Hox Loci केंद्रित CRISPR/sgRNA पुस्तकालय स्क्रीनिंग महत्वपूर्ण CTCF सीमाओं की पहचान

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

प्रोटीन कोडिंग जीन से पूछताछ करने के लिए एक CRISPR/sgRNA पुस्तकालय लागू किया गया है । तथापि, जीन विनियमन में सीटीसीएफ सीमा के कार्य को उजागर करने के लिए एक sgRNA पुस्तकालय की व्यवहार्यता बेरोज़गारी बनी हुई है । यहां, हम hox loci में CTCF सीमाओं के समारोह को स्पष्ट करने के लिए एक hox Loci विशिष्ट sgrna पुस्तकालय का वर्णन ।

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Luo, H., Sobh, A., Vulpe, C. D., Brewer, E., Dovat, S., Qiu, Y., Huang, S. HOX Loci Focused CRISPR/sgRNA Library Screening Identifying Critical CTCF Boundaries. J. Vis. Exp. (145), e59382, doi:10.3791/59382 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

ccctc-बाध्यकारी कारक (ctcf)-मध्यस्थता स्थिर सांस्थितिकत: जोड़ डोमेन (tads) पड़ोसी tads में स्थित डीएनए तत्वों की बातचीत को विवश करने में एक महत्वपूर्ण भूमिका निभाते हैं । CTCF होक्स जीन के स्थानिक और लौकिक अभिव्यक्ति को विनियमित करने में एक महत्वपूर्ण भूमिका निभाता है जो भ्रूण के विकास, शरीर की पैटेनिंग, हेमेटोपॉइसिस और ल्यूकीजेनेसिस को नियंत्रित करता है । हालांकि, यह काफी हद तक अज्ञात है कि क्या और कैसे hox loci जुड़े ctcf सीमाएं क्रोमेटिन संगठन और hox जीन अभिव्यक्ति को विनियमित । वर्तमान प्रोटोकॉल में, एक विशिष्ट sgrna परित पुस्तकालय hoxa/B/C/डी loci में सभी ctcf बाइंडिंग साइटों को लक्षित करने के लिए उत्पंन किया गया है के प्रभाव की जांच करने के लिए ctcf-संबद्ध क्रोमेटिन सीमाओं पर बालक के गठन और hoxa जीन अभिव्यक्ति. CRISPR-Cas9 जेनेटिक स्क्रीनिंग के माध्यम से, HOXA7/HOXA9 जीन (CBS7/9) के बीच स्थित ctcf बाइंडिंग साइट को ऑन्कोजेनिक क्रोमेटिन डोमेन के एक महत्वपूर्ण नियामक के रूप में पहचाना गया है, साथ ही यह एटॉपिक होक्स जीन को बनाए रखने के लिए महत्वपूर्ण है । MLL में अभिव्यक्ति पैटर्न-एक्यूट माइलॉयड ल्यूकेमिया (एएमएल) rearranged । इस प्रकार, इस sgRNA पुस्तकालय स्क्रीनिंग दृष्टिकोण विशिष्ट जीन loci में CTCF मध्यस्थता जीनोम संगठन में उपंयास अंतर्दृष्टि प्रदान करता है और यह भी एनोटेटेड आनुवंशिक नियामक तत्वों के कार्यात्मक लक्षण वर्णन के लिए एक आधार प्रदान करता है, दोनों कोडिंग और गैर कोडिंग, मानव जीनोम परियोजना के बाद के दौर में सामान्य जैविक प्रक्रियाओं के दौरान ।

Introduction

हाल ही में जीनोम इंटरेक्शन अध्ययनों से पता चला है कि मानव परमाणु जीनोम स्थिर सांस्थितिकत: डोमेन (tads) है कि सेल प्रकार और प्रजातियों के पार संरक्षित कर रहे है जोड़ रूपों । अलग डोमेन में जीनोम के संगठन की सुविधा और नियामक तत्वों (जैसे, enhancers और प्रमोटरों) के बीच बातचीत को प्रतिबंधित । CCCTC-बाध्यकारी कारक (CTCF) बालक सीमाओं को बांधता है और डीएनए तत्वों है कि पड़ोसी TADs1में स्थित है की बातचीत को विवश में एक महत्वपूर्ण भूमिका निभाता है । हालांकि, जीनोम वाइड CTCF बाइंडिंग डेटा से पता चला है कि यद्यपि CTCF अधिकांशतः विभिन्न प्रकार के सेल प्रकारों में समान डीएनए-साइट्स के साथ इंटरैक्ट करता है, लेकिन यह प्रायः एक कक्ष प्रकार में किसी विशिष्ट साइट पर क्रोमेटिन अवरोध के रूप में कार्य करता है, लेकिन दूसरे में नहीं, यह सुझाता है कि CTCF फ़ंक्शंस एक साथ क्रोमेटिन सीमाओं के गठन में अन्य गतिविधियों के साथ2. क्या अज्ञात रहता है कि क्या सीमा तत्वों (CTCF-बाइंडिंग साइटें) सीधे CTCF के जैविक कार्य से जुड़े होते हैं, और ये लिंक्स कैसे होती हैं । इसलिए, हम परिकल्पना करते है कि विशिष्ट CTCF जेनोम में बाध्यकारी साइटों सीधे TADs के गठन को विनियमित करने और इन डोमेन के भीतर या पड़ोसी डोमेन के बीच नियंत्रण प्रवर्तक/ मानव और माउस जीनोम अनुक्रमण परियोजनाओं के पूरा होने और बाद में एपिजेनेटिक विश्लेषण जीनोम के नए आणविक और आनुवंशिक हस्ताक्षर का पर्दाफाश किया है । तथापि, जीन विनियमन और सेल्युलर कार्य के साथ-साथ उनके आणविक तंत्र (नों) में विशिष्ट हस्ताक्षरों/संशोधनों की भूमिका को अभी पूरी तरह से समळाा जाना है ।

सबूत समर्थन की एकाधिक पंक्तियां कि ctcf-mediated tads कार्यात्मक क्रोमेटिन डोमेन3,4,5का प्रतिनिधित्व करते हैं । हालांकि ctcf ज्यादातर विभिंन प्रकार के सेल में एक ही डीएनए-साइटों के साथ बातचीत, जीनोम वाइड ctcf चिप seq डेटा से पता चला है कि ctcf अक्सर एक कोशिका प्रकार में एक क्रोमेटिन बाधा के रूप में काम करता है, लेकिन अंय2में नहीं । ctcf जीनोम संगठन4,6,7का मध्यस्थता करके विकास के दौरान एक आवश्यक भूमिका निभाता है । सीटीसीएफ की सीमाओं में व्यवधान/प्रमोटर इंटरैक्शन और जीन एक्सप्रेशन, जिससे विकासात्मक रुकावट उत्पन्न होती है । यह पता चलता है कि ctcf मध्यस्थता tads न केवल संरचनात्मक घटक हैं, लेकिन यह भी नियामक इकाइयों उचित बढ़ाने कार्रवाई और जीन ट्रांसक्रिप्शन के लिए आवश्यक5,8,9.

hox जीन भ्रूण के विकास के दौरान महत्वपूर्ण भूमिका निभाते है और वे अस्थाई रूप से और स्थानिक अपनी अभिव्यक्ति पैटर्न में प्रतिबंधित कर रहे हैं । होक्सा लोकस, दोनों हेस्क्स और IMR90 कक्ष1में एक ctcf-संबद्ध सीमा तत्व द्वारा पूर्वकाल और पश्च जीन को अलग करने वाले दो स्थिर tads बनाता है । हाल की रिपोर्टों का प्रदर्शन किया है कि Hoxblinc, एक hoxb लोकस संबद्ध lncRNA, ctcf के गठन का निर्देश tads और enhancer/ यह ईएससी प्रतिबद्धता और भेदभाव10के दौरान पूर्वकाल hoxb जीन सक्रियण की ओर जाता है । इसके अलावा, विशिष्ट जीन loci में Hoxa लोकस सहित, CTCF मध्यस्थता बालक डोमेन के परिवर्तन वंश विशिष्ट जीन अभिव्यक्ति प्रोफाइल बदल गया और रोग राज्यों के विकास के साथ जुड़ा हुआ था11,12. सबूत जीन प्रतिलेखन समंवय में ctcf के लिए एक प्राथमिक समारोह का समर्थन करता है और कार्यात्मक डोमेन में जीनोम आयोजन द्वारा सेल पहचान का निर्धारण ।

भ्रूणीय विकास में अपनी भूमिका के बावजूद, हेमेटोपॉयसिस के दौरान, Hox जीन hematopoiesis स्टेम और संतति कोशिका (एच एस/पीसी) समारोह को विनियमित । यह प्रसार और भेदभाव10,13,14,15के बीच संतुलन को नियंत्रित करने के द्वारा किया जाता है । होक्स जीन की अभिव्यक्ति, एच एस/पीसीएस में उच्चतम अभिव्यक्ति के साथ, हेमटोपोयटिक कोशिकाओं के विशिष्टीकरण और विभेद के दौरान कसकर विनियमित होती है । होक्स जीन अभिव्यक्ति धीरे परिपक्वता के दौरान कम हो जाती है, अपने निंनतम स्तर के साथ विभेदक टेम कोशिकाओं में होने वाली16. hox जीन dysregulation, ल्यूसेमिक परिवर्तन17,18करने के लिए अग्रणी एच एस के-नवीकरण और भेदभाव गुणों के द्वारा ल्यूलेमिक परिवर्तन का एक प्रमुख तंत्र है । हालांकि, स्थापित करने और hox जीन के अर्बुदीय अभिव्यक्ति पैटर्न बनाम के रूप में अच्छी तरह से जुड़े नियामक नेटवर्क की स्थापना और बनाए रखने की व्यवस्था अस्पष्ट बनी हुई है ।

CRISPR-Cas9 sgRNA पुस्तकालय स्क्रीनिंग व्यापक रूप से प्रोटीन-कोडिंग जीन19 के रूप में अच्छी तरह से गैर कोडिंग जीन, जैसे lncrna20 और मिरना21 के रूप में विभिंन प्रजातियों में पूछताछ करने के लिए इस्तेमाल किया गया है । हालांकि, लागत CRISPR-Cas9 sgRNA पुस्तकालय का उपयोग करने के लिए नए जीनोमिक लक्ष्यों की पहचान उच्च रहता है, क्योंकि उच्च थ्रॉपुट जीनोम अनुक्रमण अक्सर sgRNA पुस्तकालय स्क्रीनिंग सत्यापित करने के लिए लागू किया जाता है । हमारी sgRNA स्क्रीनिंग प्रणाली विशिष्ट जीनोम loci पर ध्यान केंद्रित है और एक कदम आर टी के माध्यम से लक्ष्यीकरण Sgrna, मार्कर जीन अभिव्यक्ति के अनुसार पीसीआर, HOXA9जैसे मूल्यांकन करता है । इसके अतिरिक्त, Sanger अनुक्रमण पुष्टि की है कि sgRNA जीनोम में एकीकृत किया गया था, और Indel म्यूटेशन sgRNA लक्ष्यीकरण साइट की पहचान करने के लिए पता लगाया जा सकता है । loci-विशिष्ट crispr-Cas9 आनुवंशिक स्क्रीनिंग के माध्यम से, CBS7/9 क्रोमेटिन सीमा अर्बुदीय क्रोमेटिन डोमेन की स्थापना और एएमएल रोगजनन में अस्थानिक hox जीन अभिव्यक्ति पैटर्न को बनाए रखने के लिए एक महत्वपूर्ण नियामक के रूप में पहचान की गई है 12. विधि व्यापक रूप से भ्रूण के विकास में सीटीसीएफ सीमा के न केवल विशिष्ट समारोह की पहचान करने के लिए लागू किया जा सकता है, hematopoiesis, ल्यूकेजेनेसिस, लेकिन यह भी भविष्य की पश् चजात चिकित्सा के लिए संभावित चिकित्सकीय लक्ष्य के रूप में ctcf सीमा.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. सीटीसीएफ एक ऑनलाइन उपकरण का उपयोग कर sgRNALibrary डिजाइन

  1. मानव Hox loci में आनुवंशिक क्षोभ मंच (gpp) डिजाइनर उपकरण (https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design) का उपयोग कर sgRNA लक्ष्यीकरण ctcf बाध्यकारी साइटों को डिजाइन ।
  2. कुल १,०७० sgRNAs के साथ sgRNAs लक्ष्यीकरण ३०३ यादृच्छिक लक्ष्यीकरण जीन, ६० सकारात्मक नियंत्रण, ५०० गैर मानव लक्ष्यीकरण नियंत्रण, और २०७ CTCF तत्वों या lncRNA लक्ष्यीकरण जीन (चित्रा 1, तालिका 1) । प्रत्येक लक्ष्यीकरण डीएनए तत्व 5-10 अलग sgRNAs द्वारा लक्षित है ।

2. sgRNA पुस्तकालय क्लोनिंग

  1. CRISPR में संश्लेषित ओलिगोन्यूक्लिओटिड्स क्लोन लेंटीवायरल बैकबोन वेक्टर (lentiCRISPRv2).
    1. 2 ज के लिए ३७ डिग्री सेल्सियस पर BsmBI प्रतिबंध एंजाइम के साथ LentiCRISPRv2 सदिश पचा ।
    2. BsmBI पाचन के बाद जेल पर बड़ा बैंड (लगभग १२,८७३ bp) की उपस्थिति के लिए देखो, और फिर इसे जेल निष्कर्षण किट के साथ शुद्ध ।
      नोट: एक 2kb छोटे भराव टुकड़ा भी पाचन के बाद जेल पर मौजूद है, लेकिन इस पर ध्यान नहीं दिया जाना चाहिए ।
    3. संश्लेषित ओलिगोन्यूक्लिओटिड्स और पचा LentiCRISPR वेक्टर के साथ १५० एनजी के साथ पचा LentiCRISPR डीएनए, 10 μM oligos के 1 μL, 10x T4 ligate बफर के 2 μL, T4 ligate के 1 μL, और फिर उन्हें 16 डिग्री सेल्सियस पर रात में सेते.
  2. प्रवर्धन के लिए इलेक्ट्रोवायरल CRISPR/sgRNA पुस्तकालय को इलेक्ट्रो-सक्षम कोशिकाओं में रूपांतरित करना ।
    1. १.८ केवी, २०० Ω और 25 μF पर विद्युत पोरेटर तैयार करें । तो पहले एक ३७ ° c पानी स्नान में वसूली soc मीडिया गर्म, और पूर्व गर्म पौंड एम्पीसिलीन एंटीबायोटिक प्लेटें ३७ डिग्री सेल्सियस पर ।
    2. 10 मिनट के लिए बर्फ पर सक्षम कोशिकाओं गल ।
    3. तैयार १.५ मिलीलीटर माइक्रो-सेंट्रीफ्यूज ट्यूबों और बर्फ पर 1 मिमी इलेक्ट्रोपोरेशन cuvettes ।
    4. एक 10 एनजी/μl पुस्तकालय प्लाज्मिड डीएनए के 1 μl एक १.५ मिलीलीटर माइक्रो सेंट्रीफ्यूज ट्यूब में सक्षम कोशिकाओं के 25 μl में मिक्स, और धीरे से ट्यूब के नीचे flicking द्वारा कुछ समय मैंयुअल रूप से मिश्रण ।
    5. एक बार जब कुवेटे काफी ठंडा हो जाता है, तो डीएनए/सक्षम कोशिका मिश्रण को इसमें स्थानांतरित कर देना चाहिए । countertop पर दो बार ठोकर और एक ऊतक कागज के साथ द्रोणिका के बाहरी से किसी भी पानी की बूंदों पोंछ । फिर क्वेटे को इलेक्ट्रोपोरेशन मॉड्यूल और प्रेस पल्स में रखें ।
    6. तुरंत ३७ डिग्री सेल्सियस पूर्व गर्म SOC मीडिया के ९७५ μL जोड़ें । ऊपर और नीचे और एक 15 मिलीलीटर ट्यूब को स्थानांतरित करने के द्वारा मिश्रण ।
    7. घुमाएं और 1 एच के लिए ३७ डिग्री सेल्सियस पर सेते ।
    8. SOC मीडिया के ९०० μL में १०० μL कोशिकाओं को पतला और एक पौंड एम्पीसिलीन एंटीबायोटिक आगर प्लेट पर जगह १०० μL. ३७ डिग्री सेल्सियस पर रात में सेटे ।
  3. निर्माता के प्रोटोकॉल में विस्तृत के रूप में एक maxi तैयारी स्तंभ का उपयोग कर संयुक्त कालोनियों से प्लाज्मिड डीएनए निकालें ।
    1. पौंड आगर प्लेट से सभी कालोनियों परिमार्जन और पौंड एम्पीसिलीन एंटीबायोटिक मध्यम के 2 मिलीलीटर और जोरदार मिलाते (~ २०० एक्स जी) के साथ रातोंरात ३७ डिग्री सेल्सियस पर सेने की एक स्टार्टर संस्कृति संरोपण ।
    2. स्टार्टर संस्कृति 1:500 पौंड एम्पीसिलीन मध्यम और 12-16 एच के लिए ३७ डिग्री सेल्सियस पर जोरदार मिलाते (~ २०० एक्स जी) के साथ सेते की १०० मिलीलीटर में पतला ।
    3. 4 ° c पर 15 मिनट के लिए ६,००० x g पर केंद्रापसारक द्वारा बैक्टीरियल सेल गोली फसल ।
    4. निलंबन बफर के 10 मिलीलीटर में बैक्टीरियल गोली को फिर से निलंबित कर दें ।
    5. lysis बफर के 10 मिलीलीटर के साथ निलंबित गोली Lyse, और जोरदार 4-6 बार उलटने । कमरे के तापमान पर 5 मिनट के लिए lysate सेटे ।
    6. ठंडा बेअसर बफर के 10 मिलीलीटर के साथ lysate बेअसर । धीरे ट्यूबों 4-6 बार उलटा और बर्फ पर 20 मिनट के लिए यह सेते द्वारा मिक्स ।
    7. 4 डिग्री सेल्सियस पर 30 मिनट के लिए १३,५०० x g पर नीचे स्पिन । प्लाज्मिड डीएनए वाले सुपरनैजेंट को एक नए ट्यूब में तुरंत स्थानांतरित करें ।
    8. चरण 2.3.7 दोहराएं, और तुरंत एक नया ट्यूब के लिए प्लाज्मिड डीएनए युक्त supernatant हस्तांतरण ।
    9. Equiliब्रेट बफर के 10 मिलीलीटर लागू करने और स्तंभ गुरुत्वाकर्षण प्रवाह से खाली करने के लिए अनुमति देने के द्वारा स्तंभ Equilibrate ।
    10. स्तंभ के लिए supernatant जोड़ें और गुरुत्वाकर्षण प्रवाह द्वारा राल में प्रवेश करने के लिए अनुमति देते हैं ।
    11. धोने बफर के 2x 30 मिलीलीटर के साथ कॉलम धो लें ।
    12. डीएनए को एलूशन के साथ 15 एमएल का वेल्यूशन बफर कर लीजिये.
    13. डीएनए को १०.५ मिलीलीटर के कमरे के तापमान isopropanol के साथ eluted डीएनए हाला । मिक्स और 4 डिग्री सेल्सियस पर 30 मिनट के लिए १५,००० x g पर तुरंत नीचे स्पिन, और धीरे से supernatant छानना ।
    14. ७०% इथेनॉल के 5 मिलीलीटर के साथ डीएनए गोली धोने, सेंट्रीफ्यूज डीएनए गोली 10 मिनट के लिए १५,००० एक्स जी पर और स्पष्ट supernatant त्यागें ।
    15. दोहराएं चरण 2.5.14 दो बार और अधिक ।
    16. सेंट्रीफ्यूज डीएनए गोली 10 मिनट के लिए १५,००० x जी पर, और धीरे डीएनए गोली परेशान बिना supernatant छानना ।
    17. हवा 5-10 मिनट के लिए गोली सूखी, और बफर (ते बफर, पीएच ८.०) की एक आवश्यक मात्रा में डीएनए भंग ।

3. उच्च टिटर sgRNA पुस्तकालय लेंटीवायरस जनरेशन

  1. सेल तैयारी: संस्कृति HEK293T Dulbecco के संशोधित ईगल मध्यम (DMEM) 10% के साथ पूरक (vol/vol) भ्रूण गोजातीय सीरम (FBS) और 1% (vol/vol) पेनिसिलिन-स्ट्रेप्टोमाइसिन (पुनश्च) एंटीबायोटिक टी-25 flasks है । उंहें ३७ डिग्री सेल्सियस और 5% सह2पर इनयूबेटर में रखें ।
  2. पैकेज लेंसवायरस: सह-transfect HEK293T कोशिकाओं के साथ 20 μg शुद्ध पुस्तकालय वैक्टर के चरण 2 से, 15 μg पैकेज प्लाज्मिड (psPAX2) और 10 μg लिफाफा प्लाज्मिड (pMD2. g) के लिए ४८ एच के लिए वायरस फसल कटाई से पहले.
  3. वायरस संग्रह: ४८ h के बाद, संग्रहकी वायरस supernatant और एक ०.४५ μm कम प्रोटीन बाध्यकारी PVDF झिल्ली के माध्यम से वायरस supernatant फिल्टर ।
  4. वायरस एकाग्रता: ५०-फ़ोल्ड का उपयोग कर और चरण 5 में वायरस MOI परीक्षण द्वारा मसूर की दाल को ध्यान केंद्रित ।
  5. वायरस भंडारण: एक-८० डिग्री सेल्सियस फ्रीजर में केंद्रित वायरस और स्टोर Aliquot ।

4. ऑप्टिमाइज़ किया गया प्रॉमिमाइसिन एकाग्रता

  1. ल्यूकेमिया सेल संस्कृति: संस्कृति MOLM13 AML RPMI में कोशिकाओं १६४० 10% के साथ पूरक (vol/vol) भ्रूण गोजातीय सीरम (एफबीएस) और 1x पेनिसिलिन-स्ट्रेप्टोमाइसिन (पुनश्च) एंटीबायोटिक दवाओं एक टी-१२५ फ्लास्क में । उंहें ३७ डिग्री सेल्सियस पर एक मशीन में प्लेस और 5% सह2
    नोट: कोशिकाओं को आम तौर पर 1:4 या 1:6 के विभाजन के अनुपात में हर 4-5 डी पारित कर रहे हैं, कोशिकाओं को ७०% कन्फ्लुएंसी से अधिक तक पहुंचने की अनुमति कभी नहीं ।
  2. १.० x 104 सेल के घनत्व के साथ एक 12-well थाली में MOLM13 कोशिकाओं को सेट करें, अच्छी तरह से प्रति 2 मिलीलीटर की कुल मात्रा में (२.० x 104 कोशिकाओं).
  3. समय-पाठ्यक्रम परख: सांद्रता बढ़ाने में 7 दिनों के लिए प्रोमाइसिन के साथ MOLM13 कोशिकाओं का इलाज (०.१ μg/ml, ०.२ μg/एमएल, ०.५ μg/एमएल, १.० μg/एमएल और २.० μg/एमएल)
    1. 0 दिवस पर puromycin उपचार के बिना MOLM13 कोशिकाओं को सेट और 3 दिन से 7 दिन से एक नियंत्रण के रूप में puromycin उपचार के बिना दोहराने कुओं की स्थापना की ।
    2. 3 को दोहराने वाले कुओं वाली प्रत्येक प्रायोगिक स्थिति के साथ MOLM13 कोशिकाओं का उपचार ०.१ μg/एमएल, ०.२ μg/एमएल, ०.५ μg/एमएल, १.० μg/एमएल और २.० μg/एमएल के साथ अलग से करें ।
    3. लाइव सेल अनुपात की गणना और सभी शर्तों वाले दिन 0 से 7 दिन के लिए एक अस्तित्व वक्र बनाते हैं ।
  4. जीवन रक्षा वक्र: Trypan नीले और गणना व्यवहार्यता दैनिक के साथ दाग कोशिकाओं प्रत्येक प्रोमाइसिन एकाग्रता के लिए अस्तित्व घटता प्राप्त करने के लिए ।
  5. अनुकूलन ंयूनतम puromycin एकाग्रता: Trypan ब्लू धुंधला, जिसमें सभी MOLM13 कोशिकाओं 5-7 दिनों के बीच मारे गए है के माध्यम से ंयूनतम puromycin एकाग्रता का निर्धारण ।

5. MOLM13 ल्यूकेमिया कोशिकाओं में लैंटिवायरल पुस्तकालय की टाइट्रेट करना

  1. एएमएल कोशिकाओं की तैयारी: पारक्रमण साथ MOLM13 aml कोशिकाओं लीजिए (rpmi १६४०, 10% fbs, 1% पी एस, और ८.० μg/एमएल कोटिंग मध्यम) के घनत्व पर १.५ x 106 कोशिकाओं/
  2. 12-अच्छी थाली में १.५ x 106 कोशिकाओं के साथ एक अच्छी तरह से में MOLM13 कोशिकाओं प्लेस ।
  3. गल रहा है:-८० ° c फ्रीजर से केंद्रित दाल को हटाने और बर्फ पर यह गल ।
  4. अलग कुओं में केंद्रित मसूर की एक अलग खुराक के साथ MOLM13 कोशिकाओं को मिक्स, 0, 1, २.५, 5, ७.५ और 10 μL (कुल 6 समूहों) सहित.
  5. इन मिश्रण को तुरंत ३३ डिग्री सेल्सियस पर 2 ज के लिए १,००० x g पर सेंट्रीफ्यूज करें और 12-वेल प्लेट्स को ३७ डिग्री सेल्सियस पर इनयूबेटर पर वापस और 5% CO2 को 4 ज के लिए ट्रांसफर करें ।
  6. 4 ज के बाद, कमरे के तापमान पर 5 मिनट के लिए ४०० x g पर संक्रमित कोशिकाओं नीचे स्पिन ।
  7. धीरे सेल गोली परेशान बिना supernatant महाप्राण, और फिर से ताजा मीडिया के साथ transduced कोशिकाओं को निलंबित (rpmi १६४०, 10% fbs और 1% पुनश्च), और फिर उंहें टी के लिए स्थानांतरण-25 बोतल है और ३७ डिग्री सेल्सियस के लिए ४८ एच के लिए बिना प्रोमाइसिन ।
  8. के बाद ४८ एच, 2 बोतल में इन कोशिकाओं को विभाजित (2 समूहों): एक प्रयोगात्मक 5 दिनों के लिए 1 μg/मिलीलीटर puromycin के साथ इलाज समूह, और 5 दिनों के लिए puromycin उपचार के बिना एक नियंत्रण समूह ।
  9. सभी गैर transduced नियंत्रण कोशिकाओं मर चुके हैं जब तक चरण 4 के अनुसार 1 μg/मिलीलीटर puromycin के साथ 5 दिनों के लिए प्रोमाइसिन चयन बाहर ले । हर 2 दिन में नए मीडिया के लिए एक्सचेंज ।
  10. puromycin उपचार के बिना कोशिकाओं की संख्या के साथ puromycin के साथ इलाज किया जीवित कोशिकाओं की संख्या को विभाजित करके पारक्रमण के लिए अनुकूलित MOI मूल्य उपाय ।

6. Pooled CRISPR-Cas9 KO पुस्तकालय के Transduction

  1. लेंथ के साथ ट्रांसवायरस: संक्रमित १.५ x 106 MOLM13 कोशिकाओं के ०.३ MOI के साथ sgrna परित मसूर में मध्यम (rpmi १६४०, 10% fbs, 1% पी एस, और 8 μg/मिलीलीटर कोटिंग मध्यम) 6-well थाली में और बिना एक नियंत्रण के रूप में की कोशिकाओं का उपयोग करें ।
  2. तुरंत सेंट्रीफ्यूज 6-well थाली १,००० x g पर 2 एच के लिए ३३ डिग्री सेल्सियस पर कोशिकाओं को spinfect और प्लेटों वापस करने के लिए ३७ डिग्री सेल्सियस और 5% सह2 के लिए 4 एच में ।
  3. कमरे के तापमान पर 5 मिनट के लिए ४०० x g पर संक्रमित कोशिकाओं नीचे स्पिन ।
  4. धीरे सेल गोली परेशान बिना supernatant महाप्राण, और फिर से ताजा मीडिया के साथ transduced कोशिकाओं को निलंबित (rpmi १६४०, 10% fbs और 1% पुनश्च), और फिर उंहें टी के लिए स्थानांतरण-25 बोतल है और ३७ डिग्री सेल्सियस के लिए ४८ एच के लिए बिना प्रोमाइसिन ।
  5. ४८ ज के बाद, 5 दिनों के लिए 1 μg/mL puromycin के साथ कोशिकाओं का इलाज । 2 दिनों के बाद ताजा मीडिया के लिए एक्सचेंज और एक इष्टतम सेल घनत्व पर रहते हैं ।
  6. ९६ में एकल क्लोन बीज-अच्छी तरह से कमजोर पड़ने विधियों के साथ प्लेटों और ३७ डिग्री सेल्सियस और 5% सह2पर इन एकल क्लोन सेते । 3-4 सप्ताह के लिए उंहें संस्कृति ।
  7. के बाद एक एकल सेल एक आबादी में बढ़ता है, 24 में कोशिकाओं के आधे-अच्छी तरह से प्लेटों के लिए puromycin चयन के तहत आगे की संस्कृति के लिए स्थानांतरण और अगले चरण में इन क्लोन सत्यापित करें । बाकी कोशिकाओं को रखें ।

7. एक कदम RT-qPCR के साथ Pooled CRISPR-Cas9 KO पुस्तकालय की स्क्रीनिंग

  1. एक कदम रिवर्स-transcriptase पोलीमरेज़ श्रृंखला प्रतिक्रिया (एक कदम RT-qpcr) के साथ मार्कर जीन HOXA9 की अभिव्यक्ति का मूल्यांकन करके sgrna एकीकृत क्लोन स्क्रीनिंग की प्रभावशीलता का निर्धारण ।
    नोट: HOXA9 उच्च ल्यूकोजेनेसिस में MOLM13 aml कोशिकाओं में व्यक्त कर रहे है22,23
  2. sgRNA एकीकृत MOLM13 सेल गिनती और एक ९६-well पीसीआर प्लेट के लिए अच्छी तरह से प्रति 1 x 104 कोशिकाओं को हस्तांतरण ।
  3. सेंट्रीफ्यूज १,००० एक्स जी पर ट्यूब 5 मिनट के लिए, और फिर अच्छी तरह से हटाने और सेल गोली परेशान किए बिना एक पिपेट के साथ supernatant त्यागने ।
  4. PBS बफर के १२५ μL के साथ कोशिकाओं को धो, और 5 मिनट के लिए १,००० एक्स जी पर ट्यूब सेंट्रीफ्यूज । फिर एक पिपेट का उपयोग कर supernatant के १२० μL निकालें और प्रत्येक अच्छी तरह से PBS के लगभग 5 μL बनाए रखने ।
  5. सेल lysis मास्टर मिक्स के ५० μL सेल lysis बफर के ४८ μL, proteinase कश्मीर समाधान के 1 μL (10 मिलीग्राम/एमएल) और DNase समाधान के 1 μL (1 मिलीग्राम/एमएल) के लिए प्रत्येक अच्छी तरह से जोड़ें । फिर ऊपर पिपेट और नीचे 5 बार फिर से सेल गोली निलंबित ।
  6. 10 मिनट के लिए कमरे के तापमान पर मिश्रण सेते, ३७ डिग्री सेल्सियस पर 5 मिनट के बाद, और फिर 5 मिनट के लिए ७५ ° c.
  7. सेल lysate पर-८० डिग्री सेल्सियस फ्रीजर स्टोर ।
  8. एक कदम आरटी-qPCR प्रतिक्रिया की तैयारी: गल एक कदम प्रतिक्रिया मिश्रण और अन्य प्रतिक्रिया घटकों 4 डिग्री सेल्सियस करने के लिए. फिर नीचे संक्षिप्त स्पिन ट्यूबों के नीचे समाधान इकट्ठा करने के लिए, और प्रकाश के बिना बर्फ पर जगह है । मिक्स और धीरे स्पिन ।
  9. आर टी-qPCR रिएक्शन मिक्स के साथ पीसीआर कुओं के लिए सेल lysate के 1 μL जोड़ने, मार्कर जीन के फॉरवर्ड प्राइमर (३०० एनएम) और रिवर्स प्राइमर (३०० एनएम), ०.१२५ μL रिवर्स transcriptase (10 U/μL) के 1 μL, और एक कदम प्रतिक्रिया मिश्रण (2x) के 5 μL सहित ।
  10. ऑप्टिकली पारदर्शी फिल्म के साथ सील कुओं, और धीरे भंवर और प्रतिक्रिया घटकों मिश्रण ।
  11. ९६-खैर पीसीआर प्लेट को रीयल टाइम पीसीआर इंस्ट्रूमेंट पर लगाएं ।
  12. ५० डिग्री सेल्सियस पर 10 मिनट के लिए रिवर्स प्रतिलेखन प्रतिक्रिया भागो, पोलीमरेज़ inactivation और ९५ डिग्री सेल्सियस पर 1 मिनट के लिए डीएनए की निंदा के बाद ।
  13. पीसीआर रिएक्शन के ४० चक्रों के साथ आरटी-पीसीआर का प्रदर्शन: ९५ डिग्री सेल्सियस पर 15 एस के लिए विकृत्करण, और ६० डिग्री सेल्सियस पर 20 एस के लिए थाली प्रतिदीप्ति पढ़ना, और फिर पिघल वक्र विश्लेषण 65-95 डिग्री सेल्सियस के माध्यम से ०.५ डिग्री सेल्सियस की वृद्धि पर 2-5 s/कदम ।
  14. नियंत्रण की तुलना में HOXA9 जीन की अभिव्यक्ति के स्तर के अनुसार, अलग से upregulated, downregulated और कोई परिवर्तन समूहों की स्थापना की । एक हाउसकीपिंग जीन नियंत्रण के रूप में β-actin जीन का प्रयोग करें ।

8. जीनोटाइपिंग और सैन्सर अनुक्रम के माध्यम से एकीकृत sgRNAs सकारात्मक क्लोन का सत्यापन

  1. संगेर अनुक्रमण के माध्यम से HOXA9 घटी हुई अभिव्यक्ति क्लोन की जाँच करें और 50-100 एनजी MOLM13 जीनोम डीएनए, 5 μl पोलीमरेज़ प्रतिक्रिया बफर (10x), 1 μl आगे प्राइमर (10 μm) के साथ पीसीआर प्रदर्शन (aatggactatcatatgcttaccgtaacttgaaagtatttcg) और 1 μl रिवर्स प्राइमरी (10 μM) (TCTACTATTCTTTCCCCTGCACTGTTGTGGGCGATGTGCGCTCTG), 1 μL dNTP (10mM), 1 यूनिट पॉलीमलेस (5 U/ 30 के लिए ९४ डिग्री सेल्सियस पर प्रारंभिक विकृत्करण के साथ पीसीआर प्रतिक्रिया करें, और फिर 20 एस के लिए ९४ डिग्री सेल्सियस पर अधिक विकृतिकरण, 20 एस के लिए ५६ डिग्री सेल्सियस पर, विस्तार ६८ डिग्री सेल्सियस पर 20 एस के लिए (कुल 30 चक्र), 10 मिनट के लिए ६८ डिग्री सेल्सियस पर अंतिम विस्तार , और फिर 4 डिग्री सेल्सियस पर पकड़े ।
  2. पीसीआर उत्पादों (आकार २८५ बीपी) को पीसीआर शुद्धिकरण किट के साथ निकालें और शुद्ध करें ।
  3. शुद्ध पीसीआर उत्पादों को 2 μL T4 ligate बफर (10x), ५० एनजी टी वेक्टर डीएनए (५० ng/μL), 25 एनजी प्यूरिफाइड पीसीआर डीएनए (२८५ बीपी), 1 μL T4 ligate (3 इकाइयों/μL) के साथ टी वेक्टर में लाइजेज़ मिश्रण को रात भर 16 डिग्री सेल्सियस पर एक इनयूबेटर में रखें ।
  4. DH5α सक्षम सेल में बंधाव मिश्रण स्थानांतरण, एक पौंड एम्पीसिलीन एंटीबायोटिक आगर प्लेट पर बढ़ने, और ३७ डिग्री सेल्सियस पर रातोंरात सेते ।
  5. पौंड प्लेट से सिंगल क्लोन उठाओ और जीनोटाइपिंग और sanger अनुक्रमण द्वारा उन्हें सत्यापित.

9. Nuclease पाचन परख द्वारा प्रेरित Indel उत्परिवर्तन की sgRNAs का पता लगाना

  1. एक nuclease परीक्षण परख द्वारा sgRNA एकीकृत एकल क्लोन प्रेरित Indel दरों का पता लगाने ।
  2. अलग से 50-100 एनजी indel उत्परिवर्ती (टेस्ट) और वंय प्रकार के साथ पीसीआर amplicons तैयार (wt, संदर्भ) डीएनए पीसीआर टेम्पलेट के रूप में, 5 μl पोलीमरेज़ प्रतिक्रिया बफर (10x), 1 μl dntp (10x), 1 इकाई पोलीमरेज़ (5 U/μl), 1 μl फॉरवर्ड प्राइमर (10 μm) (5 '-gagatggcggcgcggaag-3 '), और 1 μ L रिवर्स प्राइमर (10 μM) (5 '-AAATATAGGGCGGCTGTTCACT-3 '). पीसीआर रिएक्शन 30 एस के लिए ९८ डिग्री सेल्सियस पर प्रारंभिक निंदा के साथ किया गया था, और फिर 20 एस के लिए ९८ डिग्री सेल्सियस पर, 20 एस के लिए ५६ डिग्री सेल्सियस पर अनीलन, 30 एस के लिए ७२ डिग्री सेल्सियस पर विस्तार (कुल 30 चक्र), और 10 मिनट के लिए ७२ डिग्री सेल्सियस पर अंतिम विस्तार , और 4 डिग्री सेल्सियस पर धारण ।
  3. २०० एनजी के साथ heteroद्वैध मिश्रण समूह की स्थापना की "संदर्भ" (20 एनजी/μL) और २०० एनजी "परीक्षण" (20 एनजी/μL) पीसीआर amplicons ०.२ मिलीलीटर पीसीआर में, और केवल ४०० के साथ "संदर्भ" पीसीआर amplicons के एक नियंत्रण के रूप में होमोडुप्लेक्स मिश्रण समूह ।
  4. अलग से एक 1 L बीकर में 5 मिनट के लिए ९५ डिग्री सेल्सियस पर heteroद्वैध और होमोडुप्लेक्स मिश्रण सेते पानी की ८०० मिलीलीटर से भरा है और फिर धीरे से कमरे के तापमान को शांत करने के लिए और heteroद्वैध या होमोड्यूप्लेक्स के रूप में ।
  5. अलग से पचाने ४०० एनजी के साथ annealed विषम और समद्विक मिश्रण के साथ 1 μL indel उत्परिवर्तन जांच nuclease (२.५ U/μL) और 2 μL nuclease प्रतिक्रिया बफर (10x) ४२ ° c पर ६० मिनट के लिए ।
  6. अग्रासे जेल के साथ पचा नमूनों का विश्लेषण इलेक्ट्रोफोरेसिस, विषमद्वैध मिश्रण डीएनए छोटे टुकड़ों में काटा जाना चाहिए (70-250 बीपी), और होमोडुप्लेक्स डीएनए (३२० बीपी) नहीं काटा जाना चाहिए ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

CRISPR-Cas9 प्रौद्योगिकी कार्यात्मक जीनोमिक अध्ययन के लिए एक शक्तिशाली अनुसंधान उपकरण है । यह तेजी से पारंपरिक जीन संपादन तकनीकों की जगह है और दोनों जीनोम चौड़ा और व्यक्तिगत जीन के लिए उच्च उपयोगिता है-अनुप्रयोगों केंद्रित । यहां, पहले व्यक्तिगत क्लोन loci-विशिष्ट CRISPR-Cas9-arrayed sgRNA पुस्तकालय Sgrna लक्ष्य ३०३ यादृच्छिक लक्ष्यीकरण जीन, ६० सकारात्मक नियंत्रण, ५०० गैर मानव लक्ष्यीकरण नियंत्रण, और २०७ CTCF तत्वों या lncRNA निर्वाचकगण १,०७० Sgrna शामिल है चार Hox loci में जीन लक्ष्यीकरण (चित्रा 1, 1 तालिका) । इस पुस्तकालय सभी CTCF कोर बाध्यकारी रूपांकनों लक्ष्य, hox जीन संबद्ध lncRNAs, ज्ञात नियामक तत्वों, और hox loci में सकारात्मक नियंत्रण के रूप में कई hox जीन । इसमें यादृच्छिक गैर-होक्स जीन, गैर-मानव जीन तथा अंतजनित क्षेत्रों को ऋणात्मक नियंत्रणों के रूप में लक्षित करने वाले sgRNAs भी शामिल हैं । की दक्षता और विशिष्टता को बढ़ाने के लिए CTCF साइट नॉकआउट (KO) द्वारा lentiCRISPR ट्रांसलेशन, प्रत्येक लक्ष्यीकरण साइट शामिल हैं 5-10 sgRNAs (तालिका 1). यहां वर्णित प्रोटोकॉल में, sgRNA पुस्तकालयों को इन loci में Hoxa/B/C/D loci और lncRNAs में ctcf बाइंडिंग साइटों के अनुसार डिज़ाइन किया गया है, जो व्यापक संस्थान sgrna उपकरण पर आधारित है (चित्रा 1, चित्रा 2) । MOLM13 कोशिकाओं में mll-AF9 संलयन ले जाने के एक MOI के साथ संक्रमण के एक कम बहुलता पर पारक्रमण के बाद, संक्रमण की दर एक sgrna से कम है/सेल के बाद puromycin चयन, और फिर प्रतिरोधी क्लोन एकल सेल से बड़े HOXA9 जीन अभिव्यक्ति की हानि के लिए जांच की ।

sgRNA लाइब्रेरी स्क्रीनिंग के लिए कार्यप्रवाह संक्षिप्त वर्णन किया गया था (चित्रा 3). सबसे पहले, sgRNA पुस्तकालय युक्त वायरस दो वैक्टर (psPAX2 और pMD2. G) की मदद से HEK293T कोशिकाओं में उत्पन्न किया गया. sgrna परित पुस्तकालय मसूर की दाल को केंद्रित किया गया और polybrane (८.० μg/mL) के साथ MOLM13 aml कोशिकाओं में transduced । एक ४८ के बाद, कोशिकाओं puromycin के इष्टतम एकाग्रता के साथ इलाज किया गया । 5 दिनों के बाद, कोशिकाओं को एक सेल/अच्छी तरह से ९६-वेल प्लेटों में बोये गए और एक क्लोन को प्रोमाइसिन की उपस्थिति में उत्पन्न किया गया । अंत में, sgRNA एकल क्लोन जीनोम में एकीकृत एक कदम आरटी-पीसीआर, Sanger अनुक्रमण और Indel उत्परिवर्तन का पता लगाने (चित्रा 3) द्वारा पहचाने गए थे । HOXA9 oncogene की अभिव्यक्ति फेरबदल के अनुसार एक कदम छोटी बूंद डिजिटल आरटी-qpcr (आरटी-ddqpcr) के माध्यम से की पहचान की है puromycin प्रतिरोधी एकल क्लोन (चित्रा 4) । genotyping और sanger अनुक्रम sgrna पुस्तकालय निर्माण और सत्यापन के लिए प्रदर्शन किया गया (चित्रा 2, चित्रा 4) ।

९६-well पीसीआर प्लेट में sgRNA लक्ष्यीकरण MOLM13 सकारात्मक क्लोन नियंत्रण कोशिकाओं के साथ तुलना के माध्यम सेHOXA9 जीन के अभिव्यक्ति स्तर पर आधारित आरटी-qpcr विधि के साथ आगे की पुष्टि की गई । ५२८ जीवित क्लोनों की जांच के बाहर, 10 क्लोन HOXA9 के स्तर में ५०% से अधिक की कमी प्रदर्शित (चित्र 4a) । HOXA9में एकीकृत sgRNAs-कम, HOXA9-अपरिवर्तित, और HOXA9वृद्धि की क्लोन आगे sgrnas वेक्टर PRIMERS का उपयोग कर दृश्यों की पीसीआर प्रवर्धन द्वारा पुष्टि की गई । शुद्ध पीसीआर उत्पादों टी वेक्टर प्रणाली में T4 ligated के माध्यम से ligated थे और Sanger अनुक्रम द्वारा पहचान के लिए बाहर भेजा (चरण 8 देखें) । अनुक्रम आंकड़ों से संकेत मिलता है कि 30 क्लोन sequenced से, 21 क्लोन एकल sgRNA (तालिका 2) शामिल थे । sgRNA की श्रेणियों की पहचान की और HOXA9 अभिव्यक्ति के स्तर के अनुसार विश्लेषण किया गया । दस में से छह क्लोन HOXA9 स्तरों में कमी दिखा sgRNAs CBS7/9 साइट को लक्षित करने, लेकिन गैर में नहीं मानव जीन, यादृच्छिक मानव जीन, और अंय ctcf साइट नियंत्रण (चित्रा 4 और तालिका 2) ।

sgRNA एकीकृत सकारात्मक एकल क्लोन प्रेरित Indel उत्परिवर्तनों के द्वारा निर्धारित कर रहे है पीसीआर आधारित जीनोटाइपिंग और nuclease पाचन के आधार पर nuclease परख (चित्रा 5) । न्यूक्लिस पाचन परख प्रतिनिधि HOXA9में CBS7/9 सीमा में हुई indel म्यूटेशन की पहचान करने के लिए प्रदर्शन किया गया है-कम, HOXA9-अपरिवर्तित, और HOXA9-वृद्धि क्लोन. परिणाम से पता चला कि CBS7/9 उत्परिवर्तन 6 HOXA9-कम क्लोन में से 4 में पाया गया है: क्लोन #5, 6, 28, और १२१, लेकिन क्लोन #15 और #31 में नहीं (चित्रा 5) । हालांकि, क्लोन #15 में sgRNA लक्ष्यीकरण Hottip lncrna साइट निहित है, जबकि क्लोन #31 कई Sgrna लक्ष्यीकरण HOAIRM1 lncrna, Hottip lncrna, और HOXD9/ ctcf बाइंडिंग साइट (आंकड़े 4b, 5 और तालिका 2) ।

Figure 1
चित्रा 1 : योजनाबद्ध आरेख चार में CTCF बाइंडिंग साइटें और lncRNAs दिखा रहा है Hox जीन loci. प्रत्येक लक्ष्यीकरण डीएनए तत्व में 5-10 विभिन्न sgRNAs शामिल हैं. ctcf चिप-seq dataset भू (GSM1335528) से डाउनलोड किया गया था और एकीकृत जीनोमिक व्यूअर (igv) के साथ कल्पना. Hox loci में ctcf साइटों को लक्षित sgrna नारंगी कैंची के साथ लेबल थे । कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें । 

Figure 2
चित्रा 2 : योजनाबद्ध आरेख जो sgRNA वेक्टर अनुक्रम और पीसीआर प्रवर्धन प्राइमरों को एकीकृत करने के भाग का प्रतिनिधित्व करता है । पीसीआर प्रवर्धन प्राइमरों को sgRNA के रिक्त अनुक्रम के अनुसार डिजाइन किया गया था । फॉरवर्ड प्राइमर (P1) पीले रंग में प्रकाश डाला गया था, रिवर्स प्राइमर (P2) लाल रंग में प्रकाश डाला गया था, और sgRNA sgRNA मसूरी वायरल वेक्टर में हरे रंग में प्रकाश डाला गया था । कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें । 

Figure 3
चित्रा 3 : sgRNAs पुस्तकालय डिजाइन, निर्माण और सत्यापन के लिए कार्यप्रवाह का प्रतिनिधित्व योजनाबद्ध आरेख । यह वर्कफ़्लो निंनानुसार है । सबसे पहले, sgRNA पुस्तकालय डिजाइन किया गया था और एक मसूरी में क्लोन CRISPR वेक्टर, और फिर मसूर sgRNA पुस्तकालय के साथ पैक किया गया था लेंटरवायरल वेक्टर, psPAX2 और pMD2. G वैक्टर HEK293T कोशिकाओं में. अगले, MOLM13 कोशिकाओं को एक कम MOI (०.३) वायरस से संक्रमित थे और इन कोशिकाओं को puromycin चयन किया गया । फिर, सिंगल क्लोन ९६-well थाली में बोये गए । अंत में, एक जीनोम में एकीकृत sgRNA एकल क्लोन एक कदम आरटी qPCR, सैन्गर अनुक्रम और Indel उत्परिवर्तन का पता लगाने के द्वारा पहचाने गए थे । कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें । 

Figure 4
चित्रा 4 : परित CRISPR-Cas9 KO पुस्तकालय स्क्रीनिंग एक कदम आरटी qPCR और Sanger अनुक्रम के साथ की पहचान की । () एक चरण आरटी-छोटी बूंद एक ही क्लोन में HOXA9 अभिव्यक्ति की डिजिटल पीसीआर स्क्रीनिंग sgrna पुस्तकालय युक्त मसूर की दाल से संक्रमित । HOXA9 अभिव्यक्ति के स्तर के लिए ५२८ sgRNA पुस्तकालय संक्रमित क्लोन की स्क्रीनिंग (५२८ डॉट्स) दिखाया गया है । ५२८ क्लोन के दस HOXA9 के स्तर (बैंगनी तीर) में ५०% से अधिक की कमी का प्रदर्शन किया । लाल रेखा नियंत्रण कक्षों के साथ तुलना करके 2-गुना कम परिवर्तन की सीमा का प्रतीक है; नीली रेखा 2 गुना वृद्धि परिवर्तन की सीमा का प्रतीक है । () छह क्लोन #5, 6, 28, १२१, २०७ और ४२० को संगर अनुक्रम (ग्रीन एरो) के माध्यम से CBS7/9 विशिष्ट sgRNA द्वारा लक्षित किया गया था । () डब्ल्यूटी MOLM13 में HOXA9 स्तरों और एकल लक्षित sgrna युक्त 21 क्लोन के आरटी-डीडीक्यूपीसीआर विश्लेषण । HOXA9 व्यंजक डेटा को sgRNA अनुक्रम की श्रेणियों के अनुसार पाँच समूहों में समूहीकृत किया गया: HOXA7/ ctcf साइट, गैर-मानवीय लक्ष्य, hox loci में अन्य ctcf साइटें, hox संबद्ध lncrnas, और अंय मानव लक्ष्य । यह आंकड़ा Luo एट अल.12से संशोधित किया गया है । आँकड़ों के लिए, इस डेटा छात्र टी परीक्षण के साथ तीन स्वतंत्र प्रयोगों से मतलब ± एसडी के रूप में प्रतिनिधित्व किया गया था. कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 5
चित्रा 5 : एकीकृत sgRNAs सकारात्मक क्लोन के Indel ंयूटेशन पीसीआर आधारित जीनोटाइपिंग और nuclease परख के साथ की पुष्टि की। ()  जीनोमिक डीएनए प्रतिनिधि CRISPR-Cas9 KO पुस्तकालय जांच क्लोन है कि कम, अपरिवर्तित, या HOXA9 अभिव्यक्ति के स्तर में वृद्धि की प्रदर्शनी से अलग किया गया था । HOXA7 और HOXA9 जीन (CBS7/9 सीमा) के बीच स्थित सीटीसीएफ साइट के विषमयुग्मज विलोपन की पहचान पीसीआर-आधारित जीनोटाइपिंग द्वारा की गई थी । HOXA9-घटी क्लोन #5, 6, 28, और १२१ CBS7/9 सीमा स्थान (काले तीर) में विलोपन का प्रदर्शन किया । (ख) CBS7/9 स्थल में indel परिवर्तन का विश्लेषण नाभिक पाचन परख द्वारा प्रतिनिधि क्लोन से किया गया था जो कम (लाल रेखा), अपरिवर्तित (नीली रेखा), या वृद्धि (जामुनी रेखा) HOXA9 व्यंजक स्तर का प्रदर्शन करता है । HOXA9-घटी क्लोन #5, 6, 28, और १२१ CBS7/9 सीमा स्थान (नारंगी तीर) में परिवर्तन का प्रदर्शन किया । यह आंकड़ा Luo एट अल.12से संशोधित किया गया है । कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें । 

तालिका 1: Sgrnas पूल लायब्रेरी लक्ष्यीकरण जानकारी। इस डेटा Luo एट अल.12से है । कृपया इस तालिका को डाउनलोड करने के लिए यहां क्लिक करें ।

तालिका 2: सैन्सर चयनित में प्रस्तुत sgRNAs का अनुक्रमण परिणाम HOXA9 -घटी, HOXA9 -अपरिवर्तित, और HOXA9 -वृद्धि क्लोन । HOXA9-कम, अपरिवर्तित और वृद्धि क्लोन लाल, नीले और बैंगनी रंग में, अलग से प्रकाश डाला जाता है । इस डेटा Luo एट अल.12से है । कृपया इस तालिका को डाउनलोड करने के लिए यहां क्लिक करें ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

प्रोटीन कोडन जीन संबंधित sgrna पुस्तकालयों एक कार्यात्मक स्क्रीनिंग प्रणाली में जीन और नेटवर्क के माध्यम से विशिष्ट सेलुलर कार्यों को विनियमित करने के लिए पहचान करने के लिए लागू किया गया है sgrna संवर्धन24,25,26 ,27,28. कई गैर कोडिंग क्षेत्र संबंधित sgRNA पुस्तकालयों भी जीन में दिखाया गया था-डिसटल और समीपवर्ती विनियमन तत्वों के लिए विशिष्ट कार्यात्मक स्क्रीन, सहित BCL11A, Tdgf1a और औषध प्रतिरोध विनियमन जीन28, 29,30. इन sgRNA पुस्तकालयों सभी एक विस्तृत जैव सूचना विज्ञान डिजाइन, oligonucleotide संश्लेषण, और उप के द्वारा उत्पंन किया गया था वैक्टर में ओलिगोन्यूक्लिओटाइड पूल (एस) क्लोनिंग । पूरे जीनोम व्यापक स्क्रीनिंग दृष्टिकोण बहुत शक्तिशाली और उपयोगी है, लेकिन जीनोम चौड़ा sgRNA डिजाइन और महंगे संश्लेषण के लिए लगातार धन के लिए कंप्यूटेशनल विशेषज्ञता की आवश्यकता है; इस प्रकार, यह अभी भी अधिकांश प्रयोगशालाओं के लिए चुनौतीपूर्ण है । तथापि, हमारे loci-विशिष्ट sgrna पुस्तकालय स्क्रीनिंग दृष्टिकोण दोनों सुविधाजनक और कुशल है ऐसे ctcf बाध्यकारी क्रोमेटिन संगठन और transअपंग विनियमन में शामिल साइट के रूप में विशिष्ट डीएनए तत्व की पहचान (चित्रा 1 और चित्रा 2) । CTCF सीमाओं को लक्षित करके, हमने एक विशिष्ट मार्कर जीन, HOXA9के अभिव्यक्ति स्तर के अनुसार sgRNA लक्षित क्लोन का मूल्यांकन करने के लिए एक-चरण RT-PCR लागू किया. इसके अलावा, हम इन सकारात्मक एकीकृत sgRNAs क्लोन की पुष्टि करने के लिए Sanger अनुक्रमण प्रदर्शन (चित्रा 2 और चित्रा 4). कार्यात्मक इन सकारात्मक sgrnas लक्षित क्लोन की पुष्टि करने के लिए, हम एक पीसीआर आधारित जीनोटाइपिंग और उत्परिवर्तन जांच परख के क्रम में निर्धारित करने के लिए कि क्या sgrnas लक्ष्य साइट संमिलित या विलोपन उत्परिवर्तन लाती (चित्रा 5) । यह हमें विशिष्ट गैर कोडिंग डीएनए तत्वों को लक्षित करने और स्तनधारी कोशिकाओं में अपने जैविक समारोह का मूल्यांकन करने के लिए एक आशाजनक विधि देता है ।

हमारे प्रोटोकॉल में, हमने उल्लेख किया है कि एक विशिष्ट ओलिगोन्यूक्लिओटाइड डिजाइन और अधिक कुशल उप-lentiCRIPSRV2 वैक्टर में क्लोनिंग और अधिक मज़बूती से एक सटीक sgRNA पुस्तकालय (कदम 1-2) उत्पन्न सुनिश्चित करेगा । आदेश में उच्च अनुमापांक sgrna पुस्तकालय को प्राप्त करने के लिए, मसूर की दाल, (चरण 3) प्रोटोकॉल के बाद संसांद्रक का उपयोग कर ५०-गुना केंद्रित किया जाना चाहिए, और एक में संग्रहित-८० ° c फ्रीजर एकाधिक aliquots में (कदम 3.1 – 3.5) । एक अतिरिक्त चिंता transduction के लिए इष्टतम MOI मूल्य मिल रहा है । यदि MOI बहुत कम है, संक्रमित कोशिकाओं की संख्या में कमी और sgRNA स्क्रीनिंग विफलता के लिए नेतृत्व करेंगे । यदि MOI बहुत अधिक है, यह एक एकल सेल में एक से अधिक sgRNA एकीकृत होगा, और यह एक कदम आरटी-पीसीआर और Indel उत्परिवर्तन का पता लगाने के माध्यम से sgRNA पुस्तकालय स्क्रीनिंग के साथ हस्तक्षेप करेंगे । इसलिए, स्क्रीनिंग से पहले, की कोशिकाओं के प्रत्येक समूह के लिए इष्टतम MOI खोजने के लिए की टाइट्रेट करना के माध्यम से एक महत्वपूर्ण कदम है । MOLM13 ल्यूकेमिया कोशिकाओं और MOI के मूल्यांकन में मसूर की दाल की टाइट्रेट प्रोटोकॉल (कदम 5.1 – 5.10) में किया जाएगा । इसके अलावा, रिवर्स ट्रांसक्रिप्शन के लिए कोशिकाओं की एक पूरी तरह से lysing सफल एक कदम आरटी-पीसीआर सुनिश्चित कर सकते हैं । यह प्रोटोकॉल (चरण 7.5-7.6) में सभी तापमान चरणों में lysis के लिए ऊष्मायन समय को बढ़ाने के द्वारा किया जा सकता है । इसलिए, क्रम में परित crispr की स्क्रीनिंग के लिए कुशल-Cas9 KO पुस्तकालय, पूरी तरह से सेल lysis और रिवर्स प्रतिलेखन एक कदम RT-qpcr (कदम 7.1-7.14) का निर्धारण करने में एक महत्वपूर्ण भूमिका निभाते हैं । इसके अतिरिक्त, पीसीआर उत्पादों की गुणवत्ता में वृद्धि सफल indel उत्परिवर्तन का पता लगाने सुनिश्चित कर सकते हैं, क्योंकि कम गुणवत्ता वाले पीसीआर उत्पादों heteroद्वैध/होमोडुप्लेक्स उत्पादन प्रक्रिया (कदम 9.1-.6) को प्रभावित करेगा ।

इसके अलावा, विधि जल्दी भ्रूणीय विकास में hox जीन विनियमन में ctcf की भूमिका और ंयायपालिका hox जीन हस्ताक्षर के साथ कुछ ल्यूकेमिया की पहचान करने के लिए इस्तेमाल किया जा सकता है । उदाहरण के लिए, भ्रूणीय विकास के दौरान होक्स जीन महत्वपूर्ण भूमिकाएं निभाते हैं और होक्स गेन्स के सभी चार क्लस्टर्स अस्थायी रूप से और भ्रूण विकास में उनकी अभिव्यक्ति पैटर्न में जटिल रूप से प्रतिबंधित होते हैं । इसके अलावा, NPM1 उत्परिवर्तन aml में सबसे आम आनुवंशिक असामान्यता और सामान्य सितोगेनिक क के साथ 30% एएमएल रोगियों के लिए खाते में है । एएमएल के इस सबसेट एक ंयायपालिका hoxa और hoxb जीन हस्ताक्षर है, जो ल्यूकेमिया से प्रभावित परिवर्तन17का एक प्रमुख तंत्र बन जाता है दर्शाती है । यह स्पष्ट करने के लिए महत्वपूर्ण है कि कैसे Hox जीन सामान्य विकास में विनियमित कर रहे हैं और leukemogenesis के दौरान dysregulated. हम और अंय लोगों को पता चला है कि ctcf क्रोमेटिन संगठन और hox loci9,12में जीन प्रतिलेखन में एक आवश्यक भूमिका निभाता है । इस प्रकार, hox loci केंद्रित sgrna पुस्तकालय स्क्रीनिंग विकास और टेम द्रोह के दौरान hox जीन विनियमन में ctcf बाध्यकारी साइट के विशिष्ट समारोह फंसाए करने के लिए एक सुविधाजनक साधन प्रदान करता है । हालांकि, दृष्टिकोण की कमी उच्च-थ्रपुट अगली पीढ़ी अनुक्रमण के लिए एक उपयोगी मार्कर खोजने की कठिनाई है । भविष्य के अनुसंधान लक्ष्यों में से एक के लिए एक उच्च चयनात्मक मार्कर खोजने के लिए और जीनोम चौड़ा अगली पीढ़ी अनुक्रमण बाहर ले जाने के क्रम में है मार्कर प्रभाव को देखने के लिए किया जाएगा । इसलिए, एक विशिष्ट फ्लोरोसेंट मार्कर का उपयोग करते हुए ट्रैकिंग रिपोर्टर के रूप में जीन टैग भविष्य अनुसंधान योजनाओं में एक महत्वपूर्ण उपकरण बन जाएगा ।

Enhancers प्रमोटर समारोह और जीन अभिव्यक्ति के नियमन में महत्वपूर्ण भूमिकाओं के एक भीड़ खेलते हैं । हालांकि, यह भी एक स्थिति और उंमुखीकरण स्वतंत्र तरीके से लंबी दूरी से प्रमोटर गतिविधि को सक्रिय कर सकते हैं, और enhancers अक्सर एक ट्रांस ओरिएंटेशन में जीन अभिव्यक्ति को विनियमित । इस प्रकार, यह विशिष्ट जीन के लिए बढ़ाने के (नों) तुच्छ, विशेष रूप से बाद जीनोमिक युग में, चुनौतीपूर्ण है । पारंपरिक रिपोर्टर assays और सहसंबंधी कार्यात्मक विश्लेषण (जैसे, क्रोमेटिन immunopरेसिपिटेशन और dnasei अति संवेदनशील assays) बढ़ाने के समारोह३२,३३की जांच करने के लिए इस्तेमाल किया गया है । इसी प्रकार, छोटे आकार के लोकस केंद्रित प्रदर्शन भी विशिष्ट जीन३४के लिए बाहर और समीपस्थित नियामक तत्वों की गतिविधियों का पता लगाने के लिए लागू किया गया । हाल ही में, परित sgrna-को पुस्तकालय रणनीति है कि लक्ष्य गैर hox जीन loci में नियामक तत्वों कोडिंग सफलतापूर्वक HOXA7 और HOXA9 जीन के बीच स्थित एक ctcf बाध्यकारी साइट की पहचान की, साथ ही साथ एक hottip lncrna कि पीछे hoxa क्रोमेटिन डोमेन संगठन है, जो तीव्र माइलॉयड ल्यूकेमिया (एएमएल)12में अस्थानिक hoxa जीन अभिव्यक्ति ड्राइव को नियंत्रित करने के लिए महत्वपूर्ण है । इन अध्ययनों से पता था कि परित sgRNA को पुस्तकालय स्क्रीनिंग भी एक शक्तिशाली आनुवंशिकी दृष्टिकोण की पहचान करने और गैर के जैविक समारोह का मूल्यांकन-सीटू में हमारे जीनोम में तत्वों कोडिंग है ।

एक क्रोमेटिन इन्सुलेटर प्रोटीन के रूप में, ctcf विशिष्ट कोशिका प्रकार में विशिष्ट जीन अभिव्यक्ति पैटर्न के लिए क्रोमेटिन पड़ोस परिभाषित द्वारा जीनोम संगठन में एक महत्वपूर्ण भूमिका निभाता है11,३५. सांस्थितिकत: संबद्ध डोमेन (बालक) संरचना में परिवर्तन enhancer/प्रमोटर इंटरैक्शन को बदलता है, जिसके परिणामस्वरूप रोगग्रस्त अवस्था5,11होती है । CTCF मेटाजोआन में अत्यधिक संरक्षित है और बालक सीमाओं पर समृद्ध है । हालांकि, यह अस्पष्ट है कि क्या और कैसे ctcf क्रोमेटिन सीमा संरचना और बालक के गठन को बनाए रखने में योगदान देता है । हालांकि परित ctcf sgrna-पीटा पुस्तकालय स्क्रीनिंग चार hox loci पर ध्यान केंद्रित किया गया था, यह एक शक्तिशाली तरीका की पहचान करने और ctcf सीमाओं काटना साबित हुआ, और बालक डोमेन के रूप में अच्छी तरह से बढ़ाने के रूप में परिभाषित/ बालक डोमेन12. इसके अतिरिक्त, इस विधि कुशलता से lncrna तत्वों और प्रतिलेखन कारकों है कि मध्यस्थता की पहचान करने के लिए लागू किया जा सकता है क्रोमेटिन रचना और hox loci में पहुंच गतिविधि । हम भविष्य में अनुसंधान में सीटीसीएफ चिप-सीईक्यू और चिया-पीईटी आंकड़ों के अनुसार अगली पीढ़ी की पहचान के माध्यम से जीनोम-वाइड सीटीसीएफ साइटों से युक्त CRISPR/sgRNA पुस्तकालय का पता लगाने की भी कोशिश कर रहे हैं । इस प्रकार, इस रणनीति को एक पूरे गुणसूत्र या यहां तक कि पूरे जीनोम को बढ़ाया जा सकता है ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

हमारे पास इस रिपोर्ट से संबंधित हितों का कोई टकराव नहीं है ।

Acknowledgments

लेखक भी पांडुलिपि संपादन के लिए निकोलस Cesari धंयवाद । इस कार्य के लिए राष्ट्रीय स्वास्थ्य संस्थान (एसएच, R01DK110108, R01CA204044) से अनुदान का समर्थन किया गया था ।

Materials

Name Company Catalog Number Comments
Lipofectamine 3000 reagent Thermo Fisher Scientific L3000-008
Proteinase K Thermo Fisher Scientific 25530049
Puromycin Thermo Fisher Scientific A1113802
Stbl3 cells  Life Technologies  C737303
HEK293T ATCC CRL-3216
MOLM-13 DSMZ ACC 554
lentiCRISPRv2 Addgene 52961
pMD2.G Addgene 12259
psPAX2 Addgene 12260
pGEM®-T Easy Vector Systems  Promega A137A
T4 ligase  New England Biolabs  M0202S
QIAquick Gel Extract kit QIAGEN 28706
QIAuick PCR purification kit QIAGEN 28106
SingleShot™ SYBR® Green One-Step Kit Bio-Rad Laboratories 1725095
QIAGEN Plasmid Maxi Kit QIAGEN 12163
Dulbecco’s Modified Eagle Medium  Thermo Fisher Scientific  11965084
RPMI 1640  Thermo Fisher Scientific 11875093
Fetal bovine serum (FBS)  Thermo Fisher Scientific 10-082-147
Penicillin/streptomycin/L-glutamine  Life Technologies  10378016
Lenti-X Concentrator  Clontech 631232
Trypan Blue Solution Thermo Fisher Scientific 15250061
Polybrene Santa Cruz Biotechnology sc-134220
Phosphate Buffered Saline (PBS)  Genessee Scientific  25-507
TAE buffer  Thermo Fisher Scientific  FERB49
Surveyor® Mutation Detection Kits Integrated DNA Technologies 706020
Biorad Universal Hood II Gel Doc System Bio-Rad 170-8126
Centrifuge 5424 R Eppendorf 5404000138
Digital Dry Baths/Block Heaters Thermo Fisher Scientific 88870002
TSX Series Ultra-Low Freezers Thermo Fisher Scientific TSX40086V
Forma™ Steri-Cult™ CO2 Incubators Thermo Fisher Scientific 3308
Herasafe™ KS, Class II Biological Safety Cabinet Thermo Fisher Scientific 51022484
Sorvall™ Legend™ XT/XF Centrifuge Series Thermo Fisher Scientific 75004506
Fisherbrand™ Isotemp™ Water Baths Thermo Fisher Scientific FSGPD02
Thermo Scientific™ Locator™ Plus Rack and Box Systems Thermo Fisher Scientific 13-762-353
CFX96 Touch Real-Time PCR Detection System Bio-Rad 1855195
MiniAmp™ Thermal Cycler Applied Biosystems technology A37834
Thermo Scientific™ Owl™ EC300XL2 Compact Power Supply Thermo Fisher Scientific 7217581
Thermo Scientific™ Owl™ EasyCast™ B1 Mini Gel Electrophoresis Systems Thermo Fisher Scientific 09-528-178
VWR® Tube Rotator and Rotisseries VWR International 10136-084
VWR® Incubating Mini Shaker VWR International 12620-942
Analytical Balance MS104TS/00 METTLER TOLEDO 30133522
DS-11 FX and DS-11 FX+ Spectrophotometer DeNovix Inc. DS-11 FX

DOWNLOAD MATERIALS LIST

References

  1. Dixon, J. R., et al. Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature. 485, (7398), 376-380 (2012).
  2. Cuddapah, S., et al. Global analysis of the insulator binding protein CTCF in chromatin barrier regions reveals demarcation of active and repressive domains. Genome research. 19, (1), 24-32 (2009).
  3. Phillips, J. E., Corces, V. G. CTCF: master weaver of the genome. Cell. 137, (7), 1194-1211 (2009).
  4. Tang, Z., et al. CTCF-Mediated Human 3D Genome Architecture Reveals Chromatin Topology for Transcription. Cell. 163, (7), 1611-1627 (2015).
  5. Lupianez, D. G., et al. Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions. Cell. 161, (5), 1012-1025 (2015).
  6. Dowen, J. M., et al. Control of cell identity genes occurs in insulated neighborhoods in mammalian chromosomes. Cell. 159, (2), 374-387 (2014).
  7. Phillips-Cremins, J. E., et al. Architectural protein subclasses shape 3D organization of genomes during lineage commitment. Cell. 153, (6), 1281-1295 (2013).
  8. Narendra, V., Bulajic, M., Dekker, J., Mazzoni, E. O., Reinberg, D. CTCF-mediated topological boundaries during development foster appropriate gene regulation. Genes & Development. 30, (24), 2657-2662 (2016).
  9. Narendra, V., et al. CTCF establishes discrete functional chromatin domains at the Hox clusters during differentiation. Science. 347, (6225), 1017-1021 (2015).
  10. Deng, C., et al. HoxBlinc RNA Recruits Set1/MLL Complexes to Activate Hox Gene Expression Patterns and Mesoderm Lineage Development. Cell Reports. 14, (1), 103-114 (2016).
  11. Patel, B., et al. Aberrant TAL1 activation is mediated by an interchromosomal interaction in human T-cell acute lymphoblastic leukemia. Leukemia. 28, (2), 349-361 (2014).
  12. Luo, H., et al. CTCF boundary remodels chromatin domain and drives aberrant HOX gene transcription in acute myeloid leukemia. Blood. 132, (8), 837-848 (2018).
  13. Dou, D. R., et al. Medial HOXA genes demarcate haematopoietic stem cell fate during human development. Nature Cell Biology. 18, (6), 595-606 (2016).
  14. Lawrence, H. J., et al. Loss of expression of the Hoxa-9 homeobox gene impairs the proliferation and repopulating ability of hematopoietic stem cells. Blood. 106, (12), 3988-3994 (2005).
  15. Deng, C., et al. USF1 and hSET1A mediated epigenetic modifications regulate lineage differentiation and HoxB4 transcription. PLOS Genetics. 9, (6), e1003524 (2013).
  16. Rawat, V. P., Humphries, R. K., Buske, C. Beyond Hox: the role of ParaHox genes in normal and malignant hematopoiesis. Blood. 120, (3), 519-527 (2012).
  17. Alharbi, R. A., Pettengell, R., Pandha, H. S., Morgan, R. The role of HOX genes in normal hematopoiesis and acute leukemia. Leukemia. 27, (5), 1000-1008 (2013).
  18. Rice, K. L., Licht, J. D. HOX deregulation in acute myeloid leukemia. Journal of Clinical Investigation. 117, (4), 865-868 (2007).
  19. Bassett, A. R., Kong, L., Liu, J. L. A genome-wide CRISPR library for high-throughput genetic screening in Drosophila cells. Journal of Genetics and Genomics. 42, (6), 301-309 (2015).
  20. Zhu, S., et al. Genome-scale deletion screening of human long non-coding RNAs using a paired-guide RNA CRISPR-Cas9 library. Nature Biotechnology. 34, (12), 1279-1286 (2016).
  21. Kurata, J. S., Lin, R. J. MicroRNA-focused CRISPR-Cas9 library screen reveals fitness-associated miRNAs. RNA. 24, (7), 966-981 (2018).
  22. Collins, C. T., Hess, J. L. Role of HOXA9 in leukemia: dysregulation, cofactors and essential targets. Oncogene. 35, (9), 1090-1098 (2016).
  23. Kroon, E., Thorsteinsdottir, U., Mayotte, N., Nakamura, T., Sauvageau, G. NUP98-HOXA9 expression in hemopoietic stem cells induces chronic and acute myeloid leukemias in mice. The EMBO Journal. 20, (3), 350-361 (2001).
  24. Koike-Yusa, H., Li, Y., Tan, E. P., Velasco-Herrera Mdel, C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nature Biotechnology. 32, (3), 267-273 (2014).
  25. Shalem, O., et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 343, (6166), 84-87 (2014).
  26. Wang, T., Wei, J. J., Sabatini, D. M., Lander, E. S. Genetic screens in human cells using the CRISPR-Cas9 system. Science. 343, (6166), 80-84 (2014).
  27. Zhou, J., et al. Dual sgRNAs facilitate CRISPR/Cas9-mediated mouse genome targeting. The FEBS Journal. 281, (7), 1717-1725 (2014).
  28. Sanjana, N. E., et al. High-resolution interrogation of functional elements in the noncoding genome. Science. 353, (6307), 1545-1549 (2016).
  29. Rajagopal, N., et al. High-throughput mapping of regulatory DNA. Nature Biotechnology. 34, (2), 167-174 (2016).
  30. Korkmaz, G., et al. Functional genetic screens for enhancer elements in the human genome using CRISPR-Cas9. Nature Biotechnology. 34, (2), 192-198 (2016).
  31. Rezaei, N., et al. FMS-Like Tyrosine Kinase 3 (FLT3) and Nucleophosmin 1 (NPM1) in Iranian Adult Acute Myeloid Leukemia Patients with Normal Karyotypes: Mutation Status and Clinical and Laboratory Characteristics. Turkish Journal of Haematology. 34, (4), 300-306 (2017).
  32. Yaragatti, M., Basilico, C., Dailey, L. Identification of active transcriptional regulatory modules by the functional assay of DNA from nucleosome-free regions. Genome Research. 18, (6), 930-938 (2008).
  33. Wilken, M. S., et al. DNase I hypersensitivity analysis of the mouse brain and retina identifies region-specific regulatory elements. Epigenetics Chromatin. 8, 8 (2015).
  34. Narlikar, L., Ovcharenko, I. Identifying regulatory elements in eukaryotic genomes. Briefings in Functional Genomics and Proteomics. 8, (4), 215-230 (2009).
  35. Hnisz, D., et al. Activation of proto-oncogenes by disruption of chromosome neighborhoods. Science. 351, (6280), 1454-1458 (2016).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics