Växternas tillväxt och Agrobacterium-medierad Floral-dip omvandlingen av den Extremophyte Schrenkiella parvula

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Agrobacterium-medierad omvandling med en blommig-dip metod kan användas framgångsrikt att skapa stabila transgena linjerna av extremophyte modell Schrenkiella parvula. Vi presenterar ett protokoll ändras från det för Arabidopsis thaliana, med tanke på olika tillväxt vanor och fysiologiska egenskaper av extremophyte.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Wang, G., Pantha, P., Tran, K. N., Oh, D. H., Dassanayake, M. Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula. J. Vis. Exp. (143), e58544, doi:10.3791/58544 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Schrenkiella parvula är en extremophyte som anpassas till olika abiotiska betonar, inklusive flera ion toxicitet betonar. Trots hög kvalitet genomisk resurser tillgängliga att studera hur växter anpassar sig till miljön betonas, dess värde som en funktionell genomik modell och verktyg har begränsats på grund av en möjlig omvandling systemet. I detta protokoll, redovisar vi hur man skapar stabila transgena S. parvula linjer med hjälp av Agrobacterium-medierad blommig-dip metod. Vi ändrade den omvandling-protokoll som används för A. thaliana för unika drag av S. parvula, såsom en obestämd blommande vana och en hög epicuticular vaxinnehåll på bladen. Kort, S. parvula frön stratifierades vid 4 ° C i fem dagar innan plantering. Växter har odlats på en fotoperiod en 14 h ljus och 10 h mörka och en 130 µmol m-2s-1 ljusintensitet, vid 22 ° C till 24 ° C. Åtta till nio veckor gamla växter med flera blomställningar valdes för omvandling. Dessa blomställningar var doppad i en infiltration lösning av Agrobacterium tumefaciens GV3101 bär pMP90RK Plasmiden. Vi genomförde två rundor av blomma doppa med ett intervall av tre till fyra veckor att effektivisera omvandling. T1 fröna samlades in och torkas i fyra veckor i en behållare med torkmedel innan groning till skärmen för kandidat omvandlas linjer. Resistens mot BASTA användes till skärmen T1 växter. Vi sprutade BASTA lösningen tre gånger med ett intervall på tre dagar med start på två veckor gamla växter att minska falska positiva. En BASTA drop test som utfördes på överleva enskilda växter för att identifiera sant positiva transformants. Omvandling effektivitet var 0,033%, vilket ger 3 – 4 transgena växter per 10.000 T1 frön sprids.

Introduction

I detta protokoll beskriver vi tillväxt och etablering av stabil transgena linjerna för extremophyte modell Schrenkiella parvula. Tillgången till en effektiv omvandling systemet är ett kännetecken för någon mångsidig genetisk modell. Växter som trivs i extrema miljöer, avses som extremophytes, ge en kritisk resurs för att förstå växt anpassningar till miljöpåfrestningar. Schrenkiella parvula (tidigare Thellungiella parvula och Eutrema parvulum) är ett sådant extremophyte modell, med expanderande genomisk resurser1,2,3,4,5. Dock har omvandlingen protokoll inte ännu rapporterats för S. parvula i publicerade studier.

Genomet hos S. parvula är det första publicerade extremophyte genomet i korsblommiga växter (senap-kål familjen) och visar en omfattande övergripande genomet synteny med icke-extremophyte modell, Arabidopsis thaliana1. Således, jämförande studier mellan A. thaliana och S. parvula kunde dra nytta av rikedomen av genetiska studier utförs på A. thaliana att göra informativa hypoteser om hur S. parvula genomet har utvecklats och reglerade annorlunda för att klara betonar extrema miljö5,6,7. S. parvula är en av de mest salt-toleranta arter (baserat på jord NaCl LD50) bland kända vilda släktingar av A. thaliana8. Utöver NaCl toleransen, S. parvula överlever och avslutar sin livscykel i närvaro av flera salt joner vid höga koncentrationer giftiga för de flesta växter7. Svar på de abiotiska påfrestningarna som är förhärskande i sitt naturliga habitat, har det utvecklats olika egenskaper, bland vilka flera har studerats på biokemiska eller fysiologisk nivå 8,9,10, 11.

Sedan 2010 har förekommit över 400 peer-reveiwed publikationer som används S. parvula som målart eller använt det vid en jämförelse med andra växt-genomet. Dock kunde en tydlig flaskhals identifieras med en närmare titt på vilken typ av studier har genomförts. Majoriteten av dessa rapporter diskutera den potentiella användningen av S. parvula i framtida studier eller använda det i jämförande genomisk och phylogenomic studier. På grund av ett proof-of-concept omvandling protokoll upprättats för S. parvula, det inte har använts i funktionella genomisk studier, trots att en av högsta kvalitet växt genomen hittills tillgängliga (> 5 Mb contig N50) monteras och Kommenterad i kromosomnivå pseudomolecules1.

Metoden Agrobacterium-medierad blommig-dip omvandling har blivit den mest allmänt använda metoden att skapa trasngenic linjer i A. thaliana, och utvecklingen av en reproducerbar system för omvandling var avgörande för dess framgång som en genetisk modell12,13. Dock har inte alla korsblommiga växter arter visat att omvandlas framgångsrikt med blommig-dip metod utvecklats för A. thaliana. Speciellt, har de korsblommiga Lineage II arter som inkluderar S. parvula varit motsträviga till blommig-dip baserad omvandling metoder14,15.

Obestämt blommande tillväxt vanan att S. parvula, kombinerat med dess smala blad morfologi har gjort det utmanande att anta metoden standard Agrobacterium-medierad blommig-dip omvandling. I denna studie rapporterar vi det ändrade protokollet har vi utvecklat för reproducerbara omvandling av S. parvula.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. växternas tillväxt

  1. Utsäde sterilisering (tillval)
    1. Förbereda 50% blekmedel i dubbeldestillerat vatten (ddH2O) med 1 eller 2 droppar av en icke-joniskt rengöringsmedel (se Tabell för material) i en 50 mL tub. Vänd röret flera gånger för att blanda lösningen.
      Obs: Det är bättre att genomföra utsäde sterilisering i ett laminärt flöde skåp med UV steriliserad yta för 15 min.
    2. Lägg till blekmedel lösningen till ~ 100 – 200 S. parvula frön i en 1,5 mL tub. Blanda väl och låt röret sitta i 5 min.
    3. Ta bort lut från röret och lägga 70% etanol. Skölj fröna genom pipettering flera gånger och ta sedan bort etanol lösningen omedelbart.
    4. Tvätta frön i steriliserat vatten för att avlägsna överflödig blekmedel och etanol, sedan bort vattnet. Upprepa detta steg 5 till 6 gånger.
  2. Utsäde stratifiering
    1. Sänk ned fröna i steriliserat vatten och lagra för 5 till 7 dagar vid 4 ° C. Alternativt så torkade unsterilized frön direkt på våt jord och placera jord facket för 5 till 7 dagar vid 4 ° C.
  3. Odling av växter i beredning av omvandling
    1. Fylla jorden blanda (se Tabell för material) till 7 x 6 cm2 krukor, Blötlägg krukor i vatten och spraya vatten från toppen för att säkerställa ett enhetligt våt odlingsmedium. Lägg till 5 – gödselmedel pärlor (se Tabell för material) på jordytan av varje pott.
      Obs: Såvitt vi har upplevt, växer S. parvula väl på någon jord mix där A. thaliana kan växa.
    2. Med hjälp av en våt tandpetare, överföra 20 ~ 25 frön per kruka på jordytan.
      Obs: En bekväm metod är att sätta en sats av 4 – 5 frön i de fyra hörnen och mitten av potten (figur 1, dag 15, till vänster).
    3. Täcka potten facket med en tydlig kupol att hålla frön under hög luftfuktighet under groning.
    4. Håll växten magasinen i en kammare som tillväxt med låg intensitet på 130 µmol m−2 s−1 ljus, 22 – 24 ° C temperatur och 14 h per dag/10 h per natt cykel. Ta bort kupoler efter 7-10 dagar efter groning. Tillsätt vatten från botten av facket att hålla jord fuktas jämnt på en önskvärd nivå.
    5. Sålla bort extra plantor och lämna bara 4 – 5 friska plantor per pott väl separerade från varandra (figur 1, dag 15, högra panelen).
    6. Försiktigt vattna växterna varannan dag och gödsla med 0,2 x Hoaglands lösning16 en gång varannan vecka.
      Obs: Att hålla jorden fukten på en enhetlig nivå är nyckeln till växande S. parvula konsekvent och hälsosamt.
    7. Fortsätta att växa växter för 8 – 10 veckor tills flera blomställningar producera 100 – 150 blommig knoppar per planta (figur 1, dag 60 – 80). Den dag planeras för blommig-dip baserad omvandlingen (steg 4,5), ta bort alla mogna och utveckla siliques från växterna.

2. kloning gen/genomisk elementet av intresse i en vektor för växt förvandling

  1. Förstärka det målet DNA-fragment som använder polymeras-kedjereaktion (PCR)17 och isolera PCR-produkten med hjälp av en gel utvinning kit (se Tabell för material) enligt protokollet kit eller någon annan lämplig metod att rena DNA använder agarosgel elektrofores17,18. Verifiera sekvensen av isolerade PCR-produkten genom Sanger sekvensering19.
  2. Klon önskad PCR-produkten in i kloning vektor och omforma den klonade bygga in den behöriga E. coli celler använder en topoisomeras-baserade kloning kit (se Tabell för material) efter tillverkarens riktlinjer.
  3. Sprida 50 µL av bearbetade produkter på Luria-Bertani20 (LB) agar bakterietillväxt media (tabell 1) med lämpliga antibiotika, e.g., 50 µg / mL Spectinomycin (se Tabell för material), och inkubera vid 37 ° C över natten.
  4. Följande dag, Välj 5 – 10 enstaka kolonier, Inokulera i flytande LB medium med lämplig antibiotika och Inkubera under varsam skakning vid 37 ° C under natten.
  5. Isolera plasmider använder en plasmid isolering kit (se Tabell av material) och verifierar genom Sanger sekvensering19 huruvida målet sekvensen förstärks i 2.1 korrekt klonas.
  6. Överföra klonade och verifierade PCR-produkten till en destination vektor för växt omvandling kompatibel med rekombination-baserade kloning (se Tabell för material), med ett recombinase enzym mix kit (se Tabell för material), följande kit tillverkarens anvisning. Upprepa från steg 2,3 till steg 2.5 att isolera och kontrollera kloner härbärgerat korrekt plasmid konstruktioner.

3. omvandla den vektor konstruera för växt förvandling till Agrobacterium tumefaciens

  1. Omvandla plasmiden för den vektor construct från 2,6 till A. tumefaciens stammen GV3101:pMP90RK21, som hyser en Rifampicin motstånd gen för kromosomala bakgrund urval. Använda lämpliga antibiotika, t ex Gentamycin eller Kanamycin (se Tabell för material), för val av växt förvandling konstruera (Ti plasmid). Ett kort protokoll för A. tumefaciens omvandling via elektroporation ingår i avsnitt 3.2.
  2. A. tumefaciens omvandling av elektroporation
    1. Tina den A. tumefaciens behöriga celler22 på is. Mixa 0,1 – 1 µg av Plasmiden beredd från 2.6, upplöst i 1 – 2 µL ddH2O, med behöriga celler på is. Överför blandningen till en elektroporation kyvetten (se Tabell för material).
    2. Utföra elektroporation på blandningen av plasmider och behöriga celler från 3.2.1, använder en electroporator (se Tabell för material) efter tillverkarens riktlinjer.
      Obs: Rengöra ytan på kyvetten innan elektroporation.
    3. Överföra reaktionsblandningen från kyvetten i en mikrocentrifug rör som innehåller 1,5 mL flytande LB och blanda väl med pipettering och inkubera i 1 h vid 28 ° C med milda skakningar.
  3. Inokulera den omvandlade A. tumefaciens från avsnitt 3.2 på LB plåtar som innehåller lämpliga val av antibiotika (t.ex. Kanamycin 25 µg / mL, Spektinomycin 50 µg / mL, Gentamycin 25 µg / mL och Rifampicin 50 µg / mL) och inkubera vid 28 ° C i 3 dagar.

4. Agrobacterium-medierad omvandling av S. parvula

  1. Inokulera singeln omvandlas kolonier från plåtar till 10 mL LB flytande media som innehåller antibiotika (samma som 3.3) i en steril 50 mL koniska rör (se Tabell för material). Inkubera under 24 h i en skakande inkubator (se Tabell för material) med 250 varv per minut vid 28 ° C.
  2. Överföra den bakteriella lösningen från 3.4.1 till en steril 250 mL-mätkolv, tillsätt 40 mL LB flytande media med lämplig antibiotika och inkubera 12 h tills den optiska densiteten vid 600 nm våglängd (OD600) når cirka 2.0.
  3. Centrifugera A. tumefaciens cultureat 3100 x g i 10 min. ta bort supernatanten och slamma bakteriekulturen i 40 mL A. tumefaciens infiltration lösning (tabell 1).
  4. Späd den återsuspenderade A. tumefaciens med infiltration lösning till en slutlig OD600 av 0,8. Tillsätt 25 µL av tensiden lösning (tabell 1) till 50 mL utspädd A. tumefaciens lösning och blanda genom att vända flera gånger.
  5. Doppa Blomställningen av växterna i A. tumefaciens lösningen bereds i avsnitt 4.4 för 20 s. användning en färsk bakteriell lösning efter doppning blomställning från sex krukor. Kontrollera att alla blommor har kontakt med lösningen. Pipettera bakteriella lösningar direkt på blommor ligger i nedre delen av Blomställningen om de inte kan doppas i lösningen.
    Obs: För den första omgång omvandlingen, se till att ta bort alla mogna och utveckla siliques med en vass skalpell eller liten sax. Ta inte bort siliques om utför omvandling för andra gången.

5. efter omvandling skötsel och andra omvandlingen

  1. Placera växterna blommig-doppad vågrätt i ren fack med kupoler att täcka växterna och placera i en mörk tillväxt rum för 1 – 2 dagar.
    Obs: Att hålla blommorna under hög luftfuktighet är viktigt i detta skede (figur 1, växter efter omvandling).
  2. Tillbaka växterna till upprätt läge och överföra växterna till ett tillväxt-rum med en 14 h per dag/10 h per natt cykel, 130 µmol m-2 s-1 ljusintensitet och 22-24 ° C temperatur.
  3. Övervaka doppade blomställningar i följande vecka. Om ett betydande antal blommor avbryta (figur 2), upprepa blommig dip (steg 4) efter ca 4 veckor eller efter ett stort antal blommor har nyutvecklade.
    Obs: Till skillnad från det beredning steget för första omformningen (steg 1.3.7), ta inte bort existerande eller utveckla siliques (figur 2) innan den andra omgången av omvandling.
  4. Odla växterna tills fröna mogna och skörda frön på ~ 21 veckor.
  5. Torra frön för 2 – 3 veckor i rumstemperatur i en lufttät behållare med fylld med torkmedel (se Tabell för material).

6. Val av positiva Transformants

  1. Plantera frön T1 som beskrivs för vildtyp frön i steg 1.2-1.3.
  2. Odla växterna tills första 2 sanna bladen utvecklas, cirka 10 – 14 dagar efter groning.
  3. Utför det första valet för herbicid motstånd (figur 3A och 3B) som beskrivs nedan.
    1. Späd den herbiciden glufosinatammonium (11,3%) (eller BASTA) (tabell 1) till 1:1,000 (v/v). Spraya utspädd BASTA lösning på plantorna och täcka plantorna med kupoler över natten.
    2. Upprepa BASTA sprutning 2 – 3 gånger varje 5 – 7 dagar.
  4. Utföra andra markeringen med en BASTA-droppa prov enligt nedan.
    1. Identifiera växter att överlever efter att besprutas 3 – 4 gånger med BASTA lösning. Odla växterna ytterligare 2 – 3 veckor tills 3 – 5 bladen utveckla en relativt stor yta.
    2. Välj den största mogna bladen per planta, gnugga ytan av bladet försiktigt med ett finger för att ta bort vax lager och placera en droppe utspädd BASTA lösning (från steg 6.3.1).
      Obs: Markera platsen för bladet tillämpas med BASTA släpp genom att placera en papperstejp på närmaste stammen.
    3. Övervaka bladen tillämpas med BASTA släpp för tecken på vissnande i upp till en vecka. Välj växter med blad som är opåverkad av den BASTA droppar.
      Obs: Bladen från mest falskt positiva växter börjar vissnar inom två dagar, medan bladen från true-positiva är intakt även efter släpp av BASTA lösningen torkar upp (figur 3C).
  5. Bekräfta positiva transformants med genomiska PCR.
    1. Samla 2 – 3 blad från den överlevande växter vid steg 6.4.5.
    2. Extrahera genomiskt DNA från bladen använder CTAB metod23 eller någon annan lämplig DNA extraktion metod.
    3. Utför PCR med extraherade genomisk DNA-prover från målet växter, vilda växter (som negativa kontroller) och den plasmid bygga från steg 3.1 (som en positiv kontroll). Använd ett lämpligt par PCR primers specifika för den selektiva markörgen, e.g., för BASTA-resistent gen (bar), TCAGCAGGTGGGTGTAGA (framåt) och GTCAACCACTACATCGAGACAA (bakåt).
      1. För exempel PCR primers inriktning genen bar , använda följande PCR villkor: det inledande denaturering steget vid 98 ° C i 30 s; följt av 30 cykler av denatureringen vid 98 ° C i 30 s, glödgning vid 59 ° C i 30 s, och att utvidga vid 72 ° C i 30 s; och slutliga förlängningen vid 72 ° C i 5 min.
        Obs: För att säkerställa införandet av hela T-DNA, rekommenderar vi också utför genomiska PCR med hjälp av en PCR-primer från selektiv markör-genen och en annan PCR-primer som är specifika för sekvensen mål klonade till växt förvandling vektorn vid steg
    4. Bekräfta förekomsten av den förväntade storleken på förstärkta bar PCR-produkten av agaros gelelektrofores17 för målet prover (figur 4A) samt av sekvensering den isolerade PCR-produkt19 med samma förfarande som i steg 2.1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Vi utvecklade en omvandling protokoll som möjliggör upptagning av T0 frön inom 150 dagar, med en blommig-dip metoden modifierad från som för A. thaliana. Figur 1 visar en sammanfattning av tidslinjen och S. parvula växter som representerar den optimala scenen för att utföra omvandlingen genom blommig-dip. Vi valde S. parvula växter med 70 – 80 blommor i flera blomställningar på 60 – 80 dagar efter groning som målfasen för omvandling. Ett litet antal befintliga öppna eller befruktade blommor och siliques i detta skede togs bort innan infiltrationen av A. tumefaciens av metoden blommig-dip. Infektion med A. tumefaciens resulterade i abort av några blommor (figur 2, fäste (a)). Siliques fullt utvecklad efter blommig-dip sannolikt innehåller omvandlade frön (figur 2, fäste (b)). Även efter omvandling, S. parvula fortsatte att utveckla nya blomställningar och blommor så länge växterna har hållits frisk (figur 2, vita pilarna). På grund av denna obestämda blommande vana, kan en andra omgång omvandling utföras om växten inte visar tecken på stress eller åldras. Figur 2 A och 2B visar exempel på S. parvula växter efter den första och andra omgången av omvandling, respektive 25 dagar ifrån varandra. I den andra förvandlingen, bör befintliga siliques inte tas bort eftersom de kan innehålla genmodifierade frön. Också, den A. tumefaciens kan appliceras genom pipettering infiltration lösningen (tabell 1) på nya framväxande blomma kluster, istället för att doppa hela fotograferingen i lösningen, att minimera skadan till siliques från först omvandling.

Omvandling effektiviteten är 0,033%, vilket ger 3 – 4 transgena växter per 10.000 T1 frön sprids med hjälp av det nuvarande protokollet. Denna uppskattning bygger på ~ 50 000 T1 frön testas under tio oberoende omvandling försök. Effektiviteten är lägre än för den Arabidopsis thaliana, är det jämförbart med omvandlingen av en annan extremophyte växten Eutrema salsugenium24 och några av de Arabidopsis thaliana ekotyper25. Omvandling effektivitet kan optimeras ytterligare med hjälp av alternativa Agrobacterium stammar och ändringar av tensid och infiltration lösningar. Den flera BASTA spray och släppa tester (steg 6.3 och 6.4) kommer att vara avgörande för att identifiera sant positiva transformants och minska antalet prov som testas använder PCR bekräftelsen i steg 6,5 (figur 4A). Ytterligare bekräftelse av omvandling kan kontrolleras med en reporter genuttryck, om klonade sekvensen innehåller en reporter gen (figur 4B).

Figure 1
Figur 1 : Tidslinje S. parvula omvandling. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: S. parvula växter efter omformning av blommig-dip. Plantorna var fotograferade 10 dagar efter första blommig-dip på dag 60 (A) och 25 dagar efter andra omgången av blommig-dopp i dag 85 (B). Infiltration med Agrobacterium kan avbryta skida utveckling av blommor som visas i parentes en. Siliques fullt utvecklad efter blommig-dip sannolikt innehåller omvandlade frön (parentes b). Vita pilar visar blommor och blomställningar nyligen uppstått efter varje omformning. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3 : Urval av S. parvula transformants baserat på BASTA motstånd. (A) T1 plantor innan den BASTA sprayen. (B) röd cirkel anger en kandidat transformant överleva första-rund val av BASTA spray. (C), andra omgången val av BASTA fallprov. Ett exempel på falska positiva (övre panelen) och sanna transgena växter (nedre panelen) visas. Klicka här för att se en större version av denna siffra.

Figure 4
Figur 4 : Bekräftelse av S. parvula omvandling. (A), PCR amplifiering av bar -genen från genomisk DNAs utvinns ur S. parvula växter. Lane 1 och 13: storlek markörer; Lane 2: negativ kontroll; Lane 3-5: vildtyp S. parvula ; Lane 6-10: transgena S. parvula kandidater; Lane 11, 12: smittospridare. Lanes 7, 8 och 9 exemplifiera positiva transformants. (B) exempel på GUS reporter genuttryck i en positiv S. parvula transformant. Klicka här för att se en större version av denna siffra.

Media / lösning Reagens Belopp
Luria-Bertani (LB) bakterietillväxt media NaCl
Trypton
Jästextrakt
Agar (för lameller)
ddH2O
10 g
10 g
5 g
20 g
955 mL
Agrobacterium infiltration lösning MS salt (1/4 x)
B5 vitaminer (1 x)
Sackaros (5%w/v)
MES
N6- benzylaminopurine (BA)
Silwet L-77 (0.05%v/v)
pH
2.16 g
1 mL
50 g
0,5 g
10 ΜL
500 ΜL
5.7

Tabell 1: sammansättning av bakterietillväxt media och Agrobacterium infiltration lösning.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Det fysiologiska tillståndet av anläggningen påverkar avsevärt effektiviteten i transformation25. Användning av friska och livskraftiga växter för omvandling är en viktig förutsättning för framgångsrik omvandling i S. parvula. Vatten eller ljus stressade växter kommer att ha färre blommor jämfört med de friska växterna som är idealisk för omvandling (figur 1, center panel). S. parvula kan växa med låg intensitet mindre än 130 µmol m-2 s-1, men växterna tenderar att vara svagare; sådana anläggningar skulle leda till mer aborterade blommor efter blommig-dip. S. parvula tenderar att avbryta Agrobacterium-doppad blommor i högre takt än A. thaliana. Därför, varje steg som vidtas för att minimera aborterade blommor när doppad i A. tumefaciens infiltration lösningen bidrar till en högre effektivitet i omvandling. Vi rekommenderar en lättare period längre än 14 h per dag. Omvandling av A. thaliana utförs ofta på växter som odlas i lång-dag skick (t.ex. 18 h ljus och 6 h mörk) eller ens under kontinuerlig ljus. Men vi hittade sådana metoder resultatet i mindre motståndskraftiga S. parvula växter och leda till en låg förvandling effektivitet.

Blomknoppar produceras kontinuerligt blomställning yxorna av S. parvula (figur 2, vita pilarna). Därför skulle tillåter omvandling av nya blommorna avsevärt öka chansen att få positiva transformants. En andra blommig-dip (steg 5.3) är inte nödvändigt, men starkt föreslagna. Detta steg är dock relativt tidskrävande jämfört med A. thaliana blommig doppning, eftersom S. parvula producerar flera blomställning axlar.

Vildtyp S. parvula är känslig för BASTA, även om den initiala skärmen för positiva transformants med BASTA spray (steg 6.3) kommer att lämna 5 – 8 överlevande växter ur 100 frön grodda (figur 3A och 3B). De flesta av detta (> 80%) kommer att vara falska positiva. Detta beror till stor del på formen smala blad och blad vinkel S. parvula, som inte ger tillräcklig blad yta i en lämplig orientering att behålla den BASTA lösningen för en tillräckligt lång för att iaktta en fenotyp. Dessutom, på grund av hög vax innehållet av adaxial blad yta S. parvula10tenderar det att skapa en mer ogenomtränglig yta för BASTA. Den andra screeningen för positiva transformants med en BASTA-släpp på enskilda blad (steg 6,4, figur 3C) är därför ett viktigt steg att undvika PCR tester på hundratals falska positiva (steg 6,5).

Det nuvarande protokollet testades med A. tumefaciens stam GV3101 bär pMP90RK Plasmiden. Effektiviteten i omvandling kan förbättras med andra A. tumefaciens stammar, inklusive stammar ABI, LMG20 och C58C1 Rifr, med pMP90 virulens plasmiden rapporterade att öka omvandlingen effektiviteten i A. thaliana 25. Brassica och Eutrema arter taxonomiskt är närmare släkt med S. parvula jämfört med A. thaliana1. Därför stam den A. tumefaciens LBA4404 som användes framgångsrikt omvandla Brassica napus och stam EHA105 som har använts framgångsrikt att omvandla Eutrema salsugineum kan erbjuda en högre omvandling effektivitet än rapporterade effektiviteten av stammen används för närvarande26,27,28.

Att minska den tid och arbete som krävs av en omvandling protokoll är en annan viktig faktor i effektivare omvandling. Att placera enskilda BASTA droppar på blad och övervakning blad för en vecka på flera växter (steg 6,4) är tråkiga. En framtida ansträngningar att effektivisera omvandling kan söka efter lämpliga alternativa valbara markör gener29.

Tillgängligheten av en etablerad omvandling protokollet kommer att kraftigt föra vår förmåga att identifiera gener och nya mekanismer som tillåter extremophyte modell växter att överleva flera abiotiska betonar2,4. Romanen genetisk variation i S. parvula kommer att ge en bredare pool av genetisk variation som inte kan brytas från den kollektiva alleliska variation identifieras som stress-lyhörd gener i relativt stress-känsliga modellen, A. thaliana Pan-genomet5,6. Därför kommer att våra blommiga-dip baserad A. tumefaciens medierad omvandling protokoll som utvecklats för S. parvula fylla en lucka för behovet av sådana verktyg att utföra funktionella genomisk experiment i en extremophyte modell nära besläktade A. thaliana.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har något att avslöja.

Acknowledgments

Detta arbete stöds av en National Science Foundation award MCB 1616827.

Materials

Name Company Catalog Number Comments
Agar VWR International, Radnor, PA 90000-762 Bacto Agar Soldifying Agent, BD Diagnostics
B5 vitamins Sigma-Aldrich, St. Louis, MO G1019 Gamborg’s Vitamin Solution
Desiccant W A Hammond Drierite, Xenia, OH 22005 Indicating DRIERITE 6 mesh
Destination vector for plant transformation TAIR Vector:6531113857 pKGWFS7
Electroporation cuvette USA Scientific 9104-5050 Electroporation cuvette, round cap, 0.2 cm gap
Electroporator BIO-RAD Laboratories, Hercules, CA 1652100 MicroPulser Electroporator
Fertilizer beads Osmocote Garden, Marysville, OH N/A Osmocote Smart-Release Plant Food Flower & Vegetable
Gel extraction kit iNtRON Biotechnology, Boston, MA 17289 MEGAquick-spin Total fragment DNA purification kit
Gentamicin Sigma-Aldrich, St. Louis, MO G1914-5G Gentamicin sulfate
Glufosinate-ammonium (11.3%) herbicide (BASTA) Bayer environmental science, Montvale, NJ N/A FINALE herbicide
Kanamycin VWR International, Radnor, PA 200004-444 Kanamycin monosulfate
MES Bioworld, Dublin, OH 41320024-2 MES, Free Acid
MS salt MP Biomedicals, Santa Anna, CA 092621822 Hoagland's modified basal salt mixture
N6-benzylaminopurine (BA)  Sigma-Aldrich, St. Louis, MO B3274 6-Benzylaminopurine solution
NaCl Sigma-Alrich S7653 Sodium chloride
Non-ionic detergent Sigma-Aldrich, St. Louis, MO 9005-64-5 TWEEN 20 
Plasmid isolation kit Zymo Research, Irvine, CA D4036 Zyppy Plasmid Kits
Recombinase enzyme mix kit Life Technology 11791-020 Gateway LR Clonase II Enzyme mix
Rifampicin Sigma-Aldrich, St. Louis, MO R3501-1G Rifampicin, powder, ≥ 97% (HPLC)
Shaking incubator ThermoFisher Scientific, Waltham, MA SHKE4450 MaxQ 4450 Benchtop Orbital Shakers
Soil mix Sun Gro SUN239223328CFLP Sun Gro Metro-Mix 360 Grower Mix
Spectinomycin VWR International, Radnor, PA IC15206705
Sterile 50 mL conical tubes USA Scientific, Ocala, FL 1500-1811 50 mL conical screw cap tubes, copolymer, racks, sterile
Sucrose VWR International, Radnor, PA 57-50-1 Sucrose, ACS
Surfactant solution Lehle seeds, Round Rock, TX VIS-02 Silwet L-77
Topoisomerase-based cloning kit Life Technologies, Carlsbad, CA K240020 pENTR/D-TOPO Cloning Kit, with One Shot TOP10 Chemically Competent E. coli
Tryptone VWR International, Radnor, PA 90000-282 BD Bacto Tryptone, BD Biosciences
Yeast Extract VWR International, Radnor, PA 90000-722  BD Bacto Yeast Extract, BD Biosciences

DOWNLOAD MATERIALS LIST

References

  1. Dassanayake, M., et al. The genome of the extremophile crucifer Thellungiella parvula. Nature Genetics. 43, (9), 913-918 (2011).
  2. Oh, D. -H., Dassanayake, M., Bohnert, H. J., Cheeseman, J. M. Life at the extreme: lessons from the genome. Genome Biology. 13, (3), 241 (2012).
  3. Whited, J. The Next Top Models. Cell. 163, (1), 18-20 (2015).
  4. Dassanayake, M., Yun, D. O. D., Bressan, R. A., Cheeseman, J. M., Bohnert, J. H. The scope of things to come: New paradigms in biotechnology. Plant Biotechnology and Agriculture: Prospects for the 21st Century. 19-34 (2009).
  5. Dittami, S. M., Tonon, T. Genomes of extremophile crucifers: New platforms for comparative genomics and beyond. Genome Biology. 13, (8), 166 (2012).
  6. Amtmann, A. Learning from evolution: Thellungiella generates new knowledge on essential and critical components of abiotic stress tolerance in plants. Molecular Plant. 2, (1), 3-12 (2009).
  7. Oh, D. -H., Hong, H., Lee, S. Y., Yun, D. -J., Bohnert, H. J., Dassanayake, M. Genome structures and transcriptomes signify niche adaptation for the multiple-ion-tolerant extremophyte Schrenkiella parvula. Plant Physiology. 164, (4), 2123-2138 (2014).
  8. Orsini, F., et al. A comparative study of salt tolerance parameters in 11 wild relatives of Arabidopsis thaliana. Journal of Experimental Botany. 61, (13), 3787-3798 (2010).
  9. Uzilday, B., Ozgur, R., Sekmen, A. H., Yildiztugay, E., Turkan, I. Changes in the alternative electron sinks and antioxidant defence in chloroplasts of the extreme halophyte Eutrema parvulum (Thellungiella parvula) under salinity. Annals of Botany. 115, (3), 449-463 (2015).
  10. Teusink, R. S., Rahman, M., Bressan, R. A., Jenks, M. A. Cuticular waxes on Arabidopsis thaliana close relatives Thellungiella halophila and Thellungiella parvula. International Journal of Plant Sciences. 163, (2), 309-315 (2002).
  11. Jarvis, D. E., Ryu, C. H., Beilstein, M. A., Schumaker, K. S. Distinct roles for SOS1 in the convergent evolution of salt tolerance in Eutrema salsugineum and Schrenkiella parvula. Molecular Biology and Evolution. 31, (8), 2094-2107 (2014).
  12. Clough, S. J., Bent, A. F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant Journal. 16, (6), 735-743 (1998).
  13. Koornneef, M., Meinke, D. The development of Arabidopsis as a model plant. Plant Journal. 61, (6), 909-921 (2010).
  14. Bai, J., Wu, F., Mao, Y., He, Y. In planta transformation of Brassica rapa and B. napus via vernalization-infiltration methods. Protocol Exchange. 10, 1028 (2013).
  15. Sparrow, P. A. C., Goldsack, C. M. P., Østergaard, L. Transformation technology in the Brassicaceae. Genetics and Genomics of the Brassicaceae. 505-525 (2011).
  16. Hoagland, D. R., Arnon, D. I. The water-culture method for growing plants without soil. California Agricultural Experiment Station Circular. 347, (347), 1-32 (1950).
  17. Saiki, R., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, (4839), 487-491 (1988).
  18. Sun, Y., Sriramajayam, K., Luo, D., Liao, D. J. A Quick, cost-free method of purification of dna fragments from agarose gel. Journal of Cancer. 3, 93-95 (2012).
  19. Sanger, F., Nicklen, S., Coulson, A. R. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America. 74, (12), 5463-5467 (1977).
  20. Bertani, G. Studies on Lysogenesis I. The mode of phage liberation by lysogenic Eschericia coli. Journal of Bacteriolgy. 62, (3), 293-300 (1951).
  21. Koncz, C., Martini, N., Szabados, L., Hrouda, M., Bachmair, A., Schell, J. Specialized vectors for gene tagging and expression studies. Plant Molecular Biology Manual. 53-74 (1994).
  22. Weigel, D., Glazebrook, J. Transformation of Agrobacterium using electroporation. Cold Spring Harbor Protocols. 2006, (30), (2006).
  23. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Research. 8, (19), 4321-4326 (1980).
  24. Inan, G. Salt cress. a halophyte and cryophyte Arabidopsis relative model system and its applicability to molecular genetic analyses of growth and development of extremophiles. Plant Physiol. 135, (3), 1718-1737 (2004).
  25. Ghedira, R., De Buck, S., Nolf, J., Depicker, A. The efficiency of Arabidopsis thaliana floral dip transformation is determined not only by the Agrobacterium strain used but also by the physiology and the ecotype of the dipped plant. Molecular Plant-Microbe Interactions. 26, (7), 823-832 (2013).
  26. Shaohong, F. U., Xianya, W. E. I., Yingze, N. I. U., Shixing, G. U. O. Transformation of Brassica napus with the method of floral-dip. Biotechnology: Genomics and Its Applications. 45-49 (2005).
  27. Li, J., Tan, X., Zhu, F., Guo, J. A rapid and simple method for Brassica napus floral-dip transformation and selection of transgenic plantlets. International Journal of Biology. 2, (1), 127 (2010).
  28. Li, H. Q., Xu, J., Chen, L., Li, M. R. Establishment of an efficient Agrobacterium tumefaciens-mediated leaf disc transformation of Thellungiella halophila. Plant Cell Reports. 26, (10), 1785-1789 (2007).
  29. Wu, G., Rossidivito, G., Hu, T., Berlyand, Y., Poethig, R. S. Traffic lines: New tools for genetic analysis in Arabidopsis thaliana. Genetics. 200, (1), 35-45 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics