HOX Loci Focused CRISPR/sgRNA biblioteca rastreio identificando crítico CTCF limites

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Uma biblioteca CRISPR/sgRNA aplicou-se para interrogar os genes codificantes de proteínas. No entanto, a viabilidade de uma biblioteca de sgRNA para descobrir a função de um limite CTCF na regulação gênica permanece inexplorada. Aqui, descrevemos uma biblioteca de sgRNA específico de loci HOX para elucidar a função dos limites CTCF HOX loci.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Luo, H., Sobh, A., Vulpe, C. D., Brewer, E., Dovat, S., Qiu, Y., Huang, S. HOX Loci Focused CRISPR/sgRNA Library Screening Identifying Critical CTCF Boundaries. J. Vis. Exp. (145), e59382, doi:10.3791/59382 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

CCCTC-fator obrigatório (CTCF)-mediada estável topologicamente associando domínios (TADs) desempenham um papel crítico na restrição de interações de elementos de DNA que estão localizados na vizinha TADs. CTCF desempenha um papel importante na regulação da expressão espacial e temporal de genes HOX que controlam o desenvolvimento embrionário, modelação do corpo, hematopoiese e leukemogenesis. No entanto, permanece em grande parte desconhecido se e como HOX loci associados CTCF limites regulam a organização da cromatina e expressão dos genes HOX . No actual protocolo, foi gerada uma biblioteca em pool específico sgRNA todos os sítios de ligação CTCF os loci HOXA/B/C/D para examinar os efeitos da rompendo limites de cromatina CTCF-associado em formação TAD e gene Homeótico expressão. Através de CRISPR-Cas9 rastreio genético, o sítio de ligação do CTCF localizado entre genes HOXA7/HOXA9 (CBS7/9) foi identificado como um regulador crítico do domínio de cromatina oncogênica, bem como sendo importantes para a manutenção de uma gravidez ectópica gene HOX padrões de expressão em MLL-rearranjou a leucemia mieloide aguda (LMA). Assim, esta biblioteca sgRNA triagem abordagem fornece novos insights sobre organização de genoma CTCF mediada loci de genes específicos e também fornece uma base para a caracterização funcional dos elementos normativos genéticas anotados, ambos de codificação e não-codificante, durante processos biológicos normais na época do projeto genoma pós humano.

Introduction

Recentes estudos de interacção do genoma revelaram que os formulários do genoma nuclear humano estável domínios topologicamente associados (TADs) que são conservados entre as espécies e tipos de células. A organização do genoma em domínios separados facilita e restringe as interações entre elementos reguladores (por exemplo, potenciadores e promotores). O fator de ligação CCCTC (CTCF) liga-se aos limites do TAD e desempenha um papel crítico na restrição de interações de elementos de DNA que estão localizados na vizinha TADs1. Dados de vinculação CTCF amplo do genoma revelaram, no entanto, que embora CTCF principalmente interage com os mesmos DNA-sites em diferentes tipos de células, muitas vezes funciona como uma barreira de cromatina em um site específico no tipo de uma célula, mas não na outra, sugerindo que funções do CTCF juntamente com outras atividades na formação de cromatina limites2. O que permanece desconhecido é se os elementos de contorno (sites de ligação CTCF) estão directamente relacionados com a função biológica do CTCF e como ocorrem esses links. Portanto, nós hypothesize que sítios específicos de ligação CTCF no genoma diretamente regulam a formação de TADs e controlam interações promotor/realçador dentro desses domínios ou entre domínios vizinhos. A conclusão dos humanos e projetos de sequenciamento do genoma do rato e subsequentes análises epigenéticas ter descoberto novas assinaturas genéticas e moleculares do genoma. No entanto, o papel de assinaturas/modificações específicas na regulação gênica e função celular, bem como seu mecanismo molecular (s), ainda tem que ser completamente compreendido.

Várias linhas de evidência suportam que o TADs CTCF-mediada representam cromatina funcional domínios3,4,5. Embora CTCF principalmente interage com os mesmos DNA-sites em diferentes tipos de células, genoma ampla CTCF ChIP-seq dados revelaram que CTCF muitas vezes funciona como uma barreira de cromatina no tipo de uma célula, mas não em outros2. CTCF desempenha um papel essencial durante o desenvolvimento mediando genoma organização4,6,7. Rompimento de limites CTCF prejudicada interações realçador/promotor e expressão do gene, levando à obstrução do desenvolvimento. Isto sugere que a CTCF mediada TADs não são apenas componentes estruturais, mas também unidades regulamentares necessárias para o adequado potenciador ação e gene transcrição5,8,9.

Genes HOX desempenham papéis críticos durante o desenvolvimento embrionário, e eles são temporalmente e espacialmente restritas em seus padrões de expressão. O locus HOXA forma dois TADs estáveis separando genes anteriores e posteriores por um elemento de limite CTCF-associado em hESCs e IMR90 as células1. Relatórios recentes demonstraram que o HoxBlinc, um lncRNA de locus associado HoxB , Medeia a formação do CTCF dirigido Tad e interações realçador/promotor no locus HOXB . Isto leva à ativação do gene HOXB anterior durante ESC compromisso e diferenciação10. Além disso, em loci de genes específicos incluindo o locus HOXA , alteração do CTCF mediada TAD domínios mudados linhagem perfis de expressão de genes específicos e foi associada com o desenvolvimento da doença Estados11,12. A evidência suporta uma função primária para CTCF na coordenação da transcrição do gene e determinar a identidade da célula organizando o genoma em domínios funcionais.

Apesar de seu papel no desenvolvimento embrionário, durante a hematopoiese, genes HOX regulam a função de célula (HS/PC) de haste e progenitoras hematopoiética. Isso é feito controlando o equilíbrio entre a proliferação e diferenciação de10,13,14,15. A expressão dos genes HOX é fortemente regulamentada em toda a especificação e a diferenciação das células hematopoiéticas, com maior expressão em HS / PCs. HOX expressao diminui gradualmente durante o amadurecimento, com seus níveis mais baixos ocorrendo em diferenciados de células hematopoiéticas16. Desregulagem do gene HOX é um mecanismo dominante das transformações leucêmicas por propriedades de auto-renovação e diferenciação de dysregulating levando a transformação leucêmicas17,18HS/PCs. No entanto, o mecanismo de estabelecimento e manutenção normal vs padrões de expressão oncogênica de genes HOX , bem como redes de regulação associadas permanece obscuro.

Rastreio de biblioteca CRISPR-Cas9 sgRNA tem sido amplamente utilizado para interrogar de genes codificantes de proteínas19 como genes bem como não-codificantes, como20 e miRNA lncRNA21 em diferentes espécies. No entanto, o custo para usar a biblioteca de sgRNA CRISPR-Cas9 para identificar novos alvos genômicos permanece elevado, porque o sequenciamento do genoma do elevado-throughput é muitas vezes aplicado para verificar o rastreio de biblioteca de sgRNA. Nosso sistema de rastreio de sgRNA está focada em locus específico do genoma e avalia o direcionamento sgRNAs através de uma etapa de RT-PCR de acordo com a expressão de gene marcador, como HOXA9. Além disso, Sanger sequenciamento confirmou que o sgRNA foi integrado no genoma e mutações Indel pode ser detectado para identificar o sgRNA segmentação local. Através do rastreio genético do CRISPR-Cas9 locus específico, o limite de cromatina de CBS7/9 foi identificado como um regulador fundamental para estabelecer o domínio de cromatina oncogênicos e manter padrões de expressão de gene HOX ectópica na patogênese da LMA 12. o método pode ser amplamente aplicado para identificar não somente a função específica de limite CTCF no desenvolvimento embrionário, a hematopoiese, leukemogenesis, mas também limite CTCF como alvos terapêuticos para futura terapia epigenética.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. CTCF sgRNALibrary projeto usando uma ferramenta on-line

  1. Desenha o sgRNA sítios de ligação CTCF os loci de HOX humano usando a ferramenta de designer perturbação genética plataforma (GPP) (https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design).
  2. Sintetiza um total de 1.070 sgRNAs consistindo de sgRNAs visando 303 genes alvos aleatórios, 60 controles positivos, 500 controles não-humanos-direcionamento e 207 elementos CTCF ou lncRNA alvejando genes (Figura 1, tabela 1). Cada elemento de DNA alvo é alvo de diferentes sgRNAs de 5-10.

2. sgRNA biblioteca clonagem

  1. Clone os oligonucleotides sintetizados para o vetor de Lentivirus espinha dorsal CRISPR (lentiCRISPRv2).
    1. Digeri o vetor de LentiCRISPRv2 com a enzima de restrição BsmBI a 37 ° C por 2 h.
    2. Procure a presença da maior banda (cerca 12.873 bp) sobre o gel após a digestão de BsmBI e purificá-la em seguida com o kit de extração do gel.
      Nota: Um pedaço de pequeno enchimento kb 2 também está presente no gel após a digestão, mas isso deve ser ignorado.
    3. Ligam os oligonucleotides sintetizados e digerido LentiCRISPR vector com 150 ng de digerido LentiCRISPR DNA, 1 µ l de 10 µM oligos, 2 µ l de tampão de ligase x T4 10, 1 µ l de T4 ligase e incube-os a 16 ° C durante a noite.
  2. Transforme a Lentivirus CRISPR/sgRNA biblioteca em células electro-competente para amplificação.
    1. Preparar o electroporator em 1.8 kV, 200 Ω e 25 µF. Em seguida, pré-aquecer a recuperação de mídia SOC em banho maria a 37 ° C e pré-aquecer LB placas de antibiótico ampicilina a 37 ° C.
    2. Descongele as células competentes no gelo por 10 min.
    3. Prepare os tubos de microcentrífuga de 1,5 mL e 1 mm cubetas de eletroporação no gelo.
    4. Misture 1 µ l de um 10 ng / µ l biblioteca plasmídeo em 25 μL de células competentes em um tubo de microcentrífuga de 1,5 mL e misture suavemente por agredir o fundo do tubo algumas vezes manualmente.
    5. Uma vez que a cubeta é bastante fria, transfira a mistura de célula DNA/competente para isso. Toque duas vezes na bancada e limpe qualquer gotículas de água do exterior da cubeta com um papel absorvente. Depois, coloque a cubeta no módulo electroporation e pressione o pulso.
    6. Imediatamente adicione 975 µ l de 37 ° C pré-aquecido SOC media. Mix por pipetagem para cima e para baixo e transferir para um tubo de 15 mL.
    7. Girar e incubar a 37 ° C, durante 1 h.
    8. Diluir 100 células µ l em 900 µ l da mídia SOC... e coloque uma placa de ágar antibiótico ampicilina LB 100 µ l. Incubar durante uma noite a 37 ° C.
  3. Extrai o DNA do plasmídeo de colônias combinadas usando uma coluna maxi-prep, conforme detalhado no protocolo do fabricante.
    1. Raspar todas as colónias da placa de ágar LB e inocular uma cultura de acionador de partida de 2 mL de meio de antibiótico ampicilina LB e incubar durante uma noite a 37 ° C, com agitação vigorosa (~ 200 x g).
    2. Diluir a 1: 500 a cultura starter em 100 mL de meio de ampicilina LB e incubar a 37 ° C, durante 12-16 h com agitação vigorosa (~ 200 x g).
    3. Colher o sedimento de célula bacteriana por centrifugação a 6.000 x g durante 15 min a 4 ° C.
    4. Ressuspender o pellet bacteriano em 10 mL de tampão de suspensão.
    5. Lyse o sedimento suspenso com 10 mL de tampão de Lise e vigorosamente inverter 4 - 6 vezes. Incube o lisado por 5 min à temperatura ambiente.
    6. Neutralize o lisado com 10 mL de tampão de neutralização refrigerados. Misture por inversão suavemente os tubos de 4 - 6 vezes e incube-lo por 20 min no gelo.
    7. Spin para baixo a 13.500 x g durante 30 min a 4 ° C. Prontamente, transferi o sobrenadante contendo o plasmídeo de DNA para um novo tubo.
    8. Repita a etapa 2.3.7 e prontamente transferir o sobrenadante contendo o plasmídeo de DNA para um novo tubo.
    9. Equilibrar a coluna aplicando-se 10 mL de tampão de equilíbrio e permita que a coluna vazia pelo fluxo de gravidade.
    10. Adicionar o sobrenadante para a coluna e deixe-o entrar a resina pelo fluxo de gravidade.
    11. Lave a coluna com 2 x 30 mL de tampão de lavagem.
    12. Eluir o DNA com 15 mL de tampão de eluição.
    13. Precipitar o DNA com 10,5 mL de isopropanol temperatura ao DNA eluted. Mix e spin para baixo imediatamente a 15.000 x g durante 30 min a 4 ° C e suavemente, decante o sobrenadante.
    14. Lavar o sedimento de DNA com 5 mL de etanol a 70%, pelota do ADN de centrifugação a 15.000 x g por 10 min e descartar o sobrenadante claro.
    15. Repita a etapa 2.5.14 mais duas vezes.
    16. Centrifugar a pelota do ADN em 15.000 x g durante 10 minutos e suavemente, decante o sobrenadante sem perturbar o sedimento de DNA.
    17. Secar ao ar livre a pelota por 5-10 min e dissolver o DNA em um volume necessário de buffer (buffer de TE, pH 8.0).

3. a alta Titer sgRNA geração de Lentivirus de biblioteca

  1. Preparação de células: células de cultura HEK293T em de Dulbecco modificado águia médio (DMEM) suplementado com 10% (vol/vol) de soro fetal bovino (FBS) e antibiótico penicilina de 1% (vol/vol)-estreptomicina (PS) em frascos de T-25. Colocá-los na incubadora a 37 ° C e 5% de CO2.
  2. Pacote de lentivirus: co transfect HEK293T células com 20 µ g de vetores de biblioteca purificado da etapa 2, 15 µ g do plasmídeo de pacote (psPAX2) e 10 µ g do plasmídeo de envelope (pMD2.G) para 48 h antes da colheita os vírus.
  3. Coleção de vírus: após 48 h, vírus de recebero sobrenadante e filtrar o sobrenadante através de uma membrana PVDF de ligação de baixa proteína de 0,45 µm de vírus.
  4. Concentração de vírus: concentrar-se o sobrenadante Lentivirus 50-fold usando o concentrador e testar o vírus MOI na etapa 5.
  5. Armazenamento de vírus: o concentrado de alíquota vírus e guarde no congelador a-80 ° C.

4. otimizado puromicina concentração

  1. Cultura de células de leucemia: células de cultura MOLM13 AML em RPMI 1640 suplementado com 10% (vol/vol) de soro fetal bovino (FBS) e 1 x antibióticos penicilina-estreptomicina (PS) num balão de T-125. Coloque-os em uma incubadora a 37 ° C e 5% de CO2.
    Nota: As células normalmente são passadas a cada 4-5 d em um split ratio de 1:4 ou 1:6, nunca permitindo que as células alcançar mais de 70% confluência.
  2. Configure MOLM13 células em uma placa de 12 com uma densidade de 1,0 x 104 células/mL, em um volume total de 2 mL por bem (2.0 x 104 células).
  3. Ensaio de tempo-curso: células MOLM13 tratar com puromicina durante 7 dias em aumentar as concentrações (0,1 µ g/mL, 0,2 µ g/mL, 0,5 µ g/mL, 1,0 µ g/mL e 2,0 µ g/mL)
    1. Configurar MOLM13 células sem puromicina no dia 0 e configurar 3 poços replicar sem puromicina como um controle do dia 0 ao dia 7.
    2. Trate MOLM13 células com 0,1 µ g/mL, 0,2 µ g/mL, 0,5 µ g/mL, 1,0 µ g/mL e 2,0 µ g/mL, separadamente, com cada condição experimental contendo 3 poços de replicar.
    3. Conta a proporção de células vivas e fazer uma curva de sobrevivência do dia 0 ao dia 7, contendo todas as condições.
  4. Curva de sobrevivência: colorir células com Trypan azul e contagem de viabilidade diariamente para obter as curvas de sobrevivência para cada concentração de puromicina.
  5. Otimizando a concentração mínima de puromicina: determinar a concentração mínima de puromicina através de coloração de azul de Tripan, no qual MOLM13 todas as células são mortas entre 5-7 dias.

5. titulação de Lentivirus biblioteca em células de leucemia MOLM13

  1. AML células preparação: coletar células da LMA MOLM13 com o meio de transdução (RPMI 1640, 10% FBS, PS 1% e médio de revestimento 8,0 µ g/mL) em uma densidade de 1,5 x 106 células /mL.
  2. Células MOLM13 lugar na placa de 12 com 1,5 x 106 células em cada poço.
  3. Descongelar o lentivirus: Retire o lentivirus concentrada do freezer-80 ° C e derretê-lo no gelo.
  4. MOLM13 mistura de células com uma dose diferente do lentivirus concentrada em poços separados, incluindo 0, 1, 2,5, 5, 7,5 e 10 µ l (totais 6 grupos).
  5. Imediatamente Centrifugue estas misturas a 1.000 x g durante 2 h a 33 ° C e transferir as placas 12-poços para a incubadora a 37 ° C e 5% de CO2 para 4 h.
  6. Após 4 h, spin para baixo as células infectadas a 400 x g durante 5 min à temperatura ambiente.
  7. Delicadamente aspirar o sobrenadante sem perturbar o centrifugado, re-suspender as células transduzidas com mídia fresca (RPMI 1640, PS FBS e 1% de 10%) e transferi-los para frascos de T-25 e incubar a 37 ° C, durante 48 h sem puromicina.
  8. Após 48 h, dividir estas células em 2 frascos (2 grupos): um grupo experimental tratado com 1 puromicina µ g/mL por 5 dias e um grupo controle sem puromicina durante 5 dias.
  9. Realize puromicina durante 5 dias com 1 puromicina µ g/mL de acordo com o passo 4 até que todas as células não transfectadas controle estão mortas. Troca de mídia fresca cada 2 dias.
  10. Medir o valor MOI otimizado para transdução, dividindo o número de células vivas, tratados com puromicina com o número de células sem puromicina.

6. transdução da biblioteca KO em pool CRISPR-Cas9

  1. Transdução com lentivirus: infectar 1.5 x 106 MOLM13 células com 0,3 MOI de lentivirus sgRNA pool no meio (RPMI 1640, 10% FBS, PS 1% e 8 µ g/mL de meio de revestimento) na placa de 6 e usar as células sem a infecção de lentivirus como um controle.
  2. Imediatamente Centrifugue a placa de 6 a 1.000 x g durante 2 h a 33 ° C, para spinfect as células e transferir as placas para a incubadora a 37 ° C e 5% de CO2 para 4 h.
  3. Gire para baixo as células infectadas a 400 x g durante 5 min à temperatura ambiente.
  4. Delicadamente Aspire o sobrenadante sem perturbar o centrifugado, re-suspender as células transduzidas com mídia fresca (RPMI 1640, PS FBS e 1% de 10%) e transferi-los para frascos de T-25 e incubar a 37 ° C, durante 48 h sem puromicina.
  5. Após 48 h, trate as células com 1 puromicina µ g/mL por 5 dias. Troca de mídia fresca depois de 2 dias e manter-se em uma densidade de célula ideal.
  6. Propagar o único clone em placas de 96 poços, com limitação de métodos de diluição e incubar estes clones único a 37 ° C e 5% de CO2. Cultura-los por 3-4 semanas.
  7. Depois de uma única célula cresce em uma população, transfira metade das células em placas de 24 boas para ainda mais cultura sob puromicina e verifique se estes clones na próxima etapa. Com o resto das células.

7. a despistagem da biblioteca de KO CRISPR-Cas9 em pool com uma etapa RT-qPCR

  1. Determine a eficácia do clone integrado sgRNA triagem por avaliar a expressão do gene marcador HOXA9 com um passo transcriptase reversa cadeia da polimerase (RT-qPCR uma etapa).
    Nota: HOXA9 são altamente expressa em células MOLM13 AML em leukemogenesis22,23.
  2. Contagem de sgRNA integrada MOLM13 célula e transferência 1 x 104 células por poço em uma chapa de PCR de 96 poços.
  3. Centrifugar o tubo a 1.000 x g por 5 min e então cuidadosamente remover e descartar o sobrenadante com uma pipeta sem perturbar o centrifugado.
  4. Lavam-se células com 125 µ l de tampão PBS e centrifugar o tubo a 1.000 x g por 5 min. Então 120 µ l do sobrenadante com uma pipeta de remover e reter cerca de 5 µ l de PBS em cada poço.
  5. Adicione 50 µ l da célula lise mestre mistura contendo 48 µ l de tampão de lise celular, 1 µ l de solução de proteinase K (10 mg/mL) e 1 µ l de solução de DNase (1 mg/mL) a cada poço. Em seguida, pipeta e descer 5 vezes para re-suspender o centrifugado.
  6. Incubar a mistura durante 10 minutos à temperatura ambiente, seguido por 5 min a 37 ° C e em seguida de 75 ° C por 5 min.
  7. Armazene o lisado celular no congelador-80 ° C.
  8. A preparação da reação de RT-qPCR uma etapa: descongelar a mistura de reação de uma etapa e outros componentes de reação de 4 ° C. Em seguida spin para baixo brevemente para coletar soluções na parte inferior dos tubos e colocar no gelo sem luz. Misture e girar suavemente.
  9. Adicionar 1 µ l de lisado celular nos poços PCR com a mistura de reação de RT-qPCR, incluindo 1 µ l de primer para a frente do gene marcador (300 nM) e inverter a primeira demão (300 nM), 0.125 µ l de transcriptase reversa (10 U / µ l) e 5 µ l da mistura de reação de uma etapa (2x).
  10. Selar poços com película opticamente transparente e suavemente vórtice e misturar os componentes da reação.
  11. Coloque a placa PCR de 96 poços em um instrumento PCR em tempo real.
  12. Executar a reação de transcrição reversa para 10 min a 50 ° C, seguido de inactivação de polimerase e desnaturação do ADN por 1 min a 95 ° C.
  13. Executar o RT-PCR com 40 ciclos de reação de PCR: desnaturação por 15 s em fluorescência de 95 ° C, recozimento/extensão e placa lendo por 20 s em 60 ° C e então análise de curva de derretimento 65-95 ° c através de incrementos de 0,5 ° C em 2-5 s/etapa.
  14. Configure upregulated, ativador e nenhum grupo de mudança de acordo com os níveis de expressão do gene HOXA9 em comparação ao controle, separadamente. Use o gene β-actina como um controle do gene das tarefas domésticas.

8. verificação da sgRNAs integrada Clones positivos através da genotipagem e sequência de Sanger

  1. Verifique se os clones de expressão HOXA9 diminuída através de Sanger sequenciamento e realizar PCR com 50-100 genoma de ng MOLM13 DNA, 5 µ l do polymerase amortecedor da reação (10x), 1 µ l para a frente da primeira demão (10 µM) (AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG) e 1 µ l reverso primeira demão (10 µM) (TCTACTATTCTTTCCCCTGCACTGTTGTGGGCGATGTGCGCTCTG), 1 µ l do dNTP (10mM), polymerase de 1 unidade (5 U /µL). Realizar a reação de PCR com a desnaturação inicial a 94 ° C por 30 s e em seguida mais desnaturação a 94 ° C, durante 20 s, recozimento a 56 ° C durante 20 s, extensão a 68 ° C, durante 20 s (total 30 ciclos), uma extensão final a 68 ° C por 10 min e em seguida, segurando a 4 ° C.
  2. Extrair e purificar os produtos PCR (bp tamanho 285) com um Kit de purificação de PCR.
  3. Ligam os produtos PCR purificados para o vetor T com 2 µ l T4 ligadura buffer (10x), 50 ng T vector DNA (50 ng / µ l), 25 ng purificado PCR DNA (285 bp), ligase do T4 de 1 µ l (3 unidades / µ l) e lugar a ligadura se misturam em uma incubadora a 16 ° C durante a noite.
  4. Transferir a mistura de ligadura em células competentes DH5α, crescer em uma placa de ágar antibiótico ampicilina LB e incubar durante uma noite a 37 ° C.
  5. Escolha os único clones da placa LB e verificá-los por genotipagem e Sanger sequenciamento.

9. detecção de sgRNAs mutação de Indel induzida por Nuclease digestão ensaio

  1. Detecta que o sgRNA integrado único clone induzido Indel taxas por um ensaio de teste de nuclease.
  2. Separadamente, preparar PCR amplicons com 50-100 ng Indel mutante (teste) e DNA de tipo selvagem (WT, referência) como modelo PCR, 5 amortecedor (10x) da reação da polimerase µ l dNTP 1 µ l (10mM), 1 unidade do polymerase (5 U / µ l), primeira demão para a frente de 1 µ l (10 µM) (5'-GAGATGGCGGCGCGGAAG-3') e 1 µ L reverso da primeira demão (10 µM) (5'-AAATATAGGGCGGCTGTTCACT-3'). A reação de PCR foi realizada com a desnaturação inicial a 98 ° C por 30 s e, em seguida, desnaturação a 98 ° C, durante 20 s, recozimento a 56 ° C durante 20 s, com extensão a 72 ° C por 30 s (total 30 ciclos) e uma extensão final a 72 ° C por 10 min e segurando a 4 ° C.
  3. Configurar o grupo de mistura doheteroduplex com 200 ng a "referência" (20 ng / µ l) e 200 ng de "teste" (20 ng / µ l) PCR amplicons no tubo de 0,2 mL do PCR e o grupo de mistura homoduplex com apenas 400 ng de "referência" PCR amplicons como um controle.
  4. Separadamente, incube a mistura doheteroduplex e homoduplex a 95 ° C por 5 min num copo de 1 L, preenchidos com 800 mL de água e depois de arrefecer gradualmente a temperatura para recozer e formar doheteroduplex ou homoduplexes.
  5. Separadamente a digerir 400 ng da mistura doheteroduplex e homoduplex recozida com 1 µ l indel mutação deteção nuclease (2,5 U / µ l) e 2 µ l da nuclease amortecedor da reação (10x) a 42 ° C por 60 min.
  6. Analisar as amostras digeridas com eletroforese em gel de agarose, o DNA de mistura de doheteroduplex deve ser cortado em pequenos fragmentos (bp 70-250) e o DNA do homoduplex (320 bp) não devem ser cortados.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

CRISPR-Cas9 tecnologia é uma ferramenta poderosa da pesquisa para estudos de genômicas funcionais. Ele é rapidamente substituindo o gene convencional, técnicas de edição e tem alta utilidade para aplicações de gene com foco todo o genoma e individuais. Aqui, a primeiro individualmente clonado loci específicos CRISPR-Cas9-vestiu sgRNA biblioteca contém 1.070 sgRNAs consistindo de sgRNAs visando 303 genes alvos aleatórios, 60 controles positivos, 500 controles não-humanos-direcionamento e 207 elementos CTCF ou lncRNA alvejando genes quatro loci de HOX (Figura 1, tabela 1). Esta biblioteca metas todos os motivos de vinculação de núcleo CTCF, HOX gene associado lncRNAs, conhecido dos elementos reguladores e vários genes HOX como controles positivos os loci de HOX . Ele também contém sgRNAs segmentação aleatória non -HOX genes, os genes não-humanos e regiões intergênicas como controles negativos. Para melhorar a eficiência e especificidade do CTCF site nocaute (KO), transdução de lentiCRISPR, cada site alvo contém sgRNAs de 5-10 (tabela 1). O protocolo descrito aqui, sgRNA bibliotecas são projetadas de acordo com sites de ligação CTCF no loci HOXA/B/C/D e lncRNAs estes loci, que é baseado em ferramentas de sgRNA do Broad Institute (Figura 1, Figura 2). Após transdução em uma multiplicidade de baixa da infecção com um MOI de 0,3 em células MOLM13, carregando a fusão MLL-AF9, a taxa de infecção é inferior a um sgRNA/célula seguida de puromicina, e em seguida foram os clones resistentes desenvolvidos célula única semeada projectado para diminuição da expressão do gene HOXA9 .

O fluxo de trabalho para a seleção de biblioteca sgRNA foi brevemente descrito (Figura 3). Em primeiro lugar, a biblioteca de sgRNA contendo vírus foram gerados nas células HEK293T com a ajuda de dois vetores (psPAX2 e pMD2.G). sgRNA pool biblioteca lentivírus estavam concentrados e transformados em células de LMA MOLM13 com polybrane (8,0 µ g/mL). Após uma transdução de 48 h, as células foram tratadas com a concentração ideal de puromicina. Depois de 5 dias, as células foram semeadas uma célula/bem em placas de 96 poços e os único clones foram gerados na presença de puromicina. Finalmente, sgRNA clones único integrados no genoma foram identificados por uma etapa de RT-PCR, Sanger sequenciamento e deteção de mutação Indel (Figura 3). Os clones resistentes puromicina único são identificados através de gotículas de uma etapa digital RT-qPCR (RT-ddqPCR), de acordo com alterando a expressão do oncogene HOXA9 (Figura 4). Genotipagem e sequência de Sanger foram realizadas para a construção da biblioteca sgRNA e verificação (Figura 2, Figura 4).

sgRNA MOLM13 clones positivos em uma placa PCR de 96 poços confirmaram-se ainda mais com o método de RT-qPCR baseado nosníveis de expressão de HOXA9 genes através da comparação com as células de controle de direcionamento. Fora a 528 sobrevivendo clones selecionados, 10 clones exibidas mais do que 50% de redução nos níveis de HOXA9 (Figura 4A). sgRNAs integrados a HOXA9-reduzida, HOXA9-inalterada e HOXA9-clones aumento ainda mais foram confirmados por amplificação por PCR das sequências sgRNA usando flanqueando as primeiras demão do vetor. Os produtos PCR purificados foram ligados no sistema T vetor através de T4 ligase e enviados para identificação pela sequência de Sanger (consulte a etapa 8). Os dados de sequência indicaram que fora 30 clones sequenciados, 21 clones incluíam único sgRNA (tabela 2). As categorias de sgRNA foram identificadas e analisadas de acordo com os níveis de expressão de HOXA9 . Seis dos dez clones, mostrando uma redução na HOXA9 níveis contidos sgRNAs visando o site CBS7/9, mas não nos genes não-humanos, genes humanos aleatórios e outros controles do site CTCF (Figura 4 e tabela 2).

sgRNA integrado positivo as mutações Indel induzida por clone única são determinadas pela digestão de genotipagem e nuclease baseados em PCR, com base no ensaio de nuclease (Figura 5). O ensaio de digestão de nuclease foi realizado para identificar a Indel mutações ocorreram no limite no representante HOXA9CBS7/9-reduzida, HOXA9 -inalterado, e HOXA9 -aumentou de clones. Os resultados revelaram que a mutação de CBS7/9 foi encontrada em 4 fora a 6 HOXA9-reduzida clones: clones #5, 6, 28 e 121, mas não em clones #15 e #31 (Figura 5). No entanto, clone #15 contido a sgRNA segmentação local de lncRNA HOTTIP , , enquanto clone #31 continha vários sgRNAs segmentação HOAIRM1 lncRNA, lncRNA HOTAIR e sítio de ligação do HOXD9/10 CTCF (figuras 4B, 5 e tabela 2).

Figure 1
Figura 1 : Diagrama esquemático mostrando os locais obrigatórios do CTCF e lncRNAs em quatro HOX Locus gene. Cada elemento de DNA alvo contém diferentes sgRNAs de 5-10. CTCF ChIP-seq dataset foi baixado do GEO (GSM1335528) e visualizado com visualizador de Genomic integrado (IGV). SgRNA sites de direcionamento CTCF HOX loci foram rotulados com uma tesoura de laranja. Clique aqui para ver uma versão maior desta figura. 

Figure 2
Figura 2 : Diagrama esquemático que representa a parte da integração sgRNA sequência de vetor e iniciadores de amplificação da PCR. Os iniciadores de amplificação da PCR foram projetados de acordo com a sequência em branco do vetor de Lentivirus de sgRNA. O primer para a frente (P1) foi destacado em amarelo, o primer reverso (P2) foi destacado em vermelho, e o sgRNA foi realçado em verde do vetor de Lentivirus de sgRNA. Clique aqui para ver uma versão maior desta figura. 

Figure 3
Figura 3 : Diagrama esquemático que representa o fluxo de trabalho para verificação, construção e design de biblioteca de sgRNAs. Este fluxo de trabalho é a seguinte. Em primeiro lugar, a biblioteca de sgRNA foi projetada e clonada em um vetor de Lentivirus CRISPR, e em seguida o lentivirus foi empacotado com os sgRNA biblioteca Lentivirus vector, psPAX2 e pMD2.G vetores nas células HEK293T. Em seguida, MOLM13 células foram infectadas com um vírus MOI (0.3) baixo e estas células foi submetido a puromicina. Então, o único clone foi semeado em uma placa de 96 poços. Finalmente, os clones de sgRNA único integrados em um genoma foram identificados por uma etapa RT-qPCR, deteção de mutação Indel e sequência de Sanger. Clique aqui para ver uma versão maior desta figura. 

Figure 4
Figura 4 : Em pool CRISPR-Cas9 KO biblioteca triagem identificada com uma etapa RT-qPCR e sequência de Sanger. (A), um passo RT-gota digital PCR rastreio da expressão HOXA9 no único clones infectados com lentivirus que contém a biblioteca de sgRNA. O rastreio de 528 sgRNA biblioteca infectada clones para os níveis de expressão de HOXA9 é mostrado (528 pontos). Dez de 528 clones exibidas mais de 50% de desconto em HOXA9 níveis (setas roxas). A linha vermelha significa o limite de uma mudança de 2 vezes diminuição comparando com as pilhas do controle; a linha azul indica o limite de uma mudança de aumento de 2 vezes. (B) os seis clones #5, 6, 28, 121, 207 e 420 foram alvo da sgRNA de CBS7/9 específico através da sequência de Sanger (setas verdes). Níveis de (C) a análise de RT-ddqPCR de HOXA9 em MOLM13 de WT e o 21 clones contendo único alvo sgRNA. Os dados de expressão HOXA9 foram agrupados em cinco grupos de acordo com as categorias de sequências sgRNA: site do CTCF HOXA7/9 , alvos não-humanos, outros sites CTCF os loci de HOX , HOX associado lncRNAs, e outros alvos humanos. Esta figura foi modificada de Luo et al.12. Para as estatísticas, esses dados foi representados como a média ± DP de três experimentos independentes com teste t de Student. Clique aqui para ver uma versão maior desta figura.

Figure 5
Figura 5 : Mutações Indel integrado sgRNAs clone positivo confirmaram com o ensaio de genotipagem e nuclease baseados em PCR. ()  DNA genômico foi isolado os representante CRISPR-Cas9 KO biblioteca selecionado clones que exibiram reduzidos, inalterados ou aumento níveis de expressão de HOXA9 . A exclusão de heterozigota do CTCF site localizado entre HOXA7 e genes HOXA9 (limite de CBS7/9) foi identificada por genotipagem PCR-baseados. O HOXA9-diminuição da exclusão de clones #5, 6, 28 e 121 exibida na localidade de limite de CBS7/9 (setas pretas). (B) a Indel mutações no site CBS7/9 foram analisadas por nuclease digestão ensaio de representante clones que exibiu reduzido (linha vermelha), inalterado (linha azul), ou aumento dos níveis de expressão de HOXA9 (linha roxa). O HOXA9-diminuiu clones #5, 6, 28 e 121 exibida mutações na localidade de limite de CBS7/9 (setas laranja). Esta figura foi modificada de Luo et al.12Clique aqui para ver uma versão maior desta figura. 

Tabela 1: sgRNAs informações de biblioteca de direcionamento da piscina. Estes dados são de Luo et al.12Clique aqui para baixar esta tabela.

Tabela 2: Sanger resultados de sgRNAs apresentado no selecionado de sequenciamento HOXA9 -diminuiu, HOXA9 -inalterada, e HOXA9 -aumentou clones. HOXA9-diminuição, inalterados e aumento de clones são destacadas em vermelho, azul e roxo, separadamente. Estes dados são de Luo et al.12Clique aqui para baixar esta tabela.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Genes codificantes de proteínas relacionadas com bibliotecas de sgRNA foram aplicadas em um sistema funcional de triagem para identificação de genes e redes, regulação de funções celulares específicas através de sgRNA enriquecimento24,25,26 ,de27,28. Região não-codificante vários relacionados com bibliotecas de sgRNA também foram mostradas em telas funcionais de gene-específico para distal e proximal de regulação elementos, incluindo BCL11A, Tdgf1a e resistência aos medicamentos regulam genes28, 29,30. Essas bibliotecas de sgRNA foram todos geradas por uma detalhada bioinformática design, síntese do oligonucleotide e sub clonagem o consultam do oligonucleotide em vetores. A abordagem de triagem de todo o genoma é muito poderoso e útil, mas requer perícia computacional para projeto de genoma-largo sgRNA e financiamento consistente para a síntese de cara; assim, é ainda um desafio para a maioria dos laboratórios. No entanto, a nossa biblioteca de loci específicos sgRNA triagem abordagem é conveniente e eficiente para identificar o elemento específico do DNA como o sítio de ligação do CTCF envolvido na organização da cromatina e regulação transcricional (Figura 1 e a Figura 2). Ao direcionar os limites CTCF, aplicamos um One-Step RT-PCR para avaliar clones sgRNA direcionado de acordo com o nível de expressão de um gene marcador específico, HOXA9. Além disso, realizamos Sanger sequenciamento para confirmar estes clones positivos sgRNAs integrado (Figura 2 e Figura 4). Para funcionalmente confirmar que estes sgRNAs positivos alvo clones, foi realizado um baseados em PCR genotipagem e mutação deteção do ensaio a fim de determinar se o sgRNA induz os alvo local inserção ou exclusão mutações (Figura 5). Isso nos dá um método promissor para elementos específicos de DNA não-codificante-alvo e avaliar sua função biológica em células de mamíferos.

Em nosso protocolo, nós mencionamos que um projeto específico do oligonucleotide garantirá mais eficiente sub clonagem em vetores lentiCRIPSRV2 e mais confiável geram uma biblioteca de sgRNA precisos (passos 1-2). A fim de obter o lentivirus de biblioteca de sgRNA de alta concentração, o sobrenadante Lentivirus deve ser concentrado 50-fold usando o concentrador, seguindo o protocolo (etapa 3) e armazenado em um freezer-80 ° C em várias alíquotas (passos 3.1-3.5). Uma preocupação adicional é encontrar o valor ideal de MOI de transdução. Se o MOI é muito baixa, o número de células infectadas irá diminuir e levar a sgRNA falha de triagem. Se o MOI é muito alto, integrará mais de um sgRNA em uma única célula, e isso irá interferir com a biblioteca sgRNA triagem através de uma etapa de RT-PCR e deteção de mutação Indel. Portanto, antes de triagem, encontrando o MOI ideal para cada grupo de células por meio de titulação da biblioteca de Lentivirus é um passo importante. Titulação da biblioteca Lentivirus em células de leucemia MOLM13 e avaliação do MOI realizarão no protocolo (etapas 5.1 – 5.10). Além disso, uma lise completa das células para a transcrição reversa pode garantir uma etapa bem sucedida RT-PCR. Isso pode ser feito, aumentando o tempo de incubação para lise em todas as fases de temperatura no protocolo (etapas 7.5 – 7,6). Portanto, a fim de reforçar o eficiente para a seleção da biblioteca CRISPR-Cas9 KO em pool, célula completa Lise e transcrição reversa desempenham um papel fundamental na determinação do One-Step RT-qPCR (etapas 7.1 – 7.14). Além disso, aumentar a qualidade dos produtos PCR pode assegurar detecção de mutação indel bem sucedido, porque os produtos de PCR de baixa qualidade afetará o processo de geração de doheteroduplex/homoduplex (etapas 9.1 –.6).

Além disso, o método pode ser usado para identificar o papel do CTCF na regulação dos genes HOX no desenvolvimento embrionário precoce e certa leucemia com assinatura de gene HOX aberrante. Por exemplo, genes HOX desempenham papéis críticos durante o desenvolvimento embrionário e todos os quatro grupos de HOX gens são temporalmente e espacialmente restritas em seus padrões de expressão no desenvolvimento embrionário. Além disso, as mutações NPM1 estão entre a anomalia genética mais comum em LMA e responsáveis por 30% dos pacientes LMA com cariótipo normal de citogenética31. Esse subconjunto da LMA exibe um aberrante HOXA e HOXB gene assinatura, que se torna um mecanismo dominante de transformação leucêmicas17. É fundamental para elucidar como gene Homeótico são regulados no desenvolvimento normal e prejudicado durante leukemogenesis. Nós e os outros têm mostrado que a CTCF desempenha um papel essencial na transcrição de gene e de organização da cromatina no HOX loci9,12. Assim, a triagem de biblioteca HOX loci focada sgRNA fornece um meio conveniente para complicar a função específica do sítio de ligação do CTCF na regulação dos genes HOX durante o desenvolvimento e malignidades hematopoiéticas. No entanto, uma limitação da abordagem é a dificuldade de encontrar um marcador útil para o sequenciamento de geração de alta produtividade. Um dos objetivos da pesquisa futura será encontrar um marcador altamente seletivo e realizar o sequenciamento de geração próxima todo o genoma para ver os efeitos do marcador. Portanto, usando um gene específico com tag marcador fluorescente, como o repórter de rastreamento se tornará uma ferramenta crucial no futuro planos de investigação.

Potenciadores de jogam uma infinidade de papéis essenciais na regulação da expressão de gene e a função do promotor. No entanto, ele também pode ativar a atividade de promotor de longa distância de forma independente, posição e orientação, e realçadores frequentemente regulam a expressão gênica em uma orientação de trans . Assim, é difícil identificar o enhancer(s) de genes específicos, especialmente na era pós-genómica. Repórter tradicionais ensaios e correlativas análises funcionais (por exemplo, imunoprecipitação da cromatina e ensaios hipersensíveis DNaseI) tem sido usadas para examinar o potenciador função32,33. Da mesma forma, pequenas projecções dimensionadas locus com foco também foram aplicadas para explorar as atividades dos elementos reguladores distais e proximais para genes específicos34. Recentemente, a estratégia de biblioteca em pool sgRNA-KO que os objectivos não-codificantes dos elementos reguladores em Locus gene HOX com êxito identificado um sítio de ligação do CTCF localizado entre genes HOXA7 e HOXA9 , bem como um lncRNA HOTTIP Isso é fundamental para controlar a posterior HOXA organização da cromatina domínio, que leva a gravidez ectópica expressão de gene HOXA na leucemia mieloide aguda (LMA)12. Estes estudos demonstraram que o rastreio de biblioteca em pool sgRNA-KO é também uma abordagem poderosa genética para identificar e avaliar a função biológica dos elementos não-codificante em nosso genoma in situ.

CTCF, como uma proteína de isolador de cromatina, desempenha um papel importante na organização do genoma definindo bairros de cromatina para padrões de expressão de genes específicos na célula específica tipo11,35. Alteração da estrutura de domínio topologicamente associado (TAD) altera as interações realçador/promotor, resultando em um estado doentes5,11. CTCF é altamente conservado em metazoan e é enriquecido com os limites TAD. No entanto, ainda não está claro se e como CTCF contribui para manter a estrutura de limite da cromatina e formação de TAD. Embora o rastreio de biblioteca sgRNA-nocaute em pool CTCF centrou-se sobre os quatro loci HOX , provou ser um poderoso método para identificar e dissecar os limites CTCF e definir domínio TAD bem como potenciador/promotor interação e transcrição dentro o domínio TAD12. Além disso, este método pode ser aplicado eficientemente para identificar os elementos de lncRNA e fatores de transcrição que medeiam a conformação da cromatina e atividade de acessibilidade HOX loci. Estamos também a tentar explorar a CRISPR/sgRNA biblioteca contendo os sites de todo o genoma CTCF através da identificação de sequenciamento na próxima geração de acordo com o ChIP-seq CTCF e dados de ChIA-PET de pesquisa no futuro. Assim, esta estratégia pode ser estendida para um cromossoma inteiro ou até mesmo o genoma inteiro.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Temos sem conflitos de interesse relacionados a este relatório.

Acknowledgments

Os autores também agradecer Nicholas Cesari para editar o manuscrito. O trabalho foi apoiado por concessões do Instituto Nacional de saúde (S.H., R01DK110108, R01CA204044).

Materials

Name Company Catalog Number Comments
Lipofectamine 3000 reagent Thermo Fisher Scientific L3000-008
Proteinase K Thermo Fisher Scientific 25530049
Puromycin Thermo Fisher Scientific A1113802
Stbl3 cells  Life Technologies  C737303
HEK293T ATCC CRL-3216
MOLM-13 DSMZ ACC 554
lentiCRISPRv2 Addgene 52961
pMD2.G Addgene 12259
psPAX2 Addgene 12260
pGEM®-T Easy Vector Systems  Promega A137A
T4 ligase  New England Biolabs  M0202S
QIAquick Gel Extract kit QIAGEN 28706
QIAuick PCR purification kit QIAGEN 28106
SingleShot™ SYBR® Green One-Step Kit Bio-Rad Laboratories 1725095
QIAGEN Plasmid Maxi Kit QIAGEN 12163
Dulbecco’s Modified Eagle Medium  Thermo Fisher Scientific  11965084
RPMI 1640  Thermo Fisher Scientific 11875093
Fetal bovine serum (FBS)  Thermo Fisher Scientific 10-082-147
Penicillin/streptomycin/L-glutamine  Life Technologies  10378016
Lenti-X Concentrator  Clontech 631232
Trypan Blue Solution Thermo Fisher Scientific 15250061
Polybrene Santa Cruz Biotechnology sc-134220
Phosphate Buffered Saline (PBS)  Genessee Scientific  25-507
TAE buffer  Thermo Fisher Scientific  FERB49
Surveyor® Mutation Detection Kits Integrated DNA Technologies 706020
Biorad Universal Hood II Gel Doc System Bio-Rad 170-8126
Centrifuge 5424 R Eppendorf 5404000138
Digital Dry Baths/Block Heaters Thermo Fisher Scientific 88870002
TSX Series Ultra-Low Freezers Thermo Fisher Scientific TSX40086V
Forma™ Steri-Cult™ CO2 Incubators Thermo Fisher Scientific 3308
Herasafe™ KS, Class II Biological Safety Cabinet Thermo Fisher Scientific 51022484
Sorvall™ Legend™ XT/XF Centrifuge Series Thermo Fisher Scientific 75004506
Fisherbrand™ Isotemp™ Water Baths Thermo Fisher Scientific FSGPD02
Thermo Scientific™ Locator™ Plus Rack and Box Systems Thermo Fisher Scientific 13-762-353
CFX96 Touch Real-Time PCR Detection System Bio-Rad 1855195
MiniAmp™ Thermal Cycler Applied Biosystems technology A37834
Thermo Scientific™ Owl™ EC300XL2 Compact Power Supply Thermo Fisher Scientific 7217581
Thermo Scientific™ Owl™ EasyCast™ B1 Mini Gel Electrophoresis Systems Thermo Fisher Scientific 09-528-178
VWR® Tube Rotator and Rotisseries VWR International 10136-084
VWR® Incubating Mini Shaker VWR International 12620-942
Analytical Balance MS104TS/00 METTLER TOLEDO 30133522
DS-11 FX and DS-11 FX+ Spectrophotometer DeNovix Inc. DS-11 FX

DOWNLOAD MATERIALS LIST

References

  1. Dixon, J. R., et al. Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature. 485, (7398), 376-380 (2012).
  2. Cuddapah, S., et al. Global analysis of the insulator binding protein CTCF in chromatin barrier regions reveals demarcation of active and repressive domains. Genome research. 19, (1), 24-32 (2009).
  3. Phillips, J. E., Corces, V. G. CTCF: master weaver of the genome. Cell. 137, (7), 1194-1211 (2009).
  4. Tang, Z., et al. CTCF-Mediated Human 3D Genome Architecture Reveals Chromatin Topology for Transcription. Cell. 163, (7), 1611-1627 (2015).
  5. Lupianez, D. G., et al. Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions. Cell. 161, (5), 1012-1025 (2015).
  6. Dowen, J. M., et al. Control of cell identity genes occurs in insulated neighborhoods in mammalian chromosomes. Cell. 159, (2), 374-387 (2014).
  7. Phillips-Cremins, J. E., et al. Architectural protein subclasses shape 3D organization of genomes during lineage commitment. Cell. 153, (6), 1281-1295 (2013).
  8. Narendra, V., Bulajic, M., Dekker, J., Mazzoni, E. O., Reinberg, D. CTCF-mediated topological boundaries during development foster appropriate gene regulation. Genes & Development. 30, (24), 2657-2662 (2016).
  9. Narendra, V., et al. CTCF establishes discrete functional chromatin domains at the Hox clusters during differentiation. Science. 347, (6225), 1017-1021 (2015).
  10. Deng, C., et al. HoxBlinc RNA Recruits Set1/MLL Complexes to Activate Hox Gene Expression Patterns and Mesoderm Lineage Development. Cell Reports. 14, (1), 103-114 (2016).
  11. Patel, B., et al. Aberrant TAL1 activation is mediated by an interchromosomal interaction in human T-cell acute lymphoblastic leukemia. Leukemia. 28, (2), 349-361 (2014).
  12. Luo, H., et al. CTCF boundary remodels chromatin domain and drives aberrant HOX gene transcription in acute myeloid leukemia. Blood. 132, (8), 837-848 (2018).
  13. Dou, D. R., et al. Medial HOXA genes demarcate haematopoietic stem cell fate during human development. Nature Cell Biology. 18, (6), 595-606 (2016).
  14. Lawrence, H. J., et al. Loss of expression of the Hoxa-9 homeobox gene impairs the proliferation and repopulating ability of hematopoietic stem cells. Blood. 106, (12), 3988-3994 (2005).
  15. Deng, C., et al. USF1 and hSET1A mediated epigenetic modifications regulate lineage differentiation and HoxB4 transcription. PLOS Genetics. 9, (6), e1003524 (2013).
  16. Rawat, V. P., Humphries, R. K., Buske, C. Beyond Hox: the role of ParaHox genes in normal and malignant hematopoiesis. Blood. 120, (3), 519-527 (2012).
  17. Alharbi, R. A., Pettengell, R., Pandha, H. S., Morgan, R. The role of HOX genes in normal hematopoiesis and acute leukemia. Leukemia. 27, (5), 1000-1008 (2013).
  18. Rice, K. L., Licht, J. D. HOX deregulation in acute myeloid leukemia. Journal of Clinical Investigation. 117, (4), 865-868 (2007).
  19. Bassett, A. R., Kong, L., Liu, J. L. A genome-wide CRISPR library for high-throughput genetic screening in Drosophila cells. Journal of Genetics and Genomics. 42, (6), 301-309 (2015).
  20. Zhu, S., et al. Genome-scale deletion screening of human long non-coding RNAs using a paired-guide RNA CRISPR-Cas9 library. Nature Biotechnology. 34, (12), 1279-1286 (2016).
  21. Kurata, J. S., Lin, R. J. MicroRNA-focused CRISPR-Cas9 library screen reveals fitness-associated miRNAs. RNA. 24, (7), 966-981 (2018).
  22. Collins, C. T., Hess, J. L. Role of HOXA9 in leukemia: dysregulation, cofactors and essential targets. Oncogene. 35, (9), 1090-1098 (2016).
  23. Kroon, E., Thorsteinsdottir, U., Mayotte, N., Nakamura, T., Sauvageau, G. NUP98-HOXA9 expression in hemopoietic stem cells induces chronic and acute myeloid leukemias in mice. The EMBO Journal. 20, (3), 350-361 (2001).
  24. Koike-Yusa, H., Li, Y., Tan, E. P., Velasco-Herrera Mdel, C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nature Biotechnology. 32, (3), 267-273 (2014).
  25. Shalem, O., et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 343, (6166), 84-87 (2014).
  26. Wang, T., Wei, J. J., Sabatini, D. M., Lander, E. S. Genetic screens in human cells using the CRISPR-Cas9 system. Science. 343, (6166), 80-84 (2014).
  27. Zhou, J., et al. Dual sgRNAs facilitate CRISPR/Cas9-mediated mouse genome targeting. The FEBS Journal. 281, (7), 1717-1725 (2014).
  28. Sanjana, N. E., et al. High-resolution interrogation of functional elements in the noncoding genome. Science. 353, (6307), 1545-1549 (2016).
  29. Rajagopal, N., et al. High-throughput mapping of regulatory DNA. Nature Biotechnology. 34, (2), 167-174 (2016).
  30. Korkmaz, G., et al. Functional genetic screens for enhancer elements in the human genome using CRISPR-Cas9. Nature Biotechnology. 34, (2), 192-198 (2016).
  31. Rezaei, N., et al. FMS-Like Tyrosine Kinase 3 (FLT3) and Nucleophosmin 1 (NPM1) in Iranian Adult Acute Myeloid Leukemia Patients with Normal Karyotypes: Mutation Status and Clinical and Laboratory Characteristics. Turkish Journal of Haematology. 34, (4), 300-306 (2017).
  32. Yaragatti, M., Basilico, C., Dailey, L. Identification of active transcriptional regulatory modules by the functional assay of DNA from nucleosome-free regions. Genome Research. 18, (6), 930-938 (2008).
  33. Wilken, M. S., et al. DNase I hypersensitivity analysis of the mouse brain and retina identifies region-specific regulatory elements. Epigenetics Chromatin. 8, 8 (2015).
  34. Narlikar, L., Ovcharenko, I. Identifying regulatory elements in eukaryotic genomes. Briefings in Functional Genomics and Proteomics. 8, (4), 215-230 (2009).
  35. Hnisz, D., et al. Activation of proto-oncogenes by disruption of chromosome neighborhoods. Science. 351, (6280), 1454-1458 (2016).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics