In Vitro generatie van Somiet derivaten uit menselijk geïnduceerde pluripotente stamcellen-cellen

Developmental Biology
 

Summary

Wij presenteren hier een protocol voor de differentiatie van menselijke geïnduceerde pluripotente stamcellen in elke Somiet derivaat (myotome, sclerotome, dermatoom en syndetome) in chemisch gedefinieerde voorwaarden, die toepassingen heeft in de toekomst ziekte modellering en cel-gebaseerde therapieën in orthopedische chirurgie.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Nakajima, T., Sakurai, H., Ikeya, M. In Vitro Generation of Somite Derivatives from Human Induced Pluripotent Stem Cells. J. Vis. Exp. (146), e59359, doi:10.3791/59359 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

In reactie op signalen zoals WNTs, bone morfogenetische eiwitten (BMP's) en sonic hedgehog (SHH) uitgescheiden door de omringende weefsels, somieten (SMs) aanleiding geven tot meerdere celtypen, met inbegrip van de myotome (MYO), sclerotome (SCL) dermatoom (D) en syndetome (SYN) , die op zijn beurt uitgroeien tot skeletspieren, axiaal skelet, dorsal dermis en axiale pees/ligament, respectievelijk. Dus, de generatie van SMs en hun derivaten uit menselijk geïnduceerde pluripotente stamcellen (iPSCs) is cruciaal voor het verkrijgen van pluripotente stamcellen (PSC) voor toepassing in de regeneratieve geneeskunde en voor onderzoek van de ziekte op het gebied van orthopedie. Hoewel de inductie protocollen voor MYO en SCL van PSC's zijn eerder gemeld door diverse onderzoekers heeft geen studie nog aangetoond de inductie van SYN en D van iPSCs. Daarom, efficiënte inductie van volledig bevoegde SMs blijft een belangrijke uitdaging. Hier, recapituleren we menselijke SM patronen met menselijke iPSCs in vitro door het nabootsen van de signalering milieu tijdens het kuiken/muis SM ontwikkelen, en verslag over methoden van systematische inductie van SM derivaten (MYO, SCL D en SYN) van menselijke iPSCs onder chemisch via de presomitic mesoderm (PSM) en SM-Staten ervan vastgestelde voorwaarden. Kennis over kuiken/muis SM ontwikkeling werd met succes toegepast op de inductie van SMs met menselijke iPSCs. Deze methode zou een nieuwe tool voor het bestuderen van de menselijke somitogenesis en patronen zonder het gebruik van embryo's voor cel-gebaseerde therapie en modellering van de ziekte.

Introduction

Ontwikkeling van een methode gerichte differentiatie voor een gewenste celtype van PSC is een noodzakelijke stap voor de studie van de PSC-afgeleide cellen omzetten in klinische toepassingen. Gedwongen expressie van genen die sleutel is een veelbelovende strategie voor orgel-celdifferentiatie van PSC's en ons begrip van de genetische regulatie van cel lot bepaling, orgel morfogenese, en organisatie tijdens de embryogenese1is verbeterd. Daarnaast Recapitulerend het endogene signalering omgevingen, met behulp van de ontwikkeling van muis en chick embryo's als een routekaart, wordt als essentieel beschouwd voor de gestuurde differentiatie van de PSC. Echter, gezien de toepassing van PVC-afgeleide cellen in klinische studies zoals cel-gebaseerde therapieën, de laatste strategie is geschikter omdat het vereist geen genetische manipulatie.

Verschillende studies hebben melding gemaakt van de inductie van mesoderm van menselijke en muis PSC's in chemisch welbepaalde voorwaarden. Doorgaans worden deze methoden hebben vertrouwd op activin/knooppunten/transformeren groeifactor β (TGFβ) signalering en bot morfogenetische eiwit (BMP) signalering, geloofde te voeren meso-endoderm en mesoderm differentiatie, wat resulteert in een lage inductie efficiëntie van de Paraxiale mesoderm (ongeveer 20%)2. Met andere woorden, was de PSC-afgeleide mesoderm geïnduceerd door deze signaalroutes voornamelijk laterale plaat mesoderm en niet Paraxiale mesoderm. Onlangs, een paar studies hebben aangetoond dat de efficiënte productie van PSC-afgeleide Paraxiale mesoderm gebaseerd op verschillende strategieën3,4,5,6,7,8 . In deze studies, PSC's werden gekweekt met relatief hoge concentraties van glycogeen synthase kinase 3 (GSK3) remmers (WNT signalering activators), dus de efficiëntie van de inductie van Paraxiale mesoderm bereikte 70%-95%6,7 .

In somitogenesis, de Paraxiale mesoderm eerst vormt de presomitic mesoderm (PSM) posteriorly en vormt dan somieten (SMs) in het voorste deel t/m mesenchym-naar-epitheliale overgang9,10. Inkeping ligand Delta-achtige 1 (DLL1) wordt genoemd dat een centrale rol tijdens somitogenesis, oscillerende controle van DLL1 expressie, zowel in mRNA en eiwit niveau, regelt de segmentering van de SM. SMs uiteindelijk onderverdelen in twee delen, die aanleiding geven tot de dermomyotome (DM) dorsally en sclerotome (SCL) ventrally11. Vervolgens onderscheidt de DM in de dermatoom (D), een voorloper van de dermis, en myotome (MYO), een voorloper van de skeletspieren; Bovendien, vormt een ventrale gedeelte van SCL de syndetome (SYN), een voorloper van pezen en ligamenten12 (Figuur 1). Sommige onderzoekers hebben gemeld de inductie van PSC-afgeleide SM derivaten zoals MYO4,13 en SCL14; Er zijn echter verschillende beperkingen in deze studies. Met name, aangezien onze kennis van de signalering omgevingen van D en SYN fragmentarisch is, hebben inductie protocollen voor D en SYN nog niet systematisch vastgesteld. Om aan te tonen de volledig-bevoegdheid van SMs geïnduceerde van PSC's, is het essentieel om te laten zien van de multi differentiatie capaciteit van geïnduceerde SMs in alle vier derivaten (D, MYO SCL en SYN), terwijl eerdere studies alleen op specifieke SM derivaten gericht hebben. Wij rapporteren hier over hoe te genereren van alle vier SM-derivaten, met inbegrip van D en SYN, via PSM en SM lot van menselijke iPSCs15. Wij zijn van mening dat tot oprichting van een in vitro stapsgewijze methode die modellen het SM-ontwikkelingsproces kan bijdragen tot de studie van hoe menselijke SM tijdens de embryogenese, ontwikkelt zonder het gebruik van embryo's.

Protocol

Alle experimentele protocollen waarbij menselijke iPSCs werden goedgekeurd door de ethische commissie van de afdeling van de geneeskunde en de Graduate School of Medicine, Kyoto University.

1. menselijke iPSCs voorbereiding voor inductie

Opmerking: Cultuur menselijke iPSCs (201B7-PAX3-GFP) op SNL feeder16 cellen met primate ES cel medium aangevuld met 4 ng/mL recombinante menselijke fundamentele fibroblast groeifactor (FGF2) en 0,5% penicilline en streptomycine (hiernaaangeduid als medium van de hESC, zie Tabel 1). Wanneer de verhouding tussen de samenvloeiing bereikt 70%-80%, passage de cellen als eerder beschreven17.

  1. Passaging van menselijke iPSCs op SNL feeder cellen17
    1. Voor passaging, toevoegen van PBS in de cel kweken schotel en spoel cellen. Verwijder vervolgens de PBS (, dit proces zal worden hierna wassen met PBS).
    2. Voeg 1 mL CTK oplossing (Zie tabel 1) bij kamertemperatuur (RT) en wacht totdat de SNL feeder cellen beginnen loskoppelen van de onderkant van de schotel.
    3. De CTK-oplossing verwijderen en daarna wassen met PBS tweemaal.
    4. Voeg vervolgens 1 mL van hESC medium (Zie tabel 1) in de schotel, Schraap dan de cellen met behulp van een schraper en verzamelen in een conische tube van 15 mL.
    5. Pipetteer zachtjes de inhoud vijfmaal met behulp van een 1.000 µL tip, en vervolgens overbrengen naar een nieuwe schotel gevuld met hESC medium. Gebruik een splitsingsverhouding van 1:4 tot en met 1:10, afhankelijk van de verhouding van de samenvloeiing vóór passaging. Ook variëren de hoeveelheid hESC medium afhankelijk van de omvang van de schotel (b.v., 3 mL voor een 6 cm schotel, 8 mL voor een 10 cm schotel).
    6. Incubeer de menselijke iPSCs op 37 ° C en 5% CO2.
    7. Wijzig de middellange dagelijks (behalve de dag na de passaging) en cultuur van de cellen tot de volgende passaging procedure.
  2. Feeder-vrije kweken van menselijke iPSCs vóór PSM inductie
    Opmerking:
    cultuur om te minimaliseren van het effect van groeifactoren uitgescheiden door SNL feeder cellen, de menselijke iPSCs onder feeder-vrij voorwaarden met een feeder-vrije cel kweekmedium (Zie tabel 1) oplossingen van de extracellulaire matrix (ECM) (Zie tabel 1) gecoate schotel voor 3 dagen vóór de PSM inductie.
    1. Dag -4 (4 dagen vóór het opstarten PSM inductie)
      1. Voeg ter voorbereiding van de ECM oplossing beklede schotel, 4 mL ECM-oplossing op een schotel van 10 cm bij 4 ° C's nachts.
        Opmerking: Plaats ECM-oplossing op ijs tijdens de voorbereiding.
    2. Dag -3
      1. Eerst, verwijder de ECM-oplossing uit de schotel en voeg 8 mL feeder-vrije cel kweekmedium.
      2. Om te beginnen feeder-vrije kweken, eens wassen met PBS te spoelen van de gekweekte cellen.
      3. 1 mL van de oplossing van de CTK op RT toevoegen totdat de SNL feeder cellen beginnen loskoppelen van de onderkant van de schotel.
        Opmerking: Gebruik microscopie te bevestigen alle feeder cellen zijn losgekoppeld van de bodem.
      4. De CTK-oplossing verwijderen en wassen met PBS tweemaal, zodat alle SNL feeder cellen volledig worden verwijderd.
      5. Voeg 1 mL feeder-vrije cel kweekmedium in de schotel, dan de cellen met behulp van een schraper Schraap en verzamelen ze in een conische tube van 15 mL.
      6. Zachtjes Pipetteer de inhoud driemaal met een 1.000 µL tip, dan naar een nieuwe ECM oplossing beklede 10 cm schotel (bereid tijdens stap 1.2.1). Gebruik een splitsingsverhouding van ongeveer 1:2 tot en met 1:4, afhankelijk van de verhouding van de samenvloeiing voordat feeder-vrije kweken.
      7. Incubeer de menselijke iPSCs op 37 ° C en 5% CO2 voor 3 dagen, het medium wijzigen op dag -1.

2. PSM differentiatie en isolatie door fluorescentie-activated Cell Sorting (FACS)

  1. PSM differentiatie (0 – dag 4)
    1. Het kweekmedium feeder-vrije cel gecombineerd en 8 mL van PSM inductie medium toe te voegen (CDM Basaal medium aangevuld met 10 µM SB431542, 10 µM CHIR99021, 2 µM DMH1 en 20 ng/mL FGF2, Zie tabel 1).
      Opmerking: Cel samenvloeiing bij de aanvang van de PSM differentiatie is van cruciaal belang voor inductie-efficiëntie. Gebruik microscopie om te bevestigen dat de confluente ratio is ongeveer 30%.
    2. Incubeer bij 37 ° C, met 5% CO2, cellen voor 4 dagen, wijzigen van het medium op dag 3.
    3. Oogst cellen voor FACS op dag 4 (punt 2.2, hieronder).
  2. Isolatie van de DLL1 positief PSM cellen door fluorescentie-activated cell sorting (FACS)
    Opmerking:
    hieronder vindt u een procedure voor de voorbereiding op cel FACS sortering van DLL1 positieve cellen. Uitvoeren FACS sorteren met behulp van een stroom cytometer, volgens de fabrikant protocol.
    1. Het medium gecombineerd, dan wassen met PBS. Daarna, voeg 1 mL cel dissociatie reagens en laat gedurende 3 minuten op RT.
    2. Voeg 4 mL van CDM Basaal medium, de cellen met behulp van een schraper Schraap en verzamelen ze in een conische tube van 15 mL.
    3. Het aantal cellen met behulp van een geautomatiseerde cel counter en centrifugeer bij 280 x g gedurende 3 minuten.
    4. Zorgvuldig de bovendrijvende vloeistof verwijderen door aspiratie en resuspendeer de cellen in FACS buffer (Zie tabel 1) met een concentratie van 1,0 x 107 cellen/mL. Voor een voorbeeld van de negatieve controle (isotype controle, of in Conventie zonder antilichaam), breng 50 µL in een conische buis 15 mL en vervolgens schorten met 450 µL van FACS buffer.
    5. Toevoegen van DLL1 antilichamen (Zie Tabel van materialen) in een verhouding van 1/200. De buis beschermen tegen licht en houd op ijs gedurende 30 minuten.
    6. Centrifuge op 280 x g gedurende 3 minuten.
    7. Zorgvuldig gecombineerd het supernatant en resuspendeer in FACS buffer (1.0 x 107 cellen/mL) met 1 mg/mL DAPI aangevuld.
    8. Overdracht in een collectie buis, opgenomen met een 35 µm nylon gaas in het GLB voor het filteren, plaats dan de buis op ijs totdat sorteren is voltooid. Uitvoeren van dezelfde procedure met het monster van de negatieve controle (stap 2.2.4).
    9. Sorteren met behulp van een stroom cytometer volgens de fabrikant protocol uitvoeren
    10. De gesorteerde DLL1 positieve cellen in een conische tube van 15 mL, met 4 mL van basaal medium CDM aangevuld met 10 µM van Y27632 verzamelen. Voor totale RNA extractie, centrifugeer bij 280 x g gedurende 3 minuten dan resuspendeer in RNA lysis-buffermengsel en bewaren bij-30 ° C. Zie de RNA extractie, omgekeerde transcriptie en RT-qPCR procedures (punt 5.1) voor meer gedetailleerde informatie.
    11. Uitvoeren van SM differentiatie de gesorteerde cuvetten volgens de onderstaande protocol (sectie 3).

3. SM differentiatie van PSM

  1. SM differentiatie van gesorteerde DLL1 positieve PSM cellen (dag 4 – dag 8)
    Opmerking:
    bereiden de ECM oplossing beklede 12-Wells-platen eergisteren FACS sorteren. Te bereiden een ECM oplossing beklede 12-well plaat, voeg 1 mL ECM-oplossing in elk putje bij 4 ° C en laat 's nachts. Houd de ECM-oplossing op ijs tijdens de voorbereiding.
    1. Volgende stap 2.2.10, centrifuge op 280 x g gedurende 3 minuten.
    2. Zorgvuldig gecombineerd het supernatant en resuspendeer in 1 mL van SM inductie medium (CDM Basaal medium aangevuld met 10 µM SB431542 en 5 µM CHIR99021, Zie tabel 1).
    3. Het aantal cellen met behulp van een geautomatiseerde cel counter.
    4. Zaad 1.0 x 105 cellen op elk putje van de ECM oplossing beklede 12-Wells-platen met 1 mL van SM inductie medium aangevuld met 10 µM van Y27632.
    5. Incubeer bij 37 ° C met 5% CO2 voor 4 dagen tot dag 8. Het wijzigen van het medium niet met Y27632 op dag 5 (de dag na het sorteren van FACS) en dag 7.
    6. SM derivaten differentiatie geïnduceerde SM cuvetten volgens de protocollen hieronder uit te voeren. Voor totale RNA extractie van geïnduceerde SM cellen, het verzamelen van de cellen in een conische buis 15 mL en centrifuge op 280 x g gedurende 3 minuten, dan resuspendeer in RNA lysis-buffermengsel en bewaren bij-30 ° C.

4. SM derivaten (DM MYO, D, SCL, SYN) differentiatie van SM

Opmerking: Om aan te tonen van de volledig-bevoegdheid van SM cellen, moet u eerst DM (dermomyotome) en SCL (sclerotome) inductie dienovereenkomstig cuvetten iPSC afkomstige SM uitvoeren. Vervolgens uitvoeren MYO (myotome) en D (dermatoom) inductie cuvetten van de DM, en voeren van de inductie van de SYN (syndetome) met behulp van de SCL-cellen. Hieronder zijn de protocollen voor de inductie van elke derivaat (DM, MYO D, SCL en SYN) uit geïnduceerde SM cellen in vitro.

  1. DM differentiatie van SM cellen (dag 8-daagse 11)
    1. Het medium gecombineerd, dan Voeg 1 mL van DM inductie medium (CDM Basaal medium aangevuld met 5 µM CHIR99021 en 10 ng/mL BMP4, Zie tabel 1).
    2. Incubeer de cellen bij 37 ° C, met 5% CO2, gedurende 3 dagen tot dag 11. Het medium op dag 10 (dag 2 van DM inductie) wijzigen
    3. MYO uitvoeren en gebruik van de differentiatie van de D geïnduceerde DM cellen volgens de protocollen hieronder.
  2. MYO differentiatie van DM cellen (dag 11-daagse 41)
    1. Het medium gecombineerd, dan Voeg 1 mL van MYO inductie medium (CDM Basaal medium aangevuld met 5 µM CHIR99021, Zie tabel 1).
    2. Incubeer de cellen bij 37 ° C, met 5% CO2, gedurende 30 dagen tot 41 van de dag. Wijzig het medium om de 3 dagen.
  3. D differentiatie van DM cellen (dag 11-daagse 20)
    1. Het medium gecombineerd, dan Voeg 1 mL van D inductie medium (CDM Basaal medium aangevuld met 5 µM CHIR99021 en 10 ng/mL BMP4, Zie tabel 1).
    2. Incubeer de cellen bij 37 ° C, met 5% CO2, voor 9 dagen tot dag 20. Wijzig het medium om de 3 dagen.
  4. SCL differentiatie van SM cellen (dag 8-daagse 11)
    1. Het medium gecombineerd, dan Voeg 1 mL van SCL inductie medium (CDM Basaal medium aangevuld met 100 nM SAG en 0,6 µM LDN193189, Zie tabel 1)14.
    2. Incubeer de cellen bij 37 ° C, met 5% CO2, gedurende 3 dagen. Het medium op dag 10 (dag 2 van SCL inductie) wijzigen
    3. SYN differentiatie geïnduceerde SCL cuvetten volgens het protocol hieronder uit te voeren.
  5. SYN differentiatie uit SCL cellen (dag 11-daagse 32)
    Opmerking:
    bereiden de ECM oplossing beklede 24-Wells-platen de dag voordat de SYN inductie. Te bereiden een ECM oplossing beklede 24-well plaat, Voeg 0,5 mL van ECM-oplossing in elk putje bij 4 ° C en laat 's nachts. Houd de ECM-oplossing op ijs tijdens de voorbereiding.
    1. Het medium gecombineerd dan wassen met PBS, dan 0,2 mL van cel dissociatie reagens toevoegen aan elk putje en laat gedurende 3 minuten op RT.
    2. Voeg 0.8 mL van CDM Basaal medium toe aan elk putje dan Schraap en verzamelen van alle cellen in een conische tube van 15 mL.
    3. Centrifuge op 280 x g gedurende 3 minuten.
    4. Zorgvuldig gecombineerd het supernatant en resuspendeer in 1 mL SYN inductie middellange-1 (CDM Basaal medium aangevuld met 20 ng/mL FGF8, Zie tabel 1), dan telt het aantal cellen met behulp van een geautomatiseerde cel counter.
    5. Zaad 5.0 x 104 cellen in elk putje van de ECM oplossing beklede 24-Wells-platen met 1 mL SYN inductie middellange-1.
    6. Incubeer bij 37 ° C, met 5% CO2, gedurende 3 dagen.
    7. Op dag 14 (dag 3 van het SYN-inductie), vervangen door het medium SYN inductie middellange-2 (CDM Basaal medium aangevuld met 10 ng/mL BMP7 en 10 ng/mL TGFβ3, Zie tabel 1).
    8. Incubeer bij 37 ° C, met 5% CO2, voor 18 dagen tot dag 32. Wijzig het medium om de 3 dagen.

5. karakterisering van iPSC-afgeleide producten

Opmerking: Bij de differentiatie, wordt gekenmerkt door menselijke iPSCs derivaten met behulp van kwantitatieve PCR in real time (RT-qPCR), immunocytochemie (ICC), enzyme-linked immunosorbent assays (ELISA) en mechanische stretch stimulatie testen, dienovereenkomstig.

  1. Oogst van de cel, totaal RNA extractie, omgekeerde transcriptie en kwantitatieve real-time PCR (RT-qPCR) analyse
    1. De celsteekproeven (procedures 2.2.10, 3.1.6, 5.4.3) in een tube van 1,5 mL verzamelen en centrifugeer bij 280 x g gedurende 3 minuten.
    2. Verwijder het supernatant en resuspendeer in 350 µL van RNA lysis-buffermengsel, geboden door een passende totaal RNA extractie kit.
    3. Uittreksel totaal RNA met behulp van de kit volgens protocol van de fabrikant.
    4. Omgekeerde transcriberen de geïsoleerde 1 µg totaal RNA aan cDNA, volgens protocol van de fabrikant.
    5. RT-qPCR met behulp van geschikte enzymen, reagentia en inleidingen volgens protocol van de fabrikant uit te voeren. De sequenties van de primer gebruikt in dit onderzoek zijn vermeld in tabel 2.
  2. Immunocytochemie (ICC)
    1. Voorafgaand aan het uitvoeren van immunocytochemie met antilichamen, herstellen van de cellen met de 2% paraformaldehyde bij 4 ° C gedurende 10 minuten, en spoel tweemaal met PBS.
    2. Voor permeabilization, incubeer met 0,2% methanol of 0,2% Polysorbaat 20/PBS (hierna te noemen de PBS-T) bij 4 ° C gedurende 15 minuten.
    3. Verwijder de permeabilization reagentia en behandelen van de cellen met een passende blokkerende buffer of 1% boviene serum albumine/PBS bij 4 ° C gedurende 60 minuten.
    4. Voeg het eerste antilichaam verdund met 10% blokkeerbuffer in PBS-T en plaats op een schudden machine bij 4 ° C's nachts.
    5. Wassen drie keer met PBS-T (PBS-T toevoegen en plaats op de schudden machine op RT gedurende 10 minuten).
    6. Voeg het tweede antilichaam, verdund met 10% blokkeerbuffer in PBS-T en plaats op de schudden machine op RT voor 60 min. De eerste en tweede antilichamen voor ICC gebruikt in dit onderzoek zijn vermeld in tabel 3.
      Opmerking: Vanaf deze stap, de plaat/schotel van licht te beschermen door het te verpakken in folie.
    7. Wassen tweemaal met PBS-T.
    8. Voor de teller kleuring, voegt u 1/5000 DAPI verdund met PBS en plaats op de schudden machine op RT gedurende 5 minuten.
    9. Verwijder de DAPI-oplossing en voeg van PBS in elk putje.
    10. Observeer de cel kleuring met behulp van een fluorescentie Microscoop. U kunt ook slaan de plaat/schotel bij 4 ° C voor maximaal 1 maand.
  3. Enzyme-linked Immunosorbent assay (ELISA) voor functionele analyse van iPSC afkomstige D
    Opmerking:
    menselijke dermale fibroblast cellen (HDF) commercieel beschikbaar zijn. HDF in DMEM aangevuld met 10% foetale runderserum cultuur (Zie tabel 1).
    1. Zaad 1.0 x 105 cellen van iPSC afkomstige D en HDF op 24-Wells-platen met 1 mL van elk kweekmedium (D: D inductie medium, HDF: DMEM aangevuld met 10% foetale runderserum).
    2. Na 3 dagen cel kweken, verzamelen 100 µL van elk medium, plaats in een 1,5 mL-buis en bewaren bij 4 ° C.
    3. Het aantal procedures, zoals de toevoeging van antilichamen detectie en secundaire antilichamen, uitvoeren volgens de instructie van de fabrikant, en kwantificeren van het aantal doelstellingen door het genereren van een standaard curve tegen de concentratie van het besturingselement monsters van de analyt.
  4. Mechanische stretch stimulatie assay voor functionele analyse van iPSC afkomstige SYN
    Opmerking:
    volwassen menselijke tenocytes zijn commercieel verkrijgbaar (Zie Tabel van materialen). Cultuur menselijke iPSC afkomstige SYN en volwassen menselijke tenocytes op een cel stretching apparaat voor de mechanische stretch stimulatie assay zoals beschreven onder18,19. Gebruik SYN inductie middellange-2 en tenocytes groeimedium (Zie Tabel van materialen) als een kweken medium voor elke iPSC afkomstige SYN en volwassen menselijke tenocytes, respectievelijk.
    1. Bij 24 h vóór het uitrekken, plaat 1.0 x 105 cellen van iPSC afkomstige SYN en menselijke tenocytes op ECM oplossing beklede multi goed-type silicon rubber chambers, elk met een oppervlakte van de cultuur van 1.5 x 1.5 cm (Zie Tabel van materialen).
    2. De kamers op het apparaat voor het uitrekken van de cel instellen en dwingen monoaxial cyclische stam (0,5 Hz, 5%) voor 12 h.
    3. Voor totale RNA extractie, Voeg 350 µL van RNA lysis-buffermengsel, dan Schraap en verzamelen van de cellen in een buis 1,5 mL voor totaal RNA extractie en de daaropvolgende analyse van de RT-qPCR (Zie procedure 5.1).

Representative Results

Alle cijfers in dit verslag werden verkregen met 201B7-PAX3-GFP iPSCs, waarin EGFP één allel voor de codering sequence van PAX3 in exon 1 vervangt. Oprichting van 201B7-PAX3-GFP iPSCs elders beschreven (H. Sakurai, persoonlijke mededeling). De statistische significantie werd geëvalueerd aan de hand van statistische software. P-waarden lager dan 0,05 significant werden beschouwd.

Karakterisatie van menselijke iPSC-afgeleide PSM en SM cellen
Om te beoordelen van de differentiatie van menselijke iPSCs naar SM steunmaatregelen de PSM (figuur 2A), FACS analyse, werden ICC, en analyse van de RT-qPCR uitgevoerd. Zoals blijkt uit figuur 2B, waren meer dan 85% van de cellen positief voor DLL1, een marker voor PSM, maar negatief voor PAX3, een marker van SM, na 4 dagen van PSM inductie met menselijke iPSCs. Vervolgens werd deze populatie PAX3 positieve SM cellen na 4 dagen van SM inductie. De PSM-SM overgang werd ook bevestigd door ICC (figuur 2C) en RT-qPCR (figuur 2D). TBX6, MSGN1 en WNT3A, PSM markeringen waren uitgedrukt op de PSM staat (dag 4), maar niet uitgedrukt op de SM staat (dag 8). PARAXIS, MEOX1 en PAX3, SM markeringen, waren uitgedrukt op SM, maar niet uitgedrukt op PSM. Bovendien alleen op de kruising van de cel, na de toevoeging van SB431542 met CHIR99021 kleuring van CDH11, een marker van epithelialized SM, opgebouwd (figuur 2E).

Karakterisering van SM derivaten geïnduceerde van menselijke iPSC-afgeleide cellen van de SM
Om te beoordelen van de potentie van de differentiatie van menselijke iPSC afkomstige SM, differentiatie naar DM, MYO D, SCL en SYN (figuur 3A) werd beoordeeld door ICC analyse en PAX3 (GFP)-fluorescentie. Zoals blijkt uit figuur 3B, DM differentiatie werd bevestigd door ALX4 en EN1 kleuring en PAX3 (GFP)-fluorescentie; MYO differentiatie werd bevestigd door MYOD, MYOG en Myosin zware ketting (MHC) kleuring; D differentiatie werd bevestigd door EN1 en PDGFRa kleuring; SCL differentiatie werd bevestigd door PAX1, PAX9 en NKX3.2 vlekken; en SYN differentiatie wordt bevestigd door SCX, MKX, COL1A1 en COL1A2 vlekken.

Karakterisering van geïnduceerde D en SYN
1. enzyme-linked immunosorbent assay (ELISA) voor functionele analyse van iPSC afkomstige D
In het menselijk lichaam is een van de primaire functies van dermale fibroblasten het afscheiden van extracellulaire matrix (ECM) eiwitten, zoals collageen en hyaluronzuur die de huid hydrateren en helpen met het ondersteunen van de structuur van de huid. Om aan te tonen dat een vergelijkbare hoeveelheid collageen type 1 en hyaluronzuur eiwitten waren uitgescheiden in het kweekmedium van iPSC afkomstige D en HDF, werd ELISA uitgevoerd, zoals wordt weergegeven in figuur 4A.

2. mechanische rekken stimulatie assay voor functionele analyse van iPSC afkomstige SYN
Zoals verscheidene studies hebben reeds gemeld, mechanische stimulatie heeft invloed op de ontwikkeling van de pees vóór en na de geboorte, en bevordert de differentiatie van de tenocytes van18,19van de cellen van de voorloper. Dus, het is algemeen bekend dat reactiviteit op mechanische stress een van de kenmerken van tenocytes is. Om aan te tonen de vergelijkbare reactiviteit van menselijke iPSC afkomstige SYN en menselijke volwassen tenocytes, werd een mechanische stretch stimulatie test uitgevoerd zoals aangegeven in figuur 4B.

Figure 1
Figuur 1: schematische weergave van de hiërarchische differentiatie van Paraxiale mesoderm. Presomitic mesoderm is een celpopulatie die Transient ontstaat tijdens de vroege embryogenese en segmentatie te formulier somieten ondergaat. Somieten zijn een voorbijgaande stamcel bevolking die aanleiding geeft tot meerdere celtypen, zoals sclerotome, dermomyotome, syndetome, dermatoom en myotome cellen, die uiteindelijk in de pees/Ligament, bot-/ kraakbeen, skeletspieren en dermis onderscheiden cellen. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: FACS, RT-qPCR en ICC analyse van menselijke iPSC afkomstige PSM en SM (A) Schematische weergave van een protocol voor SM differentiatie via PSM. (B) vertegenwoordiger dot plot van DLL1 kleuring en PAX3 (GFP)-fluorescentie op dag 4 van PSM inductie en dag 4 (dag 8 vanaf iPSC) van SM inductie. (C) vertegenwoordiger immunocytochemische beelden en PAX3 (GFP)-fluorescentie op dag 4 van PSM inductie en dag 4 (dag 8 vanaf iPSC) van SM inductie. Cellen werden gekleurd met anti-TBX6, PARAXIS en MEOX1 antilichamen (rood) en samen met de DAPI (blauw) gekleurd of gedetecteerd met PAX3 (GFP)-fluorescentie (groen). (D) RT-qPCR analyse van merkers voor PSM en SM op iPSC, PSM en SM. De middelen ± standaardfout (S.E.) uit drie sets van experimenten staan. (E) vertegenwoordiger immunocytochemische beelden op dag 4 (dag 8 vanaf iPSC) voor SM, gekweekt in S10I10 (combinatie van SB431542 en IWR1, een inhibitor van de omwenteling van de WNT signalering), S10 (SB431542), en S10C5 (combinatie van SB431542 en CHIR99021) voorwaarden. Cellen werden gekleurd met anti-CDH11 antistof (rood) en mede gekleurd met DAPI (blauw). iPS, geïnduceerde pluripotente stamcellen; PSM, presomitic mesoderm; SM, Somiet; S10, SB431542 10 ΜM; C5, CHIR99021 5 ΜM; I10, IWR1 10 ΜM; Schaal bars = 50 μm. Dit cijfer is gewijzigd van Nakajima et al. (2018)15. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3: ICC analyse van DM, MYO D, SCL en SYN onderscheiden van menselijke iPSC afkomstige SM (A) Schematische weergave van protocollen voor SM derivaten differentiatie. (B) vertegenwoordiger immunocytochemische beelden en PAX3 (GFP)-fluorescentie op dag 3 (dag 11 vanaf iPSC) van DM inductie, dag 30 (dag 41 vanaf iPSC) van MYO inductie, dag 9 (dag 20 van iPSC) van D inductie, dag 3 (dag 11 vanaf iPSC) van SCL inductie en dag 21 (dag 32 van iPSC) van SYN-inductie. DM, cellen werden gekleurd met anti-ALX4 en EN1 antilichamen (rood) en samen met de DAPI (blauw) gekleurd of gedetecteerd met PAX3 (GFP)-fluorescentie (groen); MYO, cellen werden gekleurd met anti-MYOD, MYOG (rood) en MHC (cyaan) antilichamen, ook mede gekleurd met DAPI (blauw); D, cellen werden gekleurd met anti-EN1 (rood) en PDGFRa (cyaan) antilichamen en co gekleurd met DAPI (blauw); SCL, cellen werden gekleurd met anti-PAX1, PAX9 en NKX3.2 (rood) antilichamen, en mede gekleurd met DAPI (blauw); SYN, cellen werden gekleurd met anti-SCX, MKX, COL1A1 en COL1A2 (rood) antilichamen, en mede gekleurd met DAPI (blauw). DM, dermomyotome; MYO, myotome; D, dermatoom; SCL, sclerotome; SYN, syndetome; Schaal bars = 50 μm. Dit cijfer is gewijzigd van Nakajima et al. (2018)15. Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4: functionele test van geïnduceerde D en SYN. (A) het bedrag van collageen type 1 en hyaluronic acid eiwitten in het kweekmedium werden geanalyseerd door ELISA. (B) het effect van mechanische stretch stimulatie op geïnduceerde SYN en menselijke volwassen tenocytes werd beoordeeld door RT-qPCR. De middelen ± standaardfout (S.E.) uit drie sets van experimenten staan. * p < 0.05; ** p < 0,01; p < 0.001 door Dunnett van meerdere vergelijkingen t-test t.o.v. Stretch (-); n.s, niet significant, HDF, menselijke volwassen dermale fibroblast. Dit cijfer is gewijzigd van Nakajima et al. (2018)15. Klik hier voor een grotere versie van dit cijfer.

Medium/oplossing Reagant Concentratie
CDM Basaal medium Iscove van bewerkt Dulbecco van middellange/Ham F12 1:1
Penicilline/streptomycine 0,5%
Chemisch welbepaald lipide concentraat 1%
APO-transferrine 15 mg/mL
Monothioglycerol 450 mM
Bovien serumalbumine 5 mg/mL
Insuline 7 mg/mL
CTK-oplossing Water -
Trypsine 0,25%
Collagenase IV 0,1 mg/mL
Calciumchloride 1 mM
Knock-out SR 20%
D inductie medium CDM Basaal medium -
CHIR99021 5 ΜM
BMP4 10 ng/mL
DM inductie medium CDM Basaal medium -
CHIR99021 5 ΜM
BMP4 10 ng/mL
ECM-oplossing Kunstmatige extracellulaire matrix 0,3 mg/mL
DMEM/F12 -
FACS buffer PBS -
Bovien serumalbumine 0,1%
Feeder-vrije cel kweekmedium mTeSR1 -
Penicilline/streptomycine 0,5%
HDF kweekmedium DMEM -
Foetale runderserum 10%
hESC medium Primate ES cel medium -
Penicilline/streptomycine 0,5%
FGF2 4 ng/mL
MYO inductie medium CDM Basaal medium -
CHIR99021 5 ΜM
PSM inductie medium CDM Basaal medium -
SB431542 10 ΜM
CHIR99021 10 ΜM
DMH1 2 ΜM
FGF2 20 ng/mL
SCL inductie medium CDM Basaal medium -
SAG 100 nM
LDN193189 0,6 ΜM
SM inductie medium CDM Basaal medium -
SB431542 10 ΜM
CHIR99021 5 ΜM
SYN inductie middellange-1 CDM Basaal medium -
FGF8 20 ng/mL
SYN inductie middellange-2 CDM Basaal medium -
BMP7 10 ng/mL
TGFΒ3 10 ng/mL

Tabel 1: Media en oplossing recepten.

NAAM Voorwaarts Omgekeerde
ACTB CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT
COL1A1 GGACACAGAGGTTTCAGTGGT GCACCATCATTTCCACGAGC
MEOX1 GAGATTGCGGTAAACCTGGA GAACTTGGAGAGGCTGTGGA
MSGN1 GGAGAAGCTCAGGATGAGGA GTCTGTGAGTTCCCCGATGT
PARAXIS TCCTGGAGAGCTGTGAGGAT CACACCCTGTCACCAACAGT
PAX3 AGGAAGGAGGCAGAGGAAAG CAGCTGTTCTGCTGTGAAGG
SCX CCCAAACAGATCTGCACCTTC GCGAATCGCTGTCTTTCTGTC
TBX6 AGCCTGTGTCTTTCCATCGT AGGCTGTCACGGAGATGAAT
TNMD CCCTTCATGCTGAAGCCACTT CTCACTTTCAGCAGAATTGGGG
WNT3A CAAGATTGGCATCCAGGAGT ATGAGCGTGTCACTGCAAAG

Tabel 2: Primer reeksen voor RT-qPCR analyse.

Concentratie
1e
Antilichaam
ALX4_Goat 1/50
CDH11_Mouse 1/1000
COL1A1_Rabbit 1/100
COL2A1_Mouse 1-2 μg/mL
EN1_Rabbit 1/50
MEOX1_Rabbit 1/50
MHC_Rabbit 1/200
MKX_Rabbit 1/50
MYOD_Rabbit 1/500
MYOG_Mouse 1/400
NKX3.2_Rabbit 1/50
PARAXIS_Rabbit 1/50
PAX1_Rabbit 1/50
PAX9_Rabbit 1/50
PDGFRa_Goat 1/100
SCX_Rabbit 1/50
TBX6_Goat 1/50
2e
Antilichaam
Ezel anti geit IgG(H+L) secundaire antibody555 1/500
Ezel anti geit IgG(H+L) secundaire antibody647 1/500
Geit anti muis IgG(H+L) secundaire antibody555 1/500
Geit anti konijn IgG(H+L) secundaire antibody555 1/500
Geit anti konijn IgG(H+L) secundaire antibody647 1/500

Tabel 3: Eerste en tweede antilichamen voor ICC.

Discussion

Een bekende methode voor de inductie van PSC-afgeleide SM via PSM is de combinatie van CHIR99021 + A83-01 (TGFβ remmer) tijdens PSM inductie van PVC, maar niet tijdens de PSM rijping proces6. In de huidige studie, was WNT/bèta-catenine signalering geremd met behulp van C59 voor het opwekken van de SM uit PSM. Echter introduceerde we het gebruik van CHIR99021 om te activeren van de Wnt tijdens SM differentiatie. Dit besluit werd gemaakt gebaseerd op de bevinding dat verscheidene WNTs worden uitgedrukt in de omliggende weefsels van SM en het feit gezien dat de WNT verslaggevers actief in de SM20 zijn. Daardoor zien we epithelialization, een kenmerk van SM in vivo, alleen onder de voorwaarde met CHIR99021, gebaseerd op de accumulatie van CDH11 in cel kruispunten (figuur 2E). Deze constatering geeft aan de kritische betrokkenheid van WNT signalering tijdens PSM differentiatie en de SM epithelialization, daarom dat ons protocol kan beter het endogene signalering milieu recapituleren. Echter, het impliceert ook een verdere mogelijkheid van "fine-tuning"-de WNT/bèta-catenine signalering traject tijdens de differentiatie, omdat de robuustheid en de efficiëntie van differentiatie aanzienlijk afhankelijk van de celtypes, cellijnen en diverse variëren kunnen chemische verbindingen van WNT-inductoren gebruikt door elke onderzoeker.

Deze methode ook stelt ons in staat om te genereren van alle vier SM derivaten, MYO D, SCL en SYN, uit menselijke iPSCs. Onze stapsgewijze protocollen met behulp van CDM kunnen worden gebruikt voor het identificeren van de signalering eisen tijdens menselijke somitogenesis/Somiet patronen, en belangrijk inzicht verwerven in de ontwikkeling van menselijk SM. Bijvoorbeeld, kunnen onze methoden nuttig voor het bestuderen van de segmentatie klok mechanismen, een moleculaire oscillatie systeem dat de vorming van SM regelt zijn. Het is grondig onderzocht in muizen, kuikens en zebrafish, maar niet bij de mens als gevolg van het gebrek aan adequate experimentele instrumenten.

Bovendien kunnen onze methode die van toepassing zijn om toekomstige klinische cel-gebaseerde therapieën. Bijvoorbeeld menselijke iPSC afkomstige D SYN in ernstig gewonde huid kan worden getransplanteerd of gescheurde pezen voor regeneratie en behandeling. Echter verschillende beperkingen moeten worden opgelost alvorens deze methode praktisch kan worden toegepast. Hoewel in de huidige studie, gebruikten we SNL feeder cellen voor iPSC onderhoud en ECM-oplossing, die wordt gewonnen uit de Engelbreth-Holm-Swarm muis Sarcoom, als een oppervlak vacht op de schotel tijdens inductie, moeten deze niet-menselijke dieren afkomstige reagentia zijn verwijderd om klinische kwaliteit te verbeteren. Daarnaast moeten cel kwantiteit en kwaliteit, waaronder de zuiverheid en de rijping van de gewenste cellen, ook worden verbeterd. Bovendien, niet alleen het nummer van de cel, maar ook de sterkte van de cel is een belangrijk kenmerk voor regeneratie van de pees/ligament. Daarnaast is de ontwikkeling van oppervlakte markers voor reiniging en een nieuwe methode voor 3D reconstructie zijn onontbeerlijk om onze protocollen vooraf aan klinische cel-gebaseerde therapieën.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Wij willen bedanken, Dr. Junya Toguchida (CiRA) voor zijn hulp met de projectadministratie en financiering van de overname, Mr. Mitsuaki Shibata (CiRA) en Ms. Mei Terashima (CiRA) voor hun technische bijstand, Dr. Yayoi Toyooka (CiRA) en Dr. Daisuke Kamiya (CiRA) hun proeflezen van het manuscript en Mr. Masaya Todani (CiRA) voor het verstrekken van een illustratie (Figuur 1). Wij danken alle leden van de Ikeya en Toguchida labo (CiRA) voor hun steun tijdens deze studie. Dit werk werd gesteund door de Grants-in-aid voor wetenschappelijkonderzoek van de Society van Japan voor de promotie van wetenschap (JSPS) (26670661), het programma voor hardnekkige ziekten onderzoek met behulp van ziekte-specifieke iPS cellen uit het Japan wetenschap en technologie Agentschap (BJS) en het Japan Agency voor medisch onderzoek en ontwikkeling (AMED), het Core Center for iPS celonderzoek van het onderzoeksnetwerk centrum voor de realisatie van regeneratieve geneeskunde (JST/AMED), en het iPS-cel onderzoeksfonds (voor een deel aan Makoto Ikeya en Junya Toguchida). Makoto Ikeya werd ook ondersteund door Grants-in-aid voor wetenschappelijk onderzoek (JSPS) (16H 05447) en het programma van de versnelling voor hardnekkige onderzoek van ziekten met behulp van ziekte-specifieke iPS cellen (AMED).

Materials

Name Company Catalog Number Comments
ALX4_Goat antibody Santacruz sc-22066
Apo-transferrin Sigma T1147
BMP4 R&D 314-BP-010
BMP7 R&D 354-BP-010
Bovine serum albumin Sigma A8806
Calcium chloride Nacalai tesque 067730-15
CDH11_Mouse antibody Cell signaling 13577
Cell streching device Strex STB-140
Chemically defined lipid concentrate Gibco 11905-031
CHIR99021 Axon 1386
COL1A1_Rabbit antibody Abcam ab34710
COL2A1_Mouse antibody Thermo scientific MS-235
Collagenase IV Thermofisher 17104019
DLL1 APC-conjugated_Mouse antibody R&D FAB1818A For FACS
DMEM Sigma D6046
DMEM/F12 Gibco 11320-082
DMH1 Tocris 4126
EN1_Rabbit antibody Abcam ab70993
Fetal bovine serum Nichirei 171012
FGF2 Wako 060-04543
FGF8 Peprotech 100-25
Human dermal fibroblast Cell applications 160-05a
Human tenocyte Angio proteomie cAP-0041
Insulin Wako 090-06474
Iscove’s modified Dulbecco’s medium/Ham’s F12 Gibco 21056023
Knockout SR Gibco 10828028
LDN193189 Axon 1509
Matrigel BD bioscience 354230 Artificial extracellular matrix
MEOX1_Rabbit antibody Abcam ab75895
MHC_Rabbit antibody Santacruz sc-20641
MKX_Rabbit antibody Atlas antibodies A83377
Monothioglycerol Sigma M6145
mTeSR1 Stemcell tech 85850
Multi well-type silicon rubber chamber Strex STB-CH-4W
MYOD_Rabbit antibody Abcam ab133627
MYOG_Mouse antibody Santacruz sc-12732
NKX3.2_Rabbit antibody Sigma HPA027564
Novex Donkey anti Goat IgG(H+L) secondary antibody555 Invitrogen A21432
Novex Donkey anti Goat IgG(H+L) secondary antibody647 Invitrogen A21447
Novex Goat anti Mouse IgG(H+L) secondary antibody555 Invitrogen A21422
Novex Goat anti Rabbit IgG(H+L) secondary antibody555 Invitrogen A21428
Novex Goat anti Rabbit IgG(H+L) secondary antibody647 Invitrogen A21245
PARAXIS_Rabbit antibody Santacruz sc-98796
PAX1_Rabbit antibody Abcam ab95227
PAX9_Rabbit antibody Gene tex GTX104454
PBS - -
PDGFRa_Goat R&D AF307
Penicillin/Streptomycin Invitrogen 15140-122
Primate ES cell medium Reprocell RCHEMD001
SAG Calbiochem 566661
SB431542 Selleckchem SEL-S1067-10
SCX_Rabbit antibody Abcam ab58655
TBX6_Goat antibody R&D AF4744
Tendon cell growth medium Angio-proteomie cAP-40 Tenocytes growth medium
TGFβ3 R&D 243-B3-200
Trypsin Gibco 15090046

DOWNLOAD MATERIALS LIST

References

  1. Tanaka, A., et al. Efficient and reproducible myogenic differentiation from human iPS cells: prospects for modeling Miyoshi Myopathy in vitro. PLoS One. 8, (4), e61540 (2013).
  2. Sakurai, H., et al. In vitro modeling of paraxial mesodermal progenitors derived from induced pluripotent stem cells. PLoS One. 7, (10), e47078 (2012).
  3. Chal, J., et al. Generation of human muscle fibers and satellite-like cells from human pluripotent stem cells in vitro. Nature Protocl. 11, (10), 1833-1850 (2016).
  4. Chal, J., et al. Differentiation of pluripotent stem cells to muscle fiber to model Duchenne muscular dystrophy. Nature Biotechnology. 33, (9), 962-969 (2015).
  5. Umeda, K., et al. Human chondrogenic paraxial mesoderm, directed specification and prospective isolation from pluripotent stem cells. Scientific Reports. 2, 455 (2012).
  6. Loh, K. M., et al. Mapping the Pairwise Choices Leading from Pluripotency to Human Bone, Heart, and Other Mesoderm Cell Types. Cell. 166, (2), 451-467 (2016).
  7. Xi, H., et al. In Vivo Human Somitogenesis Guides Somite Development from hPSCs. Cell Reports. 18, (6), 1573-1585 (2017).
  8. Chal, J., Pourquie, O. Making muscle: skeletal myogenesis in vivo and in vitro. Development. 144, (12), 2104-2122 (2017).
  9. Tam, P. P., Beddington, R. S. The formation of mesodermal tissues in the mouse embryo during gastrulation and early organogenesis. Development. 99, (1), 109-126 (1987).
  10. Aulehla, A., Pourquie, O. Signaling gradients during paraxial mesoderm development. Cold Spring Harbor Perspectives in Biology. 2, (2), a000869 (2010).
  11. Christ, B., Scaal, M. Formation and differentiation of avian somite derivatives. Advances in Experimental Medicine and Biology. 638, 1-41 (2008).
  12. Brent, A. E., Schweitzer, R., Tabin, C. J. A somitic compartment of tendon progenitors. Cell. 113, (2), 235-248 (2003).
  13. Sakurai, H., et al. Bidirectional induction toward paraxial mesodermal derivatives from mouse ES cells in chemically defined medium. Stem Cell Research. 3, (2-3), 157-169 (2009).
  14. Zhao, J., et al. Small molecule-directed specification of sclerotome-like chondroprogenitors and induction of a somitic chondrogenesis program from embryonic stem cells. Development. 141, (20), 3848-3858 (2014).
  15. Nakajima, T., et al. Modeling human somite development and fibrodysplasia ossificans progressiva with induced pluripotent stem cells. Development. 145, (16), (2018).
  16. McMahon, A. P., Bradley, A. The Wnt-1 (int-1) proto-oncogene is required for development of a large region of the mouse brain. Cell. 62, (6), 1073-1085 (1990).
  17. Takahashi, K., et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell. 131, (5), 861-872 (2007).
  18. Suzuki, H., et al. targeting of the transcription factor Mohawk in rats causes heterotopic ossification of Achilles tendon via failed tenogenesis. Proceedings of the National Academy of Sciences of the United States of America. 113, (28), 7840-7845 (2016).
  19. Marturano, J. E., Arena, J. D., Schiller, Z. A., Georgakoudi, I., Kuo, C. K. Characterization of mechanical and biochemical properties of developing embryonic tendon. Proceedings of the National Academy of Sciences of the United States of America. 110, (16), 6370-6375 (2013).
  20. Maretto, S., et al. Mapping Wnt/beta-catenin signaling during mouse development and in colorectal tumors. Proceedings of the National Academy of Sciences of the United States of America. 100, (6), 3299-3304 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics