I Vitro generasjon av Somite derivater fra menneske indusert stamceller Pluripotent

Developmental Biology
 

Summary

Vi presenterer her en protokoll for differensiering av menneskelig indusert pluripotent stamceller i hver somite derivat (myotome, sclerotome, dermatome og syndetome) i kjemisk definerte forhold, som har programmer i fremtidige sykdom modellering og cellen-basert terapi i Ortopedisk kirurgi.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Nakajima, T., Sakurai, H., Ikeya, M. In Vitro Generation of Somite Derivatives from Human Induced Pluripotent Stem Cells. J. Vis. Exp. (146), e59359, doi:10.3791/59359 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Som svar til signaler som WNTs bein Morfogenetiske proteiner (BMP) og soniske pinnsvin (SSH) skilles ut fra omkringliggende vev, somites (SMs) gi opphav til flere celletyper, inkludert myotome (MYO), sclerotome (SCL), dermatome (D) og syndetome (SYN) , som i sin tur utvikler i skjelettmuskulatur, støpsel skjelett, dorsal dermis og aksial sene/ligament, henholdsvis. Generering av SMs og deres derivater fra menneskelige indusert pluripotent stamceller (iPSCs) er derfor viktig å få pluripotent stamceller (PSCer) for programmet i regenerativ medisin og sykdom forskning innen Ortopedisk kirurgi. Selv om induksjon protokollene for MYO og SCL fra PSCer har tidligere rapportert flere forskere, har ingen studie likevel vist induksjon av SYN og D fra iPSCs. Derfor forblir effektiv induksjon av fullt kompetente SMs en stor utfordring. Her recapitulate vi menneskelige SM mønstre med menneskelige iPSCs i vitro ved å etterligne signalnettverk miljøet under chick/mus SM utvikling og rapport om metoder for systematisk induksjon av SM derivater (MYO, SCL, D og SYN) fra menneskelig iPSCs under kjemisk definerte forhold gjennom presomitic mesoderm (PSM) og SM stater. Kunnskap om chick/mus SM utvikling ble brukt til induksjon av SMs med menneskelige iPSCs. Denne metoden kan være et romanen verktøy for studerer menneskelig somitogenesis og mønstre uten bruk av embryo og cellen-basert terapi og sykdom modellering.

Introduction

Utvikle en rettet differensiering metode for en ønsket celle fra PSCer er et nødvendig skritt for å oversette studiet av PSC-avledet celler i kliniske applikasjoner. Tvunget uttrykk for viktige gener er en lovende strategi for orgel-celle differensiering fra PSCer og har forbedret vår forståelse av genetisk regulering av cellen skjebne besluttsomhet og orgel morphogenesis organisasjonen under embryogenesis1. I tillegg anses recapitulating endogene signalnettverk omgivelser, med utviklingen av mus og kylling embryoer som et veikart, viktig for rettet differensiering av PSCer. Imidlertid gitt anvendelse av PSC-avledet celler i kliniske studier som cellen-basert behandling, sistnevnte strategien er mer egnet fordi den ikke krever genet manipulasjon.

Flere studier har rapportert induksjon av mesoderm fra menneskelige og mus PSCer i kjemisk definert forhold. Vanligvis disse metodene avhengig activin/knutepunktet/omforming vekst faktor β (TGFβ) signalering og bein Morfogenetiske proteinet (BMP) signaliserer, antas å utføre meso-endoderm og mesoderm differensiering, noe som resulterer i en lav induksjon effektiviteten av paraxial mesoderm (ca 20%)2. Med andre ord, var PSC-avledet mesoderm av disse signalveier hovedsakelig lateral plate mesoderm og ikke paraxial mesoderm. Nylig, noen studier har vist en effektiv produksjon av PSC-avledet paraxial mesoderm basert på ulike strategier3,4,5,6,7,8 . I disse studiene, PSCer ble kultivert med relativt høye konsentrasjoner av glykogen syntase kinase 3 (GSK3) hemmere (WNT signalnettverk Aktivator), følgelig induksjon effektiviteten av paraxial mesoderm nådde 70-95%6,7 .

I somitogenesis, paraxial mesoderm første danner de presomitic mesoderm (PSM) posteriorly, og deretter danner somites (SMs) i den fremre delen til mesenchyme-til-epitelial overgang9,10. Hakk ligand Delta-lignende 1 (DLL1) er kjent å ha en sentral rolle under somitogenesis, som oscillasjon kontroll av DLL1 uttrykk, både i mRNA og protein nivå, regulerer SM segmentering. SMs til slutt dele i to deler, gir opphav til dermomyotome (DM) på ryggen og sclerotome (SCL) ventrally11. Deretter skiller DM i dermatome (D), en forløper i dermis og myotome (MYO), en forløper til Skjelettmuskel; i tillegg danner en ventrale porsjon SCL syndetome (SYN), en forløper til tendons og leddbånd12 (figur 1). Noen forskere har rapportert induksjon av PSC-avledet SM derivater som MYO4,13 og SCL14; Det er imidlertid flere begrensninger i disse studiene. Spesielt siden vår kunnskap om de signalnettverk miljøene D og SYN er fragmentert, har induksjon protokoller for D og SYN ennå ikke blitt systematisk etablert. For å demonstrere full-kompetanse SMs indusert fra PSCer, er det viktig å vise flere differensiering kapasitet indusert SMs til alle fire derivater (D, MYO, SCL og SYN), mens tidligere studier har bare fokusert på spesifikke SM derivater. Her rapporterer vi om hvordan å generere alle fire SM derivater, inkludert D og SYN, gjennom PSM og SM skjebne menneskelige iPSCs15. Vi tror at etablere en i vitro gradvis metode som modeller SM utviklingsprosessen kan bidra til studiet av hvordan menneskelige SM utvikler under embryogenesis, uten å bruke embryoer.

Protocol

Alle eksperimentelle protokoller som involverer menneskelige iPSCs ble godkjent av den etiske komiteen av Institutt for indremedisin og Graduate School of Medicine, Kyoto University.

1. menneskelige iPSCs forberedelse før induksjon

Merk: Kultur menneskelig iPSCs (201B7-PAX3-GFP) på SNL mater celler16 med primas ES celle medium med 4 ng/mL rekombinant menneskets grunnleggende fibroblast vekstfaktor (FGF2) og 0,5% penicillin og streptomycin (heretter omtalt som hESC medium, kan du se Tabell 1). Når samløpet forholdet når 70%-80%, passasjen cellene som beskrevet tidligere17.

  1. Passaging av menneskelig iPSCs på SNL mater celler17
    1. Passaging, legge til PBS i celle culturing fatet og skyll celler. Deretter fjerner PBS (heretter, denne prosessen vil bli referert til som vask med PBS).
    2. Legge 1 mL av CTK løsning (se tabell 1) ved romtemperatur (RT) og vent til SNL mater cellene starte frakobling fra bunnen av parabolen.
    3. Fjern CTK løsningen og deretter vaske to ganger med PBS.
    4. Legge 1 mL av hESC medium (se tabell 1) i fatet, deretter skrape cellene med skraper og samle inn i et 15 mL konisk rør.
    5. Pipetter forsiktig innholdet fem ganger med et 1000 µL tips, og deretter overføre til en ny rett fylt med hESC medium. Bruke split forholdet 1:4 til 1:10, avhengig av samløpet forholdet før passaging. Også variere mengden hESC medium avhengig av omfanget av parabolen (f.eks 3 mL for en 6 cm rett, 8 mL for en 10 cm rett).
    6. Inkuber den menneskelige iPSCs på 37 ° C og 5% CO2.
    7. Endre middels hverdagen (bortsett fra dagen etter passaging) og kultur cellene til fremgangsmåten nedenfor passaging.
  2. Arkmater-fri dyrking av menneskelig iPSCs før PSM induksjon
    Merk:
    for å minimere effekten av vekstfaktorer skilles ut fra SNL mater celler, kultur av menneskelig iPSCs under mater-gratis forhold med en mater-fri celle kultur medium (se tabell 1) på ekstracellulær matrix (EFM) løsninger (se tabell 1) bestrøket parabolen for 3 dager før PSM induksjon.
    1. Dag -4 (4 dager før start PSM induksjon)
      1. For å forberede ECM løsning-belagt parabolen, legge 4 mL av ECM løsning på en 10 cm rett på 4 ° C over natten.
        Merk: Plasser ECM løsning på is klargjøring.
    2. Dag -3
      1. Først fjerne ECM løsningen fra retten og legge til 8 mL mater-fri celle kultur medium.
      2. For å starte mater-fri dyrking, vask en gang med PBS skylle kulturperler cellene.
      3. Legge 1 mL av CTK løsning på RT til SNL mater cellene begynner frakobling fra bunnen av parabolen.
        Merk: Bruke mikroskopi for å bekrefte alle mater celler er løsrevet fra bunnen.
      4. Fjerne CTK løsningen og vask med PBS to ganger, slik at alle SNL mater celler fjernes fullstendig.
      5. Legge 1 mL av mater-fri celle kultur medium i retten, og skrape cellene med skraper og samle dem i en 15 mL konisk rør.
      6. Forsiktig Pipetter innholdet tre ganger ved å bruke et 1000 µL tips, deretter overføre til en ny ECM løsning-belagt 10 cm rett (forberedt under trinn 1.2.1). Bruke split forholdet omtrent 1:2 til 1:4, avhengig av samløpet forholdet før mater-fri dyrking.
      7. Inkuber den menneskelige iPSCs på 37 ° C og 5% CO2 i 3 dager, endring mediet på dag -1.

2. PSM differensiering og isolasjon av fluorescens-aktivert celle sortering (FACS)

  1. PSM differensiering (0-dag 4)
    1. Sug opp mater-fri celle kultur medium og legge 8 mL av PSM induksjon medium (CDM basale medium med 10 µM SB431542, 10 µM CHIR99021, 2 µM DMH1 og 20 ng/mL FGF2, se tabell 1).
      Merk: Cellen der ved initiering av PSM differensiering er avgjørende for induksjon effektivitet. Bruke mikroskopi for å bekrefte confluent er ca 30%.
    2. Inkuber celler ved 37 ° C, med 5% CO2for 4 dager, endring mediet på dag 3.
    3. Høste celler for FACS på dag 4 (seksjon 2.2, nedenfor).
  2. Isolering av DLL1 positive PSM celler fluorescens-aktivert celle sortering (FACS)
    Merk:
    nedenfor er en prosedyre for cellen forberedelser før FACS sortering av DLL1 positive celler. Utføre FACS sortere ved hjelp av en flyt cytometer, i henhold til produsentens protokollen.
    1. Sug opp mediet, og vask med PBS. Deretter legge 1 mL av cellen dissosiasjon reagens og la for 3 min på RT.
    2. Legge 4 mL av CDM basale medium, skrape cellene med skraper og samle dem i en 15 mL konisk rør.
    3. Teller antall celler med en automatisert celle teller, så sentrifuge 280 x g i 3 minutter.
    4. Nøye fjerne nedbryting av aspirasjon og resuspend cellene i FACS buffer (se tabell 1) i en konsentrasjon av 1.0 x 107 celler/mL. For en negativ kontroll prøven (isotype kontroll, eller i konvensjonen uten antistoff), overføre 50 µL inn i et 15-mL konisk rør og deretter suspendere med 450 µL FACS bufferen.
    5. Legge til DLL1 antistoff (se Tabell for materiale) i forholdet 1/200. Beskytte røret fra lys og holde på is 30 min.
    6. Sentrifuger 280 x g i 3 minutter.
    7. Nøye Sug opp nedbryting og resuspend i FACS buffer (1.0 x 107 celler/mL) med 1 mg/mL DAPI.
    8. Overføring til en samling rør, innlemmet med en 35 µm nylon maske i cap for filtrering, deretter plassere røret på is til sortering er fullført. Utføre den samme prosedyren med negativ kontroll prøven (trinn 2.2.4).
    9. Utføre sortere ved hjelp av en flyt cytometer i henhold til produsentens protokollen.
    10. Samle de sorterte DLL1 positive cellene i en 15 mL konisk tube, som inneholder 4 mL av CDM basale medium med 10 µM av Y27632. For total RNA utvinning, sentrifuge 280 x g for 3 min og deretter resuspend i RNA lyseringsbuffer og lagre på-30 ° C. Se RNA utvinning, omvendt transkripsjon og RT-qPCR prosedyrer (pkt. 5.1) for mer detaljert informasjon.
    11. Utføre SM differensiering med sorterte cellene i henhold til den under protokollen (del 3).

3. SM differensiering fra PSM

  1. SM differensiering fra sorterte DLL1 positive PSM celler (dag 4-dagers 8)
    Merk:
    forberede ECM løsning-belagt 12-vel platene dagen før FACS sortering. For å forberede en ECM løsning-belagt 12-vel plate, Legg 1 mL av ECM løsning i hver brønn ved 4 ° C og la over natten. Holde ECM løsningen på is klargjøring.
    1. Følgende trinn 2.2.10, sentrifuger 280 x g for 3 min.
    2. Nøye Sug opp nedbryting og resuspend i 1 mL av SM induksjon medium (CDM basale medium med 10 µM SB431542 og 5 µM CHIR99021, se tabell 1).
    3. Tell antall celler med en automatisert celle teller.
    4. Frø 1.0 x 105 celler på hver brønn av ECM løsning-belagt 12-vel platene som inneholder 1 mL av SM induksjon medium med 10 µM av Y27632.
    5. Ruge på 37 ° C med 5% CO2 i 4 dager til dag 8. Endre mediet ikke inneholder Y27632 på dag 5 (dagen etter FACS sortering) og dag 7.
    6. Utføre SM derivater differensiering bruke indusert SM celler etter protokollene nedenfor. For total RNA utvinning fra indusert SM celler, samle cellene i en 15-mL konisk rør og sentrifuger 280 x g i 3 minutter, deretter resuspend i RNA lyseringsbuffer og lagre på-30 ° C.

4. SM derivater (DM, MYO, D, SCL, SYN) differensiering fra SM

Merk: For å demonstrere full-kompetanse SM celler, må du først utføre DM (dermomyotome) og SCL (sclerotome) induksjon følgelig benytter iPSC-avledet SM celler. Deretter utføre MYO (myotome) og D (dermatome) induksjon med DM cellene, og gjennomføre SYN (syndetome) induksjon bruker SCL cellene. Nedenfor finner protokoller for induksjon av hver derivat (DM, MYO, D, SCL og SYN) fra indusert SM celler i vitro.

  1. DM differensiering fra SM celler (dag 8-dag 11)
    1. Sug opp mediet, og deretter legge 1 mL av DM induksjon medium (CDM basale middels med 5 µM CHIR99021 og 10 ng/mL BMP4, se tabell 1).
    2. Inkuber cellene på 37 ° C, med 5% CO2, 3 dager til dag 11. Endre mediet på dag 10 (dag 2 av DM induksjon).
    3. Utfør MYO og D differensiering bruker indusert DM celler i henhold til protokollene nedenfor.
  2. MYO differensiering fra DM celler (dag 11-dag 41)
    1. Sug opp mediet, og deretter legge 1 mL av MYO induksjon medium (CDM basale middels med 5 µM CHIR99021, se tabell 1).
    2. Inkuber cellene på 37 ° C, med 5% CO2, for 30 dager til dag 41. Endre mediet hver tredje dag.
  3. D differensiering fra DM celler (dag 11-dag 20)
    1. Sug opp mediet, og deretter legge 1 mL av D induksjon medium (CDM basale middels med 5 µM CHIR99021 og 10 ng/mL BMP4, se tabell 1).
    2. Inkuber cellene på 37 ° C, med 5% CO2, for 9 dager til dag 20. Endre mediet hver tredje dag.
  4. SCL differensiering fra SM celler (dag 8-dag 11)
    1. Sug opp mediet, og deretter legge 1 mL av SCL induksjon medium (CDM basale medium med 100 nM SAG og 0.6 µM LDN193189, se tabell 1)14.
    2. Inkuber cellene på 37 ° C, med 5% CO2, 3 dager. Endre mediet på dag 10 (dag 2 av SCL induksjon).
    3. Utføre SYN differensiering bruke indusert SCL celler i henhold til protokollen nedenfor.
  5. SYN differensiering fra SCL celler (dag 11-dag 32)
    Merk:
    forberede ECM løsning-belagt 24-vel platene dagen før starte SYN induksjon. For å forberede en ECM løsning-belagt 24-vel plate, Legg til 0,5 mL av ECM løsning i hver brønn ved 4 ° C og la over natten. Holde ECM løsningen på is klargjøring.
    1. Sug opp mediet og vask med PBS, deretter legge 0,2 mL celle dissosiasjon reagens til hver brønn og la for 3 min på RT.
    2. Tilsett 0,8 mL av CDM basale medium hver brønn og skrape og samle alle celler i en 15 mL konisk rør.
    3. Sentrifuger 280 x g i 3 minutter.
    4. Nøye Sug opp nedbryting og resuspend i 1 mL av SYN induksjon medium-1 (CDM basale medium med 20 ng/mL FGF8, se tabell 1), deretter teller antall celler med en automatisert celle teller.
    5. Frø 5.0 x 104 celler i hver brønn av ECM løsning-belagt 24-vel platene som inneholder 1 mL av SYN induksjon medium-1.
    6. Inkuber ved 37 ° C, med 5% CO2, 3 dager.
    7. På dag 14 (dag 3 av SYN induksjon), erstatte mediet med SYN induksjon medium-2 (CDM basale medium supplert med 10 ng/mL BMP7 og 10 ng/mL TGFβ3, se tabell 1).
    8. Inkuber ved 37 ° C, med 5% CO2, 18 dager til dag 32. Endre mediet hver tredje dag.

5. karakterisering av iPSC avledede produkter

Merk: På differensiering, karakterisere menneskelige iPSCs derivater med kvantitative sanntid PCR (RT-qPCR), immunocytochemistry (ICC), enzym knyttet immunosorbent analyser (ELISA) og mekanisk strekk stimulering analyser, tilsvarende.

  1. Cellen høsting, totale RNA utvinning, omvendt transkripsjon og kvantitative sanntid PCR (RT-qPCR) analyse
    1. Samle celle prøvene (prosedyrer 2.2.10, 3.1.6, 5.4.3) i en 1,5 mL tube, så sentrifuge 280 x g i 3 minutter.
    2. Fjern nedbryting, deretter resuspend i 350 µL av RNA lyseringsbuffer, levert av en passende totale RNA utvinning kit.
    3. Pakk ut totalt RNA bruke kit i henhold til produsentens protokollen.
    4. Omvendt transkribere det isolerte 1 µg av totale å cDNA, i henhold til produsentens protokollen.
    5. Utføre RT-qPCR passer enzymer, reagenser og primere i henhold til produsentens protokollen. Primer-sekvenser som er brukt i denne studien er oppført i tabell 2.
  2. Immunocytochemistry (ICC)
    1. Før du utfører immunocytochemistry med antistoffer, fikse cellene med 2% paraformaldehyde på 4 ° C i 10 min og vaskes to ganger med PBS.
    2. For permeabilization, ruge med 0,2% metanol eller 0,2% polysorbat 20/PBS (heretter kalt PBS-T) på 4 ° C i 15 min.
    3. Fjern permeabilization reagenser og behandle cellene med en passende blokkerer buffer eller 1% bovin serum albumin/PBS på 4 ° C for 60 min.
    4. Legg første antistoffer fortynnet med 10% blokkerer buffer i PBS-T og sted på en risting maskin på 4 ° C over natten.
    5. Vask tre ganger med PBS-T (legge til PBS-T og plassere på risting maskinen på RT for 10 min).
    6. Legge til andre antistoffer, fortynnet med 10% blokkerer buffer i PBS-T og sted på risting maskinen på RT for 60 min. Første og andre antistoffer for ICC brukt i denne studien er oppført i tabell 3.
      Merk: Dette trinnet og utover, beskytte plate/rett fra lys ved å pakke den i folie.
    7. Vaske to ganger med PBS-T.
    8. Counter flekker, legge 1/5000 DAPI fortynnet med PBS og sted på risting maskinen på RT for 5 min.
    9. Fjerne den DAPI løsningen og Legg PBS i hver brønn.
    10. Observere den cellen flekker bruker fluorescens mikroskop. Eventuelt lagre plate/retten på 4 ° C i opptil 1 måned.
  3. Enzym knyttet Immunosorbent analysen (ELISA) for funksjonsanalyse iPSC-avledet d
    Merk:
    menneskelige dermal fibroblast celler (HDF) er kommersielt tilgjengelig. Kultur HDF i DMEM med 10% fosterets bovin serum (se tabell 1).
    1. Frø 1.0 x 105 celler iPSC-avledet D og HDF på 24-vel plater som inneholder 1 mL av kultur medium (D: D induksjon medium, HDF: DMEM med 10% fosterets bovin serum).
    2. Etter 3 dager av cellen dyrking, samle 100 µL av medium, plassere i en 1,5 mL tube, og lagre på 4 ° C.
    3. Utføre en rekke prosedyrer, for eksempel gjenkjenning antistoffer og sekundære antistoffer, i henhold til produsentens instruksjoner, og kvantifisere antall mål ved å generere en standardkurve mot konsentrasjonen av kontrollen analytt prøver.
  4. Mekanisk strekk stimulering analysen for funksjonell analyse av iPSC-avledet SYN
    Merk:
    voksen menneskelig tenocytes er kommersielt tilgjengelig (se Tabell for materiale). Kultur menneskelige iPSC-avledet SYN og voksen human tenocytes en celle strekker enhet for mekanisk strekk stimulering analysen som beskrevet under18,19. Bruk SYN induksjon medium-2 og tenocytes vekst medium (se Tabell for materiale) som culturing medium for hver iPSC-avledet SYN og voksen menneskelige tenocytes, henholdsvis.
    1. På 24 h før strekking, plate 1.0 x 105 celler iPSC-avledet SYN og menneskelig tenocytes på ECM løsning-belagt multi godt type silikongummi chambers, hver med en kultur overflate 1,5 cm x 1,5 cm (se Tabell for materiale).
    2. Angi chambers på enheten for cellen strekking og tvinge monoaxial syklisk belastning (0,5 Hz, 5%) 12 h.
    3. For total RNA utvinning, legge til 350 µL av RNA lyseringsbuffer, og skrape og samle celler i en 1,5 mL tube for totale RNA utvinning og påfølgende RT-qPCR analyse (se prosedyre 5.1).

Representative Results

Alle tallene i denne rapporten ble oppnådd med 201B7-PAX3-GFP iPSCs, der EGFP erstatter en allelet av PAX3 koding rekkefølgen ekson 1. Etablering av 201B7-PAX3-GFP iPSCs blir beskrevet andre steder (H. Sakurai, personlig kommunikasjon). Den statistiske betydningen ble evaluert med statistisk programvare. P-verdier lavere enn 0,05 ble vurdert betydelig.

Karakteristikk av menneskelige iPSC-avledet PSM og SM celler
For å vurdere differensiering av menneskelig iPSCs mot SM gjennom PSM tilstand (figur 2A), FACS analyse, ble ICC analyse, og RT-qPCR analyse utført. Som vist i figur 2B, var over 85% av cellene positivt på DLL1, en markør av PSM, men negative for PAX3, en markør av SM, etter 4 dager med PSM induksjon med menneskelige iPSCs. Senere ble denne befolkningen PAX3 positive SM celler etter 4 dager med SM induksjon. PSM-SM overgangen ble også bekreftet av ICC (figur 2C) og RT-qPCR (figur 2D). TBX6, MSGN1 og WNT3A, PSM indikatorer uttrykt på PSM staten (dag 4), men ikke uttrykt på SM staten (dag 8). PARAXIS, MEOX1 og PAX3, SM markører, uttrykt på SM, men ikke uttrykt på PSM. Videre farging av CDH11, en markør for epithelialized SM, akkumuleres bare i celle-celle krysset, etter tillegg av SB431542 med CHIR99021 (figur 2E).

Karakteristikk av SM derivater indusert fra menneskelige iPSC-avledet SM celler
For å evaluere differensiering styrken på menneskelig iPSC-avledet SM, differensiering mot DM, MYO, D, SCL og SYN (figur 3A) ble vurdert av ICC analyse og PAX3 (GFP)-fluorescens. Som vist i figur 3B, DM differensiering ble bekreftet av ALX4 og EN1 flekker og PAX3 (GFP)-fluorescens; MYO differensiering ble bekreftet av MYOD, MYOG og Myosin tunge kjede (MHC) flekker; D differensiering ble bekreftet av EN1 og PDGFRa flekker; SCL differensiering ble bekreftet av PAX1, PAX9 og NKX3.2 flekker; og SYN differensiering ble bekreftet av SCX, MKX, COL1A1 og COL1A2 flekker.

Karakterisering av indusert D og SYN
1. enzym knyttet immunosorbent analysen (ELISA) for funksjonsanalyse iPSC-avledet d
I menneskekroppen er en av de primære funksjonene for dermal fibroblaster å skille ut ekstracellulær matrix (EFM) proteiner, som kollagen og hyaluronsyre som fuktighet til huden og hjelpe opprettholde huden strukturen. For å demonstrere at en tilsvarende mengde kollagen-type 1 og hyaluronsyre proteiner var utskilles i kultur medium for iPSC-avledet D og HDF, ble ELISA utført, som vist i figur 4A.

2. mekanisk strekke stimulering analysen for funksjonell analyse av iPSC-avledet SYN
Som flere studier har allerede rapportert, mekanisk stimulering påvirker sene utvikling før og etter fødsel, og fremmer differensiering av tenocytes forløper celler18,19. Derfor er det kjent at reaktivitet til mekanisk stress er en av egenskapene til tenocytes. For å demonstrere den sammenlignbare reaktivitet av menneskelig iPSC-avledet SYN og menneskelige voksne tenocytes, ble en mekanisk strekk stimulering analysen utført som vist i figur 4B.

Figure 1
Figur 1: skjematisk visning av hierarkiske differensiering av paraxial mesoderm. Presomitic mesoderm er en celle som transiently framgår i løpet av tidlig embryogenesis og gjennomgår segmentering til skjemaet somites. Somites er en forbigående stamcelleforskningen befolkning som gir opphav til flere celletyper, for eksempel sclerotome, dermomyotome, syndetome, dermatome og myotome celler, som til slutt differensiere i sene/Ligament, bein/brusk, skjelettlidelser muskel og dermis celler. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: FACS, RT-qPCR og ICC analyse av menneskelig iPSC-avledet PSM og SM. (A) skjematisk visning av en protokoll for SM differensiering gjennom PSM. (B) representant dot tomt DLL1 flekker og PAX3 (GFP)-fluorescens på dag 4 av PSM induksjon og dag 4 (dag 8 fra iPSC) i SM induksjon. (C) representant immunocytochemical bilder og PAX3 (GFP)-fluorescens på dag 4 av PSM induksjon og dag 4 (dag 8 fra iPSC) i SM induksjon. Celler var farget med anti-TBX6, PARAXIS og MEOX1 antistoffer (rød) og co farget med DAPI (blå) eller oppdaget med PAX3 (GFP)-fluorescens (grønn). (D) RT-qPCR analyse av markører for PSM og SM på iPSC, PSM og SM. Betyr ± standardfeilen (S.E.) fra tre sett av eksperimenter vises. (E) representant immunocytochemical bilder på dag 4 (dag 8 fra iPSC) av SM, kultivert i S10I10 (kombinasjon av SB431542 og IWR1, en inhibitor av WNT signalisering), S10 (SB431542), og S10C5 (kombinasjon av SB431542 og CHIR99021) forhold. Celler var farget med anti-CDH11 antistoff (rød) og co farget med DAPI (blå). iPS, indusert pluripotent stilk cellen; PSM, presomitic mesoderm; SM, somite; S10, SB431542 10 ΜM; C5, CHIR99021 5 ΜM; I10, IWR1 10 ΜM; Skalere barer = 50 μm. Dette tallet er endret fra Nakajima et al. (2018)15. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: ICC analyse av DM, MYO, D, SCL og SYN differensiert fra menneskelige iPSC-avledet SM. (A) skjematisk visning av protokoller for SM derivater differensiering. (B) representant immunocytochemical bilder og PAX3 (GFP)-fluorescens på dag 3 (dag 11 fra iPSC) av DM induksjon dag 30 (dag 41 fra iPSC) MYO induksjon, dag 9 (dag 20 fra iPSC) av D induksjon, dag 3 (dag 11 fra iPSC) av SCL induksjon og dag 21 (dag 32 fra iPSC) av SYN induksjon. DM, celler var farget med anti-ALX4 og EN1 antistoffer (rød) og co farget med DAPI (blå) eller oppdaget med PAX3 (GFP)-fluorescens (grønn); MYO, celler var farget med anti-MYOD, MYOG (rød) og MHC (cyan) antistoffer, også co farget med DAPI (blå); D, celler var farget med anti-EN1 (rød) og PDGFRa (cyan) antistoffer og co farget med DAPI (blå); SCL, celler var farget med anti-PAX1, PAX9 og NKX3.2 (rød) antistoffer og co farget med DAPI (blå); SYN, celler var farget med anti-SCX, MKX, COL1A1 og COL1A2 (rød) antistoffer og co farget med DAPI (blå). DM, dermomyotome; MYO, myotome; D, dermatome; SCL, sclerotome; SYN, syndetome; Skalere barer = 50 μm. Dette tallet er endret fra Nakajima et al. (2018)15. Klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4: funksjonell analysen av indusert D og SYN. (A) mengden av kollagen-type 1 og hyaluronic syre proteiner i kultur medium ble analysert av ELISA. (B) effekten av mekanisk strekk stimulering indusert SYN og menneskelige voksne tenocytes ble vurdert av RT-qPCR. Betyr ± standardfeilen (S.E.) fra tre sett av eksperimenter vises. * p < 0,05; ** p < 0.01; p < 0,001 av Dunnetts flere sammenligninger t-test forhold til Stretch (–). n.s, ikke signifikant, HDF, menneskelige voksne dermal fibroblast. Dette tallet er endret fra Nakajima et al. (2018)15. Klikk her for å se en større versjon av dette tallet.

Middels/løsning Reagant Konsentrasjon
CDM basale medium Iscoves endret Dulbecco's medium/radioamatører F12 1:1
Penicillin/Streptomycin 0,5%
Kjemisk definert lipid konsentrat 1%
Apo-transferrin 15 mg/mL
Monothioglycerol 450 mM
Storfe serum albumin 5 mg/mL
Insulin 7 mg/mL
CTK løsning Vann -
Trypsin 0.25%
Collagenase IV 0,1 mg/mL
Veisalt 1 mM
Knockout SR 20%
D induksjon medium CDM basale medium -
CHIR99021 5 ΜM
BMP4 10 ng/mL
DM induksjon medium CDM basale medium -
CHIR99021 5 ΜM
BMP4 10 ng/mL
ECM løsning Kunstig ekstracellulær matrix 0,3 mg/mL
DMEM/F12 -
FACS buffer PBS -
Storfe serum albumin 0,1%
Mater-fri celle kultur medium mTeSR1 -
Penicillin/Streptomycin 0,5%
HDF kultur medium DMEM -
Fosterets bovin serum 10%
hESC medium Primas ES celle medium -
Penicillin/Streptomycin 0,5%
FGF2 4 ng/mL
MYO induksjon medium CDM basale medium -
CHIR99021 5 ΜM
PSM induksjon medium CDM basale medium -
SB431542 10 ΜM
CHIR99021 10 ΜM
DMH1 2 ΜM
FGF2 20 ng/mL
SCL induksjon medium CDM basale medium -
SAG 100 nM
LDN193189 0.6 ΜM
SM induksjon medium CDM basale medium -
SB431542 10 ΜM
CHIR99021 5 ΜM
SYN induksjon medium-1 CDM basale medium -
FGF8 20 ng/mL
SYN induksjon medium-2 CDM basale medium -
BMP7 10 ng/mL
TGFΒ3 10 ng/mL

Tabell 1: Medier og løsning oppskrifter.

navn Fremover Omvendt
ACTB CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT
COL1A1 GGACACAGAGGTTTCAGTGGT GCACCATCATTTCCACGAGC
MEOX1 GAGATTGCGGTAAACCTGGA GAACTTGGAGAGGCTGTGGA
MSGN1 GGAGAAGCTCAGGATGAGGA GTCTGTGAGTTCCCCGATGT
PARAXIS TCCTGGAGAGCTGTGAGGAT CACACCCTGTCACCAACAGT
PAX3 AGGAAGGAGGCAGAGGAAAG CAGCTGTTCTGCTGTGAAGG
SCX CCCAAACAGATCTGCACCTTC GCGAATCGCTGTCTTTCTGTC
TBX6 AGCCTGTGTCTTTCCATCGT AGGCTGTCACGGAGATGAAT
TNMD CCCTTCATGCTGAAGCCACTT CTCACTTTCAGCAGAATTGGGG
WNT3A CAAGATTGGCATCCAGGAGT ATGAGCGTGTCACTGCAAAG

Tabell 2: Primer sekvenser for RT-qPCR analyse.

Konsentrasjon
1
Antistoff
ALX4_Goat 1/50
CDH11_Mouse 1/1000
COL1A1_Rabbit 1/100
COL2A1_Mouse 1-2 μg/mL
EN1_Rabbit 1/50
MEOX1_Rabbit 1/50
MHC_Rabbit 1/200
MKX_Rabbit 1/50
MYOD_Rabbit 1/500
MYOG_Mouse 1/400
NKX3.2_Rabbit 1/50
PARAXIS_Rabbit 1/50
PAX1_Rabbit 1/50
PAX9_Rabbit 1/50
PDGFRa_Goat 1/100
SCX_Rabbit 1/50
TBX6_Goat 1/50
2.
Antistoff
Esel anti geit IgG(H+L) sekundære antibody555 1/500
Esel anti geit IgG(H+L) sekundære antibody647 1/500
Goat anti musen IgG(H+L) sekundære antibody555 1/500
Goat anti kanin IgG(H+L) sekundære antibody555 1/500
Goat anti kanin IgG(H+L) sekundære antibody647 1/500

Tabell 3: Første og andre antistoffer for ICC.

Discussion

En velkjent metode for induksjon av PSC-avledet SM gjennom PSM er kombinasjonen av CHIR99021 + A83-01 (TGFβ hemmer) under PSM induksjon fra PSC, men ikke under PSM modning prosessen6. Studien, var WNT/beta-catenin signalering hemmet bruker C59 for å indusere SM fra PSM. Men introdusert vi bruk av CHIR99021 å aktivere WNT veien under SM differensiering. Denne avgjørelsen ble gjort basert på å finne at flere WNTs er uttrykt i omkringliggende vev av SM og gitt det faktum at WNT journalister er aktive i SM20. Som et resultat observert vi epithelialization, karakteristisk for SM i vivo, bare under forutsetning med CHIR99021, basert på akkumulering av CDH11 i celle-celle veikryss (figur 2E). Denne observasjonen angir kritiske involvering av WNT signalering PSM differensiering og SM epithelialization, derfor våre protokollen kan bedre recapitulate endogene signalnettverk miljøet. Men betyr det også en ytterligere mulighet for finjustering WNT/beta-catenin signalveien under differensiering, fordi robusthet og effektiviteten av differensiering kan variere betydelig avhengig av celletyper, linjer og ulike kjemiske forbindelser av WNT-indusere brukes av hver forsker.

Denne metoden tillater oss også å generere alle fire SM derivater, MYO, D, SCL og SYN, fra menneskelige iPSCs. Våre gradvis protokoller bruker CDM kan brukes til å identifisere signalnettverk kravene under menneskelige somitogenesis/somite mønstre, og gi viktig innsikt i menneskelig SM utvikling. Våre metoder kan for eksempel være nyttig for å studere segmentering klokke mekanismer, en molekylær oscillation system som regulerer dannelsen av SM. Det har blitt grundig undersøkt i mus, damer og sebrafisk, men ikke i mennesker på grunn av manglende nødvendige eksperimentelle verktøy.

Dessuten kan våre metoden være gjelder for fremtidige klinisk cellen-basert behandling. For eksempel menneskelige iPSC-avledet D eller SYN kan være transplantert inn alvorlig skadet huden eller sprukket sener for regenerasjon og behandling. Imidlertid må flere begrensninger løses før dette metoden praktisk talt kan brukes. Selv om studien, vi brukte SNL mater celler for iPSC vedlikehold og ECM løsning, som er utdraget fra Engelbreth-Holm-sverm musen sarkomspesialitet, idet overflaten pels på rett under innledning, bør disse ikke-menneskelige animalske reagenser være fjernet for å forbedre kvaliteten på klinisk. I tillegg må celle kvantitet og kvalitet, som inkluderer renhet og modning av ønsket cellene, også være forbedret. Videre er ikke bare hvor celle, men også cellen styrke et viktig karakteristisk for sene/ligament gjenfødelse. I tillegg utviklingen av overflate markører for rensing og en ny metode for 3D rekonstituering er uunnværlig for å fremme våre protokoller til kliniske cellen-basert behandling.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Vi vil gjerne takke Dr. Junya Toguchida (CiRA) for hans hjelp med prosjektadministrasjon og finansiering oppkjøpet, Mr. Mitsuaki Shibata (CiRA) og Ms. Mei Terashima (CiRA) for deres kundestøtte, Dr. Yayoi Toyooka (CiRA) og Dr. Daisuke Kamiya (CiRA) for deres korrekturlesing av manuskriptet, og Mr. Masaya Todani (CiRA) for å gi en illustrasjon (figur 1). Vi takker også alle medlemmer av Ikeya og Toguchida laboratoriene (CiRA) for deres støtte under denne studien. Dette arbeidet ble støttet av Grants-in-aid for vitenskapelig forskning fra Japan Society for det fremme av vitenskap (JSPER) (26670661), programmet for Intractable sykdommer forskning utnytte sykdom-spesifikke iPS celler fra Japan vitenskap og teknologi Agency (JSO) og Japan Direktoratet for medisinsk forskning og utvikling (AMED), Core senter for forskning iPS Research Center Network for realisering av regenerativ medisin (JST/AMED) og iPS Cell Research Fund (delvis til Makoto Ikeya og Junya Toguchida). Makoto Ikeya ble også støttet av Grants-in-aid for vitenskapelig forskning (JSPER) (16H 05447) og akselerasjon programmet for Intractable sykdommer forskning utnytte sykdom-spesifikke iPS celler (AMED).

Materials

Name Company Catalog Number Comments
ALX4_Goat antibody Santacruz sc-22066
Apo-transferrin Sigma T1147
BMP4 R&D 314-BP-010
BMP7 R&D 354-BP-010
Bovine serum albumin Sigma A8806
Calcium chloride Nacalai tesque 067730-15
CDH11_Mouse antibody Cell signaling 13577
Cell streching device Strex STB-140
Chemically defined lipid concentrate Gibco 11905-031
CHIR99021 Axon 1386
COL1A1_Rabbit antibody Abcam ab34710
COL2A1_Mouse antibody Thermo scientific MS-235
Collagenase IV Thermofisher 17104019
DLL1 APC-conjugated_Mouse antibody R&D FAB1818A For FACS
DMEM Sigma D6046
DMEM/F12 Gibco 11320-082
DMH1 Tocris 4126
EN1_Rabbit antibody Abcam ab70993
Fetal bovine serum Nichirei 171012
FGF2 Wako 060-04543
FGF8 Peprotech 100-25
Human dermal fibroblast Cell applications 160-05a
Human tenocyte Angio proteomie cAP-0041
Insulin Wako 090-06474
Iscove’s modified Dulbecco’s medium/Ham’s F12 Gibco 21056023
Knockout SR Gibco 10828028
LDN193189 Axon 1509
Matrigel BD bioscience 354230 Artificial extracellular matrix
MEOX1_Rabbit antibody Abcam ab75895
MHC_Rabbit antibody Santacruz sc-20641
MKX_Rabbit antibody Atlas antibodies A83377
Monothioglycerol Sigma M6145
mTeSR1 Stemcell tech 85850
Multi well-type silicon rubber chamber Strex STB-CH-4W
MYOD_Rabbit antibody Abcam ab133627
MYOG_Mouse antibody Santacruz sc-12732
NKX3.2_Rabbit antibody Sigma HPA027564
Novex Donkey anti Goat IgG(H+L) secondary antibody555 Invitrogen A21432
Novex Donkey anti Goat IgG(H+L) secondary antibody647 Invitrogen A21447
Novex Goat anti Mouse IgG(H+L) secondary antibody555 Invitrogen A21422
Novex Goat anti Rabbit IgG(H+L) secondary antibody555 Invitrogen A21428
Novex Goat anti Rabbit IgG(H+L) secondary antibody647 Invitrogen A21245
PARAXIS_Rabbit antibody Santacruz sc-98796
PAX1_Rabbit antibody Abcam ab95227
PAX9_Rabbit antibody Gene tex GTX104454
PBS - -
PDGFRa_Goat R&D AF307
Penicillin/Streptomycin Invitrogen 15140-122
Primate ES cell medium Reprocell RCHEMD001
SAG Calbiochem 566661
SB431542 Selleckchem SEL-S1067-10
SCX_Rabbit antibody Abcam ab58655
TBX6_Goat antibody R&D AF4744
Tendon cell growth medium Angio-proteomie cAP-40 Tenocytes growth medium
TGFβ3 R&D 243-B3-200
Trypsin Gibco 15090046

DOWNLOAD MATERIALS LIST

References

  1. Tanaka, A., et al. Efficient and reproducible myogenic differentiation from human iPS cells: prospects for modeling Miyoshi Myopathy in vitro. PLoS One. 8, (4), e61540 (2013).
  2. Sakurai, H., et al. In vitro modeling of paraxial mesodermal progenitors derived from induced pluripotent stem cells. PLoS One. 7, (10), e47078 (2012).
  3. Chal, J., et al. Generation of human muscle fibers and satellite-like cells from human pluripotent stem cells in vitro. Nature Protocl. 11, (10), 1833-1850 (2016).
  4. Chal, J., et al. Differentiation of pluripotent stem cells to muscle fiber to model Duchenne muscular dystrophy. Nature Biotechnology. 33, (9), 962-969 (2015).
  5. Umeda, K., et al. Human chondrogenic paraxial mesoderm, directed specification and prospective isolation from pluripotent stem cells. Scientific Reports. 2, 455 (2012).
  6. Loh, K. M., et al. Mapping the Pairwise Choices Leading from Pluripotency to Human Bone, Heart, and Other Mesoderm Cell Types. Cell. 166, (2), 451-467 (2016).
  7. Xi, H., et al. In Vivo Human Somitogenesis Guides Somite Development from hPSCs. Cell Reports. 18, (6), 1573-1585 (2017).
  8. Chal, J., Pourquie, O. Making muscle: skeletal myogenesis in vivo and in vitro. Development. 144, (12), 2104-2122 (2017).
  9. Tam, P. P., Beddington, R. S. The formation of mesodermal tissues in the mouse embryo during gastrulation and early organogenesis. Development. 99, (1), 109-126 (1987).
  10. Aulehla, A., Pourquie, O. Signaling gradients during paraxial mesoderm development. Cold Spring Harbor Perspectives in Biology. 2, (2), a000869 (2010).
  11. Christ, B., Scaal, M. Formation and differentiation of avian somite derivatives. Advances in Experimental Medicine and Biology. 638, 1-41 (2008).
  12. Brent, A. E., Schweitzer, R., Tabin, C. J. A somitic compartment of tendon progenitors. Cell. 113, (2), 235-248 (2003).
  13. Sakurai, H., et al. Bidirectional induction toward paraxial mesodermal derivatives from mouse ES cells in chemically defined medium. Stem Cell Research. 3, (2-3), 157-169 (2009).
  14. Zhao, J., et al. Small molecule-directed specification of sclerotome-like chondroprogenitors and induction of a somitic chondrogenesis program from embryonic stem cells. Development. 141, (20), 3848-3858 (2014).
  15. Nakajima, T., et al. Modeling human somite development and fibrodysplasia ossificans progressiva with induced pluripotent stem cells. Development. 145, (16), (2018).
  16. McMahon, A. P., Bradley, A. The Wnt-1 (int-1) proto-oncogene is required for development of a large region of the mouse brain. Cell. 62, (6), 1073-1085 (1990).
  17. Takahashi, K., et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell. 131, (5), 861-872 (2007).
  18. Suzuki, H., et al. targeting of the transcription factor Mohawk in rats causes heterotopic ossification of Achilles tendon via failed tenogenesis. Proceedings of the National Academy of Sciences of the United States of America. 113, (28), 7840-7845 (2016).
  19. Marturano, J. E., Arena, J. D., Schiller, Z. A., Georgakoudi, I., Kuo, C. K. Characterization of mechanical and biochemical properties of developing embryonic tendon. Proceedings of the National Academy of Sciences of the United States of America. 110, (16), 6370-6375 (2013).
  20. Maretto, S., et al. Mapping Wnt/beta-catenin signaling during mouse development and in colorectal tumors. Proceedings of the National Academy of Sciences of the United States of America. 100, (6), 3299-3304 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics