvula sammenlignet med A. thaliana1. Derfor sil A. tumefaciens LBA4404 som ble brukt til å transformere Brassica napus og belastningen EHA105 som har blitt brukt med hell å transformere Eutrema salsugineum kan tilby en høyere transformasjon effektivitet enn rapportert effektiviteten av belastningen brukt26,27,28.

Redusere tid og arbeid som kreves av en transformasjon protokoll er en annen viktig faktor i å forbedre transformasjon. Plassering personlige BASTA drops på blader og overvåking blad for en uke på flere planter (trinn 6.4) er kjedelig. En fremtidig innsats for å effektivisere transformasjon kan søke etter passende alternativ valgbar markør gener29.

Tilgjengeligheten av en etablert transformasjon protokoll vil sterkt forhånd vår evne til å identifisere gener og romanen mekanismer som tillater extremophyte modell planter å overleve flere abiotiske understreker2,4. Romanen genetisk variasjon i S. parvula vil gi et bredere utvalg av genetisk variasjon som kan være minelagt fra den kollektive allel varianten som stress-responsive gener i relativt stress-sensitive modellen, A. thaliana Pan-genome5,6. Derfor vil våre blomster-dip basert A. tumefaciens mediert transformasjon protokoll utviklet for S. parvula fylle et gap for slike verktøy til å utføre funksjonelle genomisk eksperimenter i en extremophyte modell nært knyttet til A. thaliana.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Dette arbeidet ble støttet av en National Science Foundation award kalt MCB 1616827.

Materials

Name Company Catalog Number Comments
Agar VWR International, Radnor, PA 90000-762 Bacto Agar Soldifying Agent, BD Diagnostics
B5 vitamins Sigma-Aldrich, St. Louis, MO G1019 Gamborg’s Vitamin Solution
Desiccant W A Hammond Drierite, Xenia, OH 22005 Indicating DRIERITE 6 mesh
Destination vector for plant transformation TAIR Vector:6531113857 pKGWFS7
Electroporation cuvette USA Scientific 9104-5050 Electroporation cuvette, round cap, 0.2 cm gap
Electroporator BIO-RAD Laboratories, Hercules, CA 1652100 MicroPulser Electroporator
Fertilizer beads Osmocote Garden, Marysville, OH N/A Osmocote Smart-Release Plant Food Flower & Vegetable
Gel extraction kit iNtRON Biotechnology, Boston, MA 17289 MEGAquick-spin Total fragment DNA purification kit
Gentamicin Sigma-Aldrich, St. Louis, MO G1914-5G Gentamicin sulfate
Glufosinate-ammonium (11.3%) herbicide (BASTA) Bayer environmental science, Montvale, NJ N/A FINALE herbicide
Kanamycin VWR International, Radnor, PA 200004-444 Kanamycin monosulfate
MES Bioworld, Dublin, OH 41320024-2 MES, Free Acid
MS salt MP Biomedicals, Santa Anna, CA 092621822 Hoagland's modified basal salt mixture
N6-benzylaminopurine (BA)  Sigma-Aldrich, St. Louis, MO B3274 6-Benzylaminopurine solution
NaCl Sigma-Alrich S7653 Sodium chloride
Non-ionic detergent Sigma-Aldrich, St. Louis, MO 9005-64-5 TWEEN 20 
Plasmid isolation kit Zymo Research, Irvine, CA D4036 Zyppy Plasmid Kits
Recombinase enzyme mix kit Life Technology 11791-020 Gateway LR Clonase II Enzyme mix
Rifampicin Sigma-Aldrich, St. Louis, MO R3501-1G Rifampicin, powder, ≥ 97% (HPLC)
Shaking incubator ThermoFisher Scientific, Waltham, MA SHKE4450 MaxQ 4450 Benchtop Orbital Shakers
Soil mix Sun Gro SUN239223328CFLP Sun Gro Metro-Mix 360 Grower Mix
Spectinomycin VWR International, Radnor, PA IC15206705
Sterile 50 mL conical tubes USA Scientific, Ocala, FL 1500-1811 50 mL conical screw cap tubes, copolymer, racks, sterile
Sucrose VWR International, Radnor, PA 57-50-1 Sucrose, ACS
Surfactant solution Lehle seeds, Round Rock, TX VIS-02 Silwet L-77
Topoisomerase-based cloning kit Life Technologies, Carlsbad, CA K240020 pENTR/D-TOPO Cloning Kit, with One Shot TOP10 Chemically Competent E. coli
Tryptone VWR International, Radnor, PA 90000-282 BD Bacto Tryptone, BD Biosciences
Yeast Extract VWR International, Radnor, PA 90000-722  BD Bacto Yeast Extract, BD Biosciences

DOWNLOAD MATERIALS LIST

References

  1. Dassanayake, M., et al. The genome of the extremophile crucifer Thellungiella parvula. Nature Genetics. 43, (9), 913-918 (2011).
  2. Oh, D. -H., Dassanayake, M., Bohnert, H. J., Cheeseman, J. M. Life at the extreme: lessons from the genome. Genome Biology. 13, (3), 241 (2012).
  3. Whited, J. The Next Top Models. Cell. 163, (1), 18-20 (2015).
  4. Dassanayake, M., Yun, D. O. D., Bressan, R. A., Cheeseman, J. M., Bohnert, J. H. The scope of things to come: New paradigms in biotechnology. Plant Biotechnology and Agriculture: Prospects for the 21st Century. 19-34 (2009).
  5. Dittami, S. M., Tonon, T. Genomes of extremophile crucifers: New platforms for comparative genomics and beyond. Genome Biology. 13, (8), 166 (2012).
  6. Amtmann, A. Learning from evolution: Thellungiella generates new knowledge on essential and critical components of abiotic stress tolerance in plants. Molecular Plant. 2, (1), 3-12 (2009).
  7. Oh, D. -H., Hong, H., Lee, S. Y., Yun, D. -J., Bohnert, H. J., Dassanayake, M. Genome structures and transcriptomes signify niche adaptation for the multiple-ion-tolerant extremophyte Schrenkiella parvula. Plant Physiology. 164, (4), 2123-2138 (2014).
  8. Orsini, F., et al. A comparative study of salt tolerance parameters in 11 wild relatives of Arabidopsis thaliana. Journal of Experimental Botany. 61, (13), 3787-3798 (2010).
  9. Uzilday, B., Ozgur, R., Sekmen, A. H., Yildiztugay, E., Turkan, I. Changes in the alternative electron sinks and antioxidant defence in chloroplasts of the extreme halophyte Eutrema parvulum (Thellungiella parvula) under salinity. Annals of Botany. 115, (3), 449-463 (2015).
  10. Teusink, R. S., Rahman, M., Bressan, R. A., Jenks, M. A. Cuticular waxes on Arabidopsis thaliana close relatives Thellungiella halophila and Thellungiella parvula. International Journal of Plant Sciences. 163, (2), 309-315 (2002).
  11. Jarvis, D. E., Ryu, C. H., Beilstein, M. A., Schumaker, K. S. Distinct roles for SOS1 in the convergent evolution of salt tolerance in Eutrema salsugineum and Schrenkiella parvula. Molecular Biology and Evolution. 31, (8), 2094-2107 (2014).
  12. Clough, S. J., Bent, A. F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant Journal. 16, (6), 735-743 (1998).
  13. Koornneef, M., Meinke, D. The development of Arabidopsis as a model plant. Plant Journal. 61, (6), 909-921 (2010).
  14. Bai, J., Wu, F., Mao, Y., He, Y. In planta transformation of Brassica rapa and B. napus via vernalization-infiltration methods. Protocol Exchange. 10, 1028 (2013).
  15. Sparrow, P. A. C., Goldsack, C. M. P., Østergaard, L. Transformation technology in the Brassicaceae. Genetics and Genomics of the Brassicaceae. 505-525 (2011).
  16. Hoagland, D. R., Arnon, D. I. The water-culture method for growing plants without soil. California Agricultural Experiment Station Circular. 347, (347), 1-32 (1950).
  17. Saiki, R., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, (4839), 487-491 (1988).
  18. Sun, Y., Sriramajayam, K., Luo, D., Liao, D. J. A Quick, cost-free method of purification of dna fragments from agarose gel. Journal of Cancer. 3, 93-95 (2012).
  19. Sanger, F., Nicklen, S., Coulson, A. R. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America. 74, (12), 5463-5467 (1977).
  20. Bertani, G. Studies on Lysogenesis I. The mode of phage liberation by lysogenic Eschericia coli. Journal of Bacteriolgy. 62, (3), 293-300 (1951).
  21. Koncz, C., Martini, N., Szabados, L., Hrouda, M., Bachmair, A., Schell, J. Specialized vectors for gene tagging and expression studies. Plant Molecular Biology Manual. 53-74 (1994).
  22. Weigel, D., Glazebrook, J. Transformation of Agrobacterium using electroporation. Cold Spring Harbor Protocols. 2006, (30), (2006).
  23. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Research. 8, (19), 4321-4326 (1980).
  24. Inan, G. Salt cress. a halophyte and cryophyte Arabidopsis relative model system and its applicability to molecular genetic analyses of growth and development of extremophiles. Plant Physiol. 135, (3), 1718-1737 (2004).
  25. Ghedira, R., De Buck, S., Nolf, J., Depicker, A. The efficiency of Arabidopsis thaliana floral dip transformation is determined not only by the Agrobacterium strain used but also by the physiology and the ecotype of the dipped plant. Molecular Plant-Microbe Interactions. 26, (7), 823-832 (2013).
  26. Shaohong, F. U., Xianya, W. E. I., Yingze, N. I. U., Shixing, G. U. O. Transformation of Brassica napus with the method of floral-dip. Biotechnology: Genomics and Its Applications. 45-49 (2005).
  27. Li, J., Tan, X., Zhu, F., Guo, J. A rapid and simple method for Brassica napus floral-dip transformation and selection of transgenic plantlets. International Journal of Biology. 2, (1), 127 (2010).
  28. Li, H. Q., Xu, J., Chen, L., Li, M. R. Establishment of an efficient Agrobacterium tumefaciens-mediated leaf disc transformation of Thellungiella halophila. Plant Cell Reports. 26, (10), 1785-1789 (2007).
  29. Wu, G., Rossidivito, G., Hu, T., Berlyand, Y., Poethig, R. S. Traffic lines: New tools for genetic analysis in Arabidopsis thaliana. Genetics. 200, (1), 35-45 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics