כוונון הירידה כדי להשיג חלבון ספציפי ויעיל המחסור

Immunology and Infection
 

Summary

כאן, אנו מציגים פרוטוקול ביעילות ובמיוחד לרוקן חלבון של עניין השמרים סכביסיטאה cerevisiae ס באמצעות מערכת העזרה β-est.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Barrass, J. D., Mendoza-Ochoa, G. I., Maudlin, I. E., Sani, E., Beggs, J. D. Tuning Degradation to Achieve Specific and Efficient Protein Depletion. J. Vis. Exp. (149), e59874, doi:10.3791/59874 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

המפעל מסייע לקולטן מחייב, TIR1, מזהה חלבונים המכילים מוטיב מסוים inducible degron (סיוע) בנוכחות האוקאין, מיקוד אותם להשפלה. מערכת זו מנוצלת על eukaryotes רבים שאינם מפעל, כך חלבון היעד, המתויג עם מוטיב הסיוע, הוא מושפל על הכלי בנוסף. רמת הביטוי TIR1 קריטית; ביטוי מופרז מוביל השפלה של חלבון סיוע מתויג גם בהעדר שימוש, בעוד ביטוי נמוך מוביל דלדול איטי. Β-estradiol-inducible מערכת הסיוע נוצר, עם ביטוי של TIR1 תחת השליטה של β-estradiol inducible יזם. הרמה של TIR1 הוא tunable על ידי שינוי הזמן של דגירה עם β-estradiol לפני בנוסף. פרוטוקול זה מתאר כיצד לרוקן במהירות חלבון יעד באמצעות מערכת העזרה. זמן הדגירה β-estradiol המתאים תלוי בשפע של חלבון היעד. לכן, מחסור יעיל תלוי בתזמון אופטימלי כי גם ממזער מחסור בלתי תלוי האוקמי.

Introduction

מוטציות מותנות, כגון מוטציות רגישות לטמפרטורה, הם כלי רב עוצמה למחקר של חלבונים חיוניים, המאפשר צמיחת תאים במצב מתירני אך גרימת אובדן של פונקציה תחת תנאים שאינם מתירני. עם זאת, מטבוליזם התא יכול להיות מודאג ברצינות על ידי שינוי בתנאי הצמיחה הנדרש כדי לגרום לפגם והוא עשוי גם ליצור השפעות מחוץ ליעד. פותחו מספר שיטות, בהן החלבון של הריבית מוקף בתנאים מותנה1 או הביטוי שלו נשלט2,3 על-ידי הוספת מולקולה קטנה. פרוטוקול זה משתמש בכלי העזר ואת מערכת הסיוע-inducible degron (עזרה) כדי לרוקן ביעילות חלבון היעד.

מערכת הסיוע יש מקורו בצמחים, שם שימוש (בפרוטוקול זה אינדול 3-חומצה אצטית (רשות) משמש), מעוררת אינטראקציה של חלבון Aux/הרשות עם TIR1, חבר של scf U3 אוביקוויב ליגאז מורכבת4. האינטראקציה המורכבת של scf גורמת לpolyubiquitination של משפחת Aux, אשר גורמת להשפלה שלהם על ידי פרוטאסדום5,6.

מערכת זו הותאמה בעבר לשימוש השמרים שמרים cerevisiae ס7,8 על ידי ביטוי חלבון TIR1 מ- oriza סאטיבה (ostir) בתאי שמרים, שם הוא מסוגל לתקשר עם שמרים אנדוגניים מתחם SCF. חלבון העניין היה מתויג עם מוטיב של החלבון או הרשות העתיקות IAA17 למקד אותו להשפלה. הIAA17 הפונקציונלי פותחו מאוחר יותר, כגון סיוע *8,9,10, המכיל את המוטיב העדין של חומצות אמינו 43 מערבה הIAA17, יחד עם תג אפירופה כדי לאפשר זיהוי.

המערכת הותאמה בתחילה לשימוש בהנצה שמרים7,8 הביע חלבון osTIR1 מיזם גל שמרים. ביטוי דורש הסטה למדיום צמיחה עם גלקטוז כמקור הפחמן הבלעדי, אשר, למרבה הצער, תוצאות משמרת diauxic עם שינויים רחבים לחילוף החומרים של התא11. לעומת זאת, דווח כי הביטוי הקונסטיטוטיבי של TIR1 יכול להוביל לירידה בחלבון היעד בהעדר האוקאין/רשות העתיקות12 אם רמת הביטוי גבוהה, ואילו ביטוי נמוך TIR1 גורם לדלדול לא יעילות. מערכת עזרה משופרת בשם β-est הסיוע פותחה שבו osTIR ערבבים הוא תחת שליטה של יזם inducible כי הוא tunable להתאים את חלבון היעד, עם השפעה מינימלית על חילוף החומרים של התא. כדי להשיג את זה, שעתוק מלאכותי מרכיב (הרשות) נבנה שבו VP16 ויראלי התמלול activator הוא התמזגו קולטן טסטוסטרון וארבעה האצבעות zn כריכת ה-DNA (dbd). כאשר β-estradiol (oestrogen) קיים, הרשות יכול להיכנס לגרעין ולגרום לשעתוק מערבבים על ידי כריכת היזם שלה (Z4EVpr)13,12.

ביטוי osTIR הוא בדרך כלל לזיהוי על 20 דקות לאחר התוספת של β-estradiol12. עם זאת, המשך האופטימלי של ביטוי osTIR ערבבים כדי להשיג דלדול יעיל של חלבון מתויג עם שיובים, תוך הימנעות דלדול לפני הצורך בנוסף, צריך להיות אמפירי נחוש עבור כל חלבון מטרה. זמן משוער זה טרום דגירה יכול להיות מוערך מערכי שפע במסד הנתונים של הגנום סכמיקו (SGD https://www.yeastgenome.org/). כפי שניתן לראות באיור 1, את החלבון השופע, Dcp1 (2880 כדי 4189 מולקולות/תא), דורש 40 דקות של טרום הדגירה עם β-estradiol, עם מחסור בלתי תלוי של היוצר. חלבון הרבה פחות שופע, Prp2 (172 כדי 211 מולקולות/תא), הוא התרוקן מאוד לאחר רק 20 דקות של טרום הדגירה. מומלץ לבדוק שתי פעמים נוספות לפני הדגירה, 10 עד 20 דקות לפני או אחרי הזמן המשוער הראשוני הזה (20 דקות הוא הזמן המינימלי המומלץ). הזמן האופטימלי לפני הדגירה הוא הזמן שבו חלבון היעד לא התרוקן לפני הוספת מצורף ולאחר מכן מוסיפים את הדלדול הוא מקובל או רמות החלבון הגישה המינימום האפשרי. כך, מתוך איור 1b, עבור Prp22 עם 30 דקות של טרום הדגירה, הרמות לא ירדו הרבה 10 דקות לאחר בנוסף. השוואת זה עם 40 מינימום של טרום דגירה ו 15 דקות עם הרשות העתיקות, שם יש מעט מחסור נוסף, אין תועלת ב דגירה עם הקלה יותר 10 דקות או טרום הדגירה של יותר מ 30 דקות, במיוחד כאשר יש ראיות של אי שאוקאין דלדול התלויים ב 40 דקות. עבור Dcp1 עם 40 דקות של טרום הדגירה (הנקודה האחרונה שבה רמת החלבון הוא כ 100% לפני הצורך בנוסף), 15 כדי 20 דקות של דלדול עם האוקאין מקובל. מומלץ לשמור את זמן דלדול קצר ככל האפשר כדי להפחית את ההשפעות המשניות על מטבוליזם התא14.

מאמר זה מדגים כיצד להשתמש β-est מערכת הסיוע על ידי אופטימיזציה של העיתוי של הדגירה β-estradiol לביטוי osTIR ערבבים להשיג מהירה חלבון היעד מחסור בתוספת של הרשות העתיקות ללא דלדול לפני הוספת מסייע.

Protocol

הערה: ראה איור 2 עבור תקציר גרפי.

1. מסננים הכנה

  1. באמצעות ura3-מאמץ, להציג את מערכת הסיוע הβ-est (כלומר, גנים לקודד את הβ-estradiol מגיב שעתוק (הרשות) ואת OSTIR) סיוע * תג חלבון היעד (ראה איור 3 ושולחן 1 לסיכום של ההליך).
    1. לשנות15 או pZTRK (G418 התנגדות סמן) או pZTRL (LEU2 סמן) פלמיד (זמין מן המרכז משאבים גנטיים שמרים) לתוך זן ura3 שמרים או להשתמש במרכז הפלבאמצע כתבנית לייצר את המוצר PCR עבור גנומית אינטגרציה.
    2. PCR מגבירים את הרשות (מסומנת בZ4EVATF במפת פלאמיד) ומערבבים באמצעות נאמנות גבוהה פולימראז מאחד הפלמידים pZTRK או pZTRL. השתמש התחל עם 50 כדי 60 בסיס 3 ' הרחבות עם הומולוגיה לאזור גנומית, כדי שילוב ישיר על ידי שילוב מחדש של הומוולוגי16. עבור שילוב גנומי של שני הרכיבים בנפרד או ביחד, ראה טבלה 1 עבור התחל והתנאים.
      הערה: זן pZ4EV-NTR1 יש את הרכיבים כבר משולבים הגנום (זמין ממרכז המשאבים הגנטיים שמרים, יפן).
    3. ודא כי חלבון היעד הוא סיוע * מתויג באמצעות הליך Longtine17 (ראה איור 3B ושולחן 1).
    4. לבצע ניתוח גדילה על המתח ללא β-estradiol והרשות העתיקות כדי לקבוע אם העזרה * תג משפיע על הצמיחה כדי לנבא את קצב הצמיחה לשימוש בשלב 1.5.

2. נוהל כללי עבור דלדול

  1. חשב את מידת התרבות הנדרשת עבור כל הדגימות שייאספו; לדוגמה, 10 מ ל של תרבות ב-OD600 של 0.8 מספיקה עבור חלבון, RNA ו-DNA חילוץ עבור מדגם אחד, כך 6 דגימות, לפחות 60 mL של התרבות נדרשת.
  2. מתרבות לילה, להקים מספיק תרבות חדשה ב-OD600 0.1 ל 0.2 ולצאת לצמוח 30 ° c. מדיום עשיר כגון YPDA מומלץ, למרות שניתן להשתמש בתנאי גדילה אחרים:
    תמצית שמרים משחק 10
    צליל פטונה 20 גר'
    גלוקוז 20 גר'
    אדנין סולפט 40 מ ג
    H2O כדי ל 1 ליטר

    הערה: חיטוי או מסנן לעקר; עיקור מסנן הוא המועדף על מכלולי פפטיד/סוכר המיוצר על ידי מזרז אוטומטי במתנול בשימוש באוסף לדוגמה.
  3. . היכונו לקבל את הדגימות
    1. הכניסו 30 עד 50% מנפח המדגם המיועד של מתנול לתוך צינור. לדוגמה, אם מדגם של 10 mL הוא להילקח, לשים 5 מ ל של מתנול לתוך שפופרת של 15 מ ל פלקון ולסגור את הצינור בחוזקה. לאחר סגירתו, יש לתייג את השפופרת ולשים על קרח יבש או ב-80 ° צ' כדי להתקרר.
      זהירות: . לוותר על המתנול בתוך מכסה המנוע
    2. תווית 1.5 mL צינורות לאחסון לטווח ארוך של דגימות ומקום קרח כדי קריר.
    3. מגניב מספיק H2O (לפחות 1 מ"ל לדוגמה) על הקרח.
  4. צפו בצמיחת התרבות. OD היעד לאיסוף דגימות הוא כ 0.7 כדי 0.8, אבל שלב טרום דגירה (הדגירה עם β-estradiol כדי לגרום osTIR), צריך להיות התחיל מוקדם יותר, כך התרבות תגיע בערך OD הנכון בזמן הדגימות הם נאסף.
    הערה: מומלץ לבצע עקומת צמיחה בתנאים שישמשו בניסוי, כך שניתן יהיה להעריך את ה-OD המתחיל.
  5. לאחר OD היעד לתחילת הדגירה הקדם כבר הגיע, לקחת מדגם (בדרך כלל 10 מ"ל), לתוך הצינור טרום מוכנים המכיל מתנול קר. היפוך לזמן קצר כדי לערבב ולמקם חזרה קרח יבש.
    הערה: המדגם ניתן להעביר קרח מים אחרי כ 5 דקות, אם נוח לעשות זאת.
  6. הוסף מיד את β-estradiol, 1 μL/mL של התרבות (הריכוז הסופי של 10 μM); יש β-estradiol נמדד מראש בפיפטה מוכן לשימוש כדי להקטין את הזמן שנלקח בין איסוף המדגם והוספת β-estradiol. לערבב במהירות על ידי מתערבל במרץ.
  7. המשך לגדל את התרבות כמו לפני (שלב 2.2), הדגירה (זהו השלב "טרום דגירה") עם β-estradiol עבור הזמן האופטימלי (לקביעת הזמן האופטימלי טרום דגירה לראות איור 1).
  8. היכונו להוספת רשות העתיקות. לקחת את הנפח של רשות העתיקות עבור שלב 2.10 (כלומר, 0.5 μL של רשות העתיקות לכל mL של התרבות). זה הופך את שלב 2.20 למהיר יותר.
  9. לאסוף מדגם כשלב 2.5.
  10. להוסיף מיד את הרשות 0.5 μL/mL של התרבות לריכוז הסופי של 750 μM כפי שהוכן בשלב 2.8. לערבב במהירות על ידי מתערבל במרץ.
  11. לאסוף דגימות, כמו שלב 2.5, על פי העיצוב הניסיוני שלך. או מדגם אחד, בכל פעם שהוא צפוי כי החלבון יהיה מרוקן באופן אמין, או דגימות מרובות במהלך זמן של דלדול. לדוגמה, 5 מרווחי זמן נוחים לתזמון ומספקים מגוון של רמות חלבונים. אסטרטגיית האופטימיזציה, כפי שמוצג באיור 1, תעניק אינדיקציה לזמנים המתאימים.
  12. . לעבד את הדגימות
    1. , שים את הדגימות על הקרח. אם לא נעשה את זה כבר ודא שאף אחד מדגימות לא הוקפא; אם יש להם, חם בעדינות ביד, היפוך כל הזמן, כך הטמפרטורה לא עולה באופן מקומי.
      הערה: זה הטוב ביותר נעשה ביד כמו טמפרטורה של המדגם ניתן להעריך, זה צריך תמיד להרגיש קר. . מקום על הקרח זו אינה נקודת הפסקה-ברגע שכל הדגימות הן נוזלים, המשך לשלב הבא.
    2. לאחר כל הדגימות נאספו כבר לא קפואים, ספין ב 3,500 x g עבור 2 דקות (ב 4 ° צ' אם אפשרי).
    3. יוצקים את מתנול/בינוני לערבב ומניחים בחזרה על הקרח; אל תדאג אם לא כל הנוזל הוסר.
    4. השהה מחדש את הגלולה בתא 1 מ ל של קרח קר H2O (משלב 2.3.3) והעבר לצינור המסומנת 1.5 mL (מוכן בשלב 2.3.2) על הקרח.
    5. ספין לזמן קצר (למשל, 10 של זמן כולל) ב > 15000 x g כדי לחדש את התאים, המקום חזרה על הקרח ולהסיר את הנוזל.
    6. להסיר את H2O על ידי שאיפה. כדוריות התא ניתן לאחסן ב-20 ° c, או-80 ° צ' עבור אחסון לטווח ארוך.
  13. בדוק את הרמה שבה החלבון התרוקן על ידי ניתוח כתם כתמי המערבי18.
    הערה: חלבון מספיק19 ו/או חומצת גרעין ניתן לחלץ מתוך גלולה אחת תא לרוב המטרות, למרות מינים נדירים RNA עשוי לדרוש נפח דגימה יותר.

Representative Results

דוגמאות מייצגות של דלדול מוצגות באיור 1. שלושת הניסויים המוצגים בדמות זו היו מיטוב ניסויים עבור דלדול החלבונים Prp2, Prp22 ו Dcp1. השפע נמוך, מPrp2 וחלבונים Prp22 התרוקנו לפחות מ -20% אחרי 40 דקות טרום הדגירה עם β-estradiol ואחריו 15 דקות עם האוקאין. זמן רב יותר טרום הדגירה פעמים להוביל דלדול מהירה יותר, אבל גם להראות המחסור חלבון בלתי רצוי לפני שניתן לעשות זאת בנוסף. בהשוואה, Dcp1 שופע יותר היה רק לרוקן כ 30% עם אותו טיפול, אבל 60 דקות של טרום הדגירה הביא דלדול כדי 13% עם הטיפול באותו העזר, על העלות של דלדול לפני התוספת מתווסף. ייתכן כי 50 דקות של טרום הדגירה עם β-estradiol ו-15 דקות עם כלי עזר היו משיגה תוצאות דומות בנקודת זמן קצר יותר וכך היה יכול להיות אופטימלי יותר.

Figure 1
איור 1: שיעור המחסור ניתן לכוונן על ידי מודגדירוג המשך של β-estradiol טרום הדגירה. כתם מערבי18 של חלבונים היעד: (a ו- b) PRP22-סיוע *-6flag, (c ו -d) Prp2-סיוע *-6flag, ו (e ו- f) Dcp1-עזרה *-6flag, מן התרבויות טרום הדגירה עם β-estradiol (β-est) עבור 20, 30, 40, או 60 דקות לפני האוקאם בנוסף12. כמויות שוות של חלבון מוחלט נטענו בכל נתיב. Pgk1 מזוהה כפקד טעינה חזותית, למעט לוח e, כאשר Pgk1 ו Dcp1 להעביר שיתוף. הכמת של להקות חלבונים ב פאנלים a, c ו- e מוצגים פאנלים b, d, ו- f, בהתאמה. כאמצעי למדידת קצב המחסור, השיפוע (m) חושב עבור המקטע הליניארי (מ-100% עד 30% מהערכים ההתחלתיים) של כל עיקול. הזמן האופטימלי לפני הדגירה הוא הזמן שבו רמות החלבון עדיין קרוב רמות בלתי המושרה (100%) ושיעור הבא של דלדול הוא מהיר. עבור Dcp1 (f), 60 מינימום של טרום הדגירה ארוך מדי, כמו החלבון התחיל לבזות בהעדר האוקאין, בעוד 20 דקות הוא קצר מדי, כמו החלבון אינו מעריך באופן מוגזם בקורס זה זמן. לאחר 40 דקות טרום הדגירה, 15 דקות עם שימוש יכול לשמש כחלבון הוא כ 70% התרוקן, למרות 20 דקות יגרום דלדול נוסף, זה יכול גם לגרום להשפעות משניות. קווי שגיאה מייצגים סטיית תקן של שתי משכפל ביולוגי. עבור כל ניסוי, מוצג כתם אחד של נציג. איור זה נגזר מהפרסום הקודם9. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 2
איור 2: תקציר גרפי. הוסף β-estradiol לתרבות מספקת גדל בינוני עשיר בטמפרטורה הנדרשת כדי להתחיל טרום הדגירה. המשך הצמיחה לזמן טרום הדגירה הנדרש לפני הוספת רשות העתיקות (האוקאין) כדי להתחיל דלדול. הפרה טרום דגירה וזמני תלוי בחלבון להיות מרוקן, אבל טרום הדגירה היא לעתים קרובות בטווח של 20-60 דקות ואת זמן המחסור הוא בדרך כלל בסדר של 10 עד 20 דקות 10 mL יש לקחת בתחילת ובסוף של טרום דגירה ו ערבות g הדלדול. דגימות אלה קבועים במהירות מתנול קר לפני הפלטינג ואחסון. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 3
איור 3: יצירת מאמץ עבור מערכת B-est. (א) כדי ליצור זן שמרים עם מערכת הסיוע *, או pZTRL (LEU2) או pztrk (Kanamycin (G418) התנגדות), פלמיד צריך להיות הציג לתוך המתח או, לחילופין, הרשות ו-ostir ניתן להוסיף לתוך הגנום על ידי הומוולוגי מחדש של רסיס שנוצר על ידי ה-PCR מ 3 ' התחל בסוף (ראה איור 3b וטבלה 1). (ב) C-תיוג מסוף של חלבון היעד מושגת על ידי ה-PCR הגברה של האזור המתאים של pURA3-AID-הסיוע *-6flag (pURA3_AID *-6flag שונה רק בתג ניתן לטפל בדיוק באותו אופן), באמצעות longtine התחל S3-F ו S2-R עם 3 ' הרחבות הומוולוגי כדי 3 ' סוף חלבון היעד. הארכה פריימר הקדמי צריך לכלול את חומצת האמינו האחרונה קודון במסגרת עם ההתחלה של התגית עזרה * ואסור לכלול את קודון לעצור. הארכה הפוכה צריכה להיות לאזור במורד אזור הקידוד. מוכנס פעם לתוך הגנום, תאים שאיבדו את URA3 marker (על ידי שילוב הומוולוגי בין האזורים הזהים שנמצאו בשני קצוות הסמן) ניתן לבחור על ידי צמיחה עם 5-אני, כי מונה בוחר URA3 תאים. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

א. פריימר רצפים
יעד מיקום פריימר שם רצף Tm (° c)
מיכל שטרן 516 F pZTRL_F < האזור של הומולוגיה-> GCGACAGCATCACCGACTTCG 61.23
7897 R pZTR_R CGCCGCCTCTACCTTGCAGA <-האזור של הומולוגיה (RC)-> 61.30
pZTRK 9154 F pZTRK_F <-אזור של הומולוגיה-> הגנה 59.40
5897 R pZTR_R CGCCGCCTCTACCTTGCAGA <-האזור של הומולוגיה (RC)-> 61.30
pURA3-סיוע *-6FLAG או pURA3_AID *-6FLAG F S3-F < האזור של הומולוגיה-> CGTACGCTGCAGGTCGAC 59.21
R S2-R ה<-אזור הומולוגיה (RC)-> 52.76
pZRTL/K היא להגביר את מערכת העזרה β-est
pURA3-סיוע *-6FLAG/6FLAG כדי להגביר את הסיוע * ו אפירופה תג כדי לתייג את חלבון היעד (הליך Lontine)
< האזור של הומולוגיה-> אזור הומולוגי לאזורים האגפים שבהם יש להוסיף את המערכת. ככל שאזור זה ארוך יותר סביר יותר שהשינוי יהיה מוצלח; 50-100 מומלץ בסיסים.
< אזור של הומולוגיה (RC)-> אזור הומולוגי לאזורים האגפים בהם יש להוסיף את המערכת, זכור להשתמש בהשלמה הפוכה. כאמור, ככל שהאזור יותר טוב.
Tm (° c) Tm באמצעות שיטת% GC עם 50 מ"מ נלארג
ב. הPCR מיקס
רכיב אמצעי אחסון (μL)
תבנית < 10
מאגר HF בתדר NEB (5x) * 100
פריימר קדימה 100 μM 2.5
פריימר הפוכה 100 μM 2.5
הפקודה dNTPs 10 מ"מ כל 10
H2O ל500
* The NEB Phusion GC מאגר (5x) ניתן להשתמש גם אבל הוא לא מועדף
לעשות את זה לערבב, לפצל 10 שפופרות של 50 μl לערבב כל אחד ולבצע את ה-PCR כטבלה 1 c.
בדוק את ה-PCR עבד על ידי ריצה על ג'ל
לשלב את כל התגובות מוצלחות לתוך צינור אחד והאתנול מזרז
הפוך את השמרים עם כל החומר המיוצר על ידי ה-PCR
ג. התנאים המולקולארית
צעד טמפ ' (° צ') זמן
דנטורציה ראשונית 98 שלושים בנות
25-35 מחזורים הספרות הדנית 98 עשרה מנות
אנאל 45 – 60 עשרים ושנות
סיומת 72 30 s/kb
הארכה סופית 72 10 דקות
החזיק 8
אנעל ב 45 ° c עבור מערכת פריימר לונטין (S3-F ו-S2-R) ו 60 ° c עבור pZTRL/K התחל
להאריך 3 דקות עבור ה-PCR לונטין ו 3 דקות עבור pZTRL/K

שולחן 1: רצף פריימר, מיקס PCR ו-PCR.

Discussion

פרוטוקול אופטימיזציה היטב יכול לייצר דלדול מהירה ויעילה של חלבון היעד. קביעת זמן טרום הדגירה המשוער עם β-estradiol חשוב, כמו זה מגביר את האפשרות של דלדול, אבל וריאציות קטנות בזמן טרום הדגירה יכול להיות נסבל. מצד שני, הטיפול חייב להילקח בעיתוי לאחר האוקגם, כמו רמת החלבון מסרב במהירות רבה.

יתרון של גישה זו הוא כי דלדול מכוון יכול להיות מושגת על ידי שילובים שונים של זמן טרום הדגירה עם β-estradiol ואת הזמן הדגירה של הרשות. לדוגמה, אם תרצה, חלבון היעד יכול להיות מתרוקן יותר לאט על ידי הפחתת זמן טרום הדגירה.

מערכת העזרה הβ-est מציעה יתרונות מסוימים במערכות שבהן OsTIR ערבבים מבוטא באופן מכונן. לדוגמה, אם חלבון היעד חיוני עבור כדאיות, ביטוי מוסדר של osTIR יכול למנוע דלדול מוקדמת של חלבון היעד. יתר על כן, ביטוי של osTIR יכול להיות מכוון להתאים את השפע של חלבון היעד ואת הרגישות שלה להשפלה, ואת דלדול יכול להיות מהיר או איטי. שני מולקולה קטנה מולקולת, β-estradiol ו שאוקאין, לא perturb את חילוף החומרים שמרים תחת התנאים המשמשים כאן, בניגוד rapamycin, בשימוש מערכת עוגן1.

יצוין כי תיוג כמה חלבונים משבש את התפקוד שלהם, שהיא בעיה עם כל מערכת המחסור ממוקד. במקרה זה, תג N-terminal עשוי לפעול כאשר תג C-terminal אינו מצליח. כמו כן, לא כל החלבונים יהיו מרוקנים ביעילות; לדוגמה, העזרה-תג על חלבון היעד עשוי להיות נגיש לחלבון osTIR ערבבים. לכן, לאחר הסיוע-תיוג, כל חלבון היעד צריך להיבדק עבור כל השפעה של התג על הצמיחה, כדי לקבוע אם דלדול יעיל, לפני התזמונים של β-estradiol טרום הדגירה ואת הטיפול ממוטב.

סיוע זה * מערכת היא פשוטה מאוד והוא תואם לכל הליך ניסיוני הבא שאינו כרוך צמיחה נוספת, כגון חלבון, DNA או ניתוח RNA או מיקרוסקופיה. בנוסף, המערכת פועלת היטב כאשר משולב עם המוח כדי לטהר את ה-RNA20המתהווה.

מערכת זו מספקת אמצעי מהיר, ספציפי, ומאפשר ל, לכלה חלבון מבלי להשפיע אחרת על חילוף החומרים של התא שמרים.

Disclosures

. למחברים אין מה לגלות

Acknowledgments

תודות לג ריד על שיזם את התוכנית הזאת, ברברה Terlouw לפיתוח, ווחיד אסלזלדה עבור מבנים "מאורה לופר" ו שושנה דה לוקאס עבור דיונים מועילים רבים. עבודה זו נתמכת על ידי מלגה GIMO מן Consejo הלאומי דה Ciencia y Tecnología, מקסיקו (CONSEJO) ו אוניברסיטת אדינבורו בית הספר למדעים ביולוגיים, PhD ברוכים הבדרההספינה ל IEM [105256] ועל ידי ברוכים המימון [104648] ל-JD באגגס . העבודה במרכז ברוך הבא לביולוגיה סלולרית נתמכת על ידי מימון ברוכים המרכזיים [092076].

Materials

Name Company Catalog Number Comments
Adenine sulphate Formedium DOC0230
Agar Formedium AGA03
Β-estradiol Sigma Aldrich E2758-1G 10 mM solution in ethanol. Store at -20 °C
DMSO Alfa Aesar 42780 DMSO should be solid at 4 °C
Glucose Fisher Scientific G/0500/60
IAA 1H-Indole-3-acetic acid Across Orgainics 122150100 Auxin analogue. 1.5 M in DMSO. The solution will be a russet colour and darken as time goes on; a deep red solution should be discarded and a new one made. Store at -20 °C.
Methanol Fisher Scientific M/4000/PC17 CAUTION Toxic and flammable
Phusion High-Fidelity DNA Polymerase NEB M0530
Peptone Formedium PEP03
SCSM single drop-out –ura Formedium DSCS101
Yeast Extract Formedium YEA03
Yeast nitrogen base without amino acids with amonium sulphate Formedium CYN0410

DOWNLOAD MATERIALS LIST

References

  1. Haruki, H., Nishikawa, J., Laemmli, U. K. The Anchor-Away Technique: Rapid, Conditional Establishment of Yeast Mutant Phenotypes. Molecular Cell. 31, 925-932 (2008).
  2. Bellí, G., Garí, E., Piedrafita, L., Aldea, M., Herrero, E. An activator/repressor dual system allows tight tetracycline-regulated gene expression in budding yeast. Nucleic Acids Research. 26, 942-947 (1998).
  3. Alexander, R. D., et al. RiboSys, a high-resolution, quantitative approach to measure the in vivo kinetics of pre-mRNA splicing and 3′-end processing in Saccharomyces cerevisiae. RNA. 16, 2570-2580 (2010).
  4. Deshaies, R. J., Joazeiro, C. A. P. RING Domain E3 Ubiquitin Ligases. Annual Review of Biochemistry. 78, 399-434 (2009).
  5. Tan, X., et al. Mechanism of auxin perception by the TIR1 ubiquitin ligase. Nature. 446, 640-645 (2007).
  6. Teale, W. D., Paponov, I. A., Palme, K. Auxin in action: signalling, transport and the control of plant growth and development. Nature Reviews Molecular Cell Biology. 7, 847-859 (2006).
  7. Nishimura, K., Fukagawa, T., Takisawa, H., Kakimoto, T., Kanemaki, M. An auxin-based degron system for the rapid depletion of proteins in nonplant cells. Nature Methods. 6, 917-922 (2009).
  8. Morawska, M., Ulrich, H. D. An expanded tool kit for the auxin-inducible degron system in budding yeast. Yeast. 30, 341-351 (2013).
  9. Kubota, T., Nishimura, K., Kanemaki, M. T., Donaldson, A. D. The Elg1 Replication Factor C-like Complex Functions in PCNA Unloading during DNA Replication. Molecular Cell. 50, 273-280 (2013).
  10. Brosh, R., et al. A dual molecular analogue tuner for dissecting protein function in mammalian cells. Nature Communications. 7, 11742 (2016).
  11. DeRisi, J. L., Iyer, V. R., Brown, P. O. Exploring the metabolic and genetic control of gene expression on a genomic scale. Science. 278, 680-686 (1997).
  12. Mendoza-Ochoa, G. I., et al. A fast and tuneable auxin-inducible degron for depletion of target proteins in budding. Yeast. (2018).
  13. McIsaac, R. S., et al. Synthetic gene expression perturbation systems with rapid, tunable, single-gene specificity in yeast. Nucleic Acids Res. 41, e57 (2013).
  14. Prusty, R., Grisafi, P., Fink, G. R. The plant hormone indoleacetic acid induces invasive growth in Saccharomyces cerevisiae. PNAS. 101, 4153-4157 (2004).
  15. Geitz, D., St Jean, A., Woods, R. A., Schiest, R. H. Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Research. 20, 1425 (1992).
  16. Widlund, P. O., Davis, T. N. A high-efficiency method to replace essential genes with mutant alleles in yeast. Yeast. 22, 769-774 (2005).
  17. Longtine, M. S., et al. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast. 14, 953-961 (1998).
  18. Eaton, S. L., et al. A Guide to Modern Quantitative Fluorescent Western Blotting with Troubleshooting Strategies. Journal of Visualized Experiments. e52099 (2014).
  19. Volland, C., Urban-Grimal, D., Géraud, G., Haguenauer-Tsapis, R. Endocytosis and degradation of the yeast uracil permease under adverse conditions. Journal of Biological Chemistry. 269, 9833-9841 (1994).
  20. Barrass, J. D., et al. Transcriptome-wide RNA processing kinetics revealed using extremely short 4tU labeling. Genome Biology. 16, 282 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics