Justering nedbrydning for at opnå specifik og effektiv protein udtømning

Immunology and Infection
 

Summary

Her præsenterer vi en protokol til effektivt og specifikt nedbryder et protein af interesse i gær Saccharomyces cerevisiae ved hjælp af β-Est Aid system.

Cite this Article

Copy Citation | Download Citations

Barrass, J. D., Mendoza-Ochoa, G. I., Maudlin, I. E., Sani, E., Beggs, J. D. Tuning Degradation to Achieve Specific and Efficient Protein Depletion. J. Vis. Exp. (149), e59874, doi:10.3791/59874 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Anlægget auxin binding receptor, TIR1, genkender proteiner, der indeholder en specifik auxin-inducerbar degron (støtte) motiv i nærværelse af auxin, målrette dem for nedbrydning. Dette system udnyttes i mange ikke-plante eukaryoter, således at et målprotein, mærket med støtte motivet, nedbrydes ved auxin tilsætning. Niveauet for TIR1-udtrykket er kritisk. overdreven ekspression fører til nedbrydning af den hjælp-mærkede protein selv i fravær af auxin, mens lav ekspression fører til langsom udtømning. Der blev oprettet et β-østradiol-inducerbart støttesystem med ekspression af TIR1 under kontrol af en β-estradiol-inducerbar promotor. Niveauet af TIR1 er tunbart ved at ændre tidspunktet for inkubation med β-estradiol før auxin tilsætning. Denne protokol beskriver, hvordan man hurtigt nedbryder et målprotein ved hjælp af støttesystemet. Den rette inkubationstid for β-estradiol afhænger af den overflod af målproteinet. Derfor er effektiv udtynding afhængig af optimal timing, der også minimerer auxin-uafhængig nedbrydning.

Introduction

Betingede mutationer, såsom temperaturfølsomme mutanter, er et kraftfuldt værktøj til studiet af essentielle proteiner, der tillader cellevækst under den eftergivende tilstand, men forårsager tab af funktion under ikke-eftergivende betingelser. Men, cellemetabolisme kan være alvorligt forvirret af ændringen i vækstbetingelser, der kræves for at fremkalde defekten og kan også skabe off-Target effekter. Flere metoder er blevet udviklet, hvor proteinet af interesse er betinget afsondret1 eller dens udtryk er kontrolleret2,3 ved tilsætning af et lille molekyle. Denne protokol bruger auxin og det auxin-inducerbare degron (AID) system til effektivt at nedbryder et målprotein.

Støtteordningen har sin oprindelse i anlæg, hvor der anvendes en auxin (i denne protokol indol-3-eddikesyre (IAA)), stimulerer interaktionen mellem Aux/IAA-proteinet og TIR1, et medlem af SCF U3 ubiquitin ubiquitinligase Complex4. SCF Complex interaktion forårsager polyubiquitination af AUX/IAA familie proteiner, hvilket resulterer i deres nedbrydning af proteasomet5,6.

Dette system blev tidligere tilpasset til brug i gær Saccharomyces cerevisiae7,8 ved at udtrykke TIR1 protein fra Oriza sativa (ostir) i gærceller, hvor det er i stand til at interagere med den endogene gær SCF-kompleks. Det protein af interesse blev mærket med et motiv fra AUX/IAA protein IAA17 at målrette det for nedbrydning. Funktionelle trunkationer af IAA17 blev udviklet senere, såsom støtte *8,9,10, indeholdende 43 aminosyre auxin-følsomme motiv fra Arabidopsis thaliana IAA17, sammen med en epitop tag for at muliggøre Påvisning.

Systemet oprindeligt tilpasset til brug i spirende gær7,8 udtrykte osTIR1 protein fra en gær gal promotor. Udtryk kræver Skift til vækstmedium med galactose som den eneste kulstofkilde, som desværre resulterer i et diauxic Skift med vidtrækkende ændringer i cellemetabolisme11. På den anden side er det blevet rapporteret, at konstitutiv ekspression af TIR1 kan føre til nedbrydning af målproteinet i fravær af auxin/IAA12 , hvis udtryks niveauet er højt, HVORIMOD lavt TIR1 udtryk forårsager ineffektiv udtømning. Et forbedret støttesystem med navnet β-Est AID blev udviklet, hvor osTIR er under kontrol af en inducerbar promotor, der er tunable til at passe til målproteinet, med minimal effekt på cellernes metabolisme. For at opnå dette, en kunstig transkriptionsfaktor (ATF) blev konstrueret, hvor VP16 viral transskription aktivator er smeltet til en østrogen receptor og en fire Zn fingre DNA binding domæne (dbd). Når β-estradiol (et østrogen) er til stede, kan ATF trænge ind i kernen og inducere ostir transkriptionen ved at binde sig til sin promotor (Z4EVpr)13,12.

osTIR-ekspression er normalt detekterbar ca. 20 min efter tilsætning af β-østradiol12. Den optimale varighed af osTIR-ekspression for at opnå effektiv udtømning af det mærkede protein med auxin, samtidig med at man undgår nedbrydning før auxin-tilsætning, skal dog bestemmes empirisk for hvert målprotein. En omtrentlig tid for denne præ-inkubation kan estimeres ud fra forekomst værdier i Saccharomyces Genome databasen (SGD https://www.yeastgenome.org/). Som det kan ses i figur 1, det rigelige protein, Dcp1 (2880 til 4189 molekyler/celle), kræver 40 min præ-inkubation med β-estradiol, uden auxin-uafhængig nedbrydning observeret. Den meget mindre rigelige protein, Prp2 (172 til 211 molekyler/celle), er stærkt forarmet efter kun 20 min af præ-inkubation. Det er tilrådeligt at teste to yderligere præ-inkubationstider, 10 til 20 min før eller efter denne indledende anslåede tid (20 min er den mindste tid, der anbefales). Den optimale præ-inkubationstid er det tidspunkt, hvor målproteinet ikke er opbrugt, før du tilføjer auxin, og når auxin tilsættes, er nedbrydningen acceptabel, eller protein niveauerne nærmer sig det mindste mulige. Så fra figur 1b, for Prp22 med 30 min før inkubation, har niveauerne ikke faldet meget 10 min efter auxin tilsætning. Ved at sammenligne dette med 40 min før inkubation og 15 min med IAS, hvor der kun er lidt ekstra udtynding, er der ingen fordel ved at inkube med auxin længere end 10 min eller præinkuberet i mere end 30 minutter, især da der er tegn på ikke-auxin afhængig udtømning ved 40 min. For Dcp1 med 40 min præ-inkubation (det sidste punkt, hvor proteinniveauet er ca 100% før auxin tilsætning), 15 til 20 min af udtynding med auxin er acceptabelt. Det anbefales at holde nedbrydningen tid så kort som muligt at reducere sekundære virkninger på cellemetabolisme14.

Denne artikel viser, hvordan man bruger β-Est-hjælpesystemet ved at optimere timingen af β-estradiolinkubation for osTIR-ekspression for at opnå hurtig målprotein udtynding ved tilsætning af IAA uden nedbrydning, før auxin tilføjes.

Protocol

Bemærk: Se figur 2 for en grafisk oversigt.

1. klargøring af stammen

  1. Ved hjælp af en ura3-stamme indføres det β-Est-hjælpesystem (dvs. gener, der koder for den responderende β-estradiol-transskriptions faktor (ATF) og ostir), og støtte * tag målproteinet (Se figur 3 og tabel 1 for et resumé af proceduren).
    1. Transformér15 enten pZTRK (G418 Resistance markør) eller pZTRL (LEU2 markør) plasmid (tilgængelig fra gærdet genetiske Ressourcecenter) ind i ura3- gærstammen eller brug plasmid som en skabelon til at producere PCR-produktet til genomisk Integration.
    2. PCR forstærker ATF (markeret Z4EVATF på plasmid-kortet) og osTIR ved hjælp af en high fidelity-polymerase fra en af plasmiderne pZTRK eller pZTRL. Brug primere med 50 til 60 base 3 ' forlængelser med homologi til genomområdet, til direkte integration med homologe rekombination16. For genomintegration af de to komponenter enten separat eller sammen, se tabel 1 for primere og betingelser.
      Bemærk: Stammen pZ4EV-NTR1 har komponenterne, der allerede er integreret i genomet (fås fra gæren genetiske Ressourcecenter, Japan).
    3. Sørg for, at målproteinet er støtte * mærket med Longtine-proceduren17 (Se figur 3b og tabel 1).
    4. Der skal foretages en vækst analyse af stammen uden β-estradiol og IAS for at afgøre, om støtte *-mærket påvirker væksten og forudsige vækstraten til brug i trin 1,5.

2. generel procedure for udtømning

  1. Beregn, hvor meget kultur der kræves for alle prøver, der skal indsamles for eksempel er 10 mL kultur ved OD600 af 0,8 tilstrækkelig til protein-, RNA-og DNA-ekstraktion for en enkelt prøve, så for 6 prøver er der behov for mindst 60 ml kultur.
  2. Fra en overnight kultur, oprette tilstrækkelig ny kultur på OD600 0,1 til 0,2 og lad det vokse ved 30 °c. En rig medium såsom YPDA anbefales, selv om andre vækstbetingelser kan anvendes:
    Gær ekstrakt 10 g
    Pepton 20 g
    Glukose 20 g
    Adenin sulfat 40 mg
    H2O til 1 L

    Bemærk: Autoklave eller filter sterilisere; filter sterilisering foretrækkes som peptid/sukker komplekser fremstillet ved autoklavering bundfald i methanol, der anvendes i prøveopsamling.
  3. Forbered dig på at modtage prøverne.
    1. Der sættes 30 til 50% af den tilsigtede prøvemængde methanol i et rør. For eksempel, hvis der skal udtages en 10 mL prøve, lægges 5 mL methanol i en 15 mL Falcon tube og lukkes røret stramt. Når den er lukket, skal du mærke røret og sætte på tøris eller ved-80 °C for at slappe af.
      Forsigtig: Der dispenserer methanol i en stinkhætte.
    2. Etiketten 1,5 mL rør til langtidsopbevaring af prøverne og sted i is til afkøling.
    3. Cool nok H2O (mindst 1 ml pr. prøve) på is.
  4. Forudse kulturens vækst. Målod for indsamling af prøverne er ca. 0,7 til 0,8, men præ-inkubations trinnet (inkubationen med β-estradiol til at inducere osTIR) skal påbegyndes tidligere, så kulturen når omtrent den rigtige OD, når prøverne er Indsamlet.
    Bemærk: Det er tilrådeligt at foretage en vækstkurve i de betingelser, der skal anvendes i forsøget, således at denne start-OD kan estimeres.
  5. Når målod for starten af præ-inkubationen er nået, udtages en prøve (sædvanligvis 10 mL) i det forberedte rør, der indeholder kold methanol. Vend kort for at blande og placere tilbage i tøris.
    Bemærk: Prøven kan flyttes til vand is efter ca 5 min, hvis det er praktisk at gøre det.
  6. Tilsæt straks β-østradiol, 1 μL/mL kultur (slutkoncentration på 10 μM); har β-estradiol på forhånd målt i en pipette klar til brug for at reducere den tid, det tager at samleprøven og tilføje β-estradiol. Blandes hurtigt ved at hvirvlende kraftigt.
  7. Fortsæt med at dyrke kulturen som før (trin 2,2), Inkuber (dette er "præ-inkubations trinnet") med β-estradiol for den optimale tid (til bestemmelse af den optimale præ-inkubationstid Se figur 1).
  8. Forbered dig på at tilføje IAA (auxin). Tag den mængde IAA, der er nødvendig for trin 2,10 (dvs. 0,5 μL IAA pr. mL kultur). Dette gør trin 2,20 hurtigere.
  9. Saml en prøve som trin 2,5.
  10. Tilsæt straks IAA 0,5 μL/mL kultur til en endelig koncentration på 750 μM som fremstillet i trin 2,8. Blandes hurtigt ved at hvirvlende kraftigt.
  11. Saml prøver, som trin 2,5, i henhold til dit eksperimentelle design. Enten en enkelt prøve, på et tidspunkt, hvor det forventes, at proteinet vil blive pålideligt udtømt, eller flere prøver i et tidsforløb med udtømning. For eksempel er 5 minutters intervaller bekvemme for timing og giver en række protein niveauer. Optimerings strategien, som vist i figur 1, vil give en indikation af passende tidspunkter.
  12. Behandle prøverne.
    1. Placer prøverne på is, hvis det ikke allerede er gjort. Sikre, at ingen af prøverne er frosset Hvis de har, forsigtigt varm i hånden, invertering konstant, så temperaturen ikke stiger lokalt.
      Bemærk: Dette gøres bedst i hånden, da prøvens temperatur kan vurderes, bør den altid føles kold. Sted på is. Dette er ikke et pausepunkt-når alle prøverne er flydende, gå videre til næste trin.
    2. Når alle prøver er blevet indsamlet og ikke længere er frosne, spin ved 3.500 x g i 2 min (ved 4 °c hvis det er muligt).
    3. Hæld methanol/medium blandingen af, og Placer den på is igen. må ikke bekymre dig, hvis ikke alle væsken er blevet fjernet.
    4. Celle pellet opslæmmes i 1 mL iskold H2O (fra trin 2.3.3) og overføres til et mærket 1,5 ml rør (fremstillet i trin 2.3.2) på is.
    5. Spin kortvarigt (f. eks. 10 s samlet tid) ved > 15000 x g for at re-pellet cellerne, Placer tilbage på isen og fjern væsken.
    6. Fjern H2O ved aspiration. Cellen pellets kan opbevares ved-20 °C, eller-80 °C for langsigtet opbevaring.
  13. Kontrollér det niveau, som proteinet er blevet opbrugt af, ved Western blot Analysis18.
    Bemærk: Tilstrækkelig protein19 og/eller nukleinsyre kan udvindes fra en enkelt celle pellet til de fleste formål, selv om sjældne RNA-arter kan kræve mere prøvevolumen.

Representative Results

Repræsentative eksempler på udtynding vises i figur 1. De tre eksperimenter præsenteret i denne figur var optimering eksperimenter for udtømning af proteinerne Prp2, Prp22 og Dcp1. De lave overflod, spliceosomale Prp2 og Prp22 proteiner både forarmet til mindre end 20% efter 40 min præ-inkubation med β-estradiol efterfulgt af 15 min med auxin. Længere præ-inkubationstider fører til hurtigere udtynding, men viser også uønsket protein udtynding før auxin tilsætning. Til sammenligning, de mere rigelige Dcp1 var kun forarmet til ca 30% med samme behandling, men 60 min præ-inkubation resulterede i udtømning til 13% med den samme auxin behandling, på bekostning af udtømning, før auxin tilsættes. Det er muligt, at 50 min præ-inkubation med β-estradiol og 15 min med auxin ville have opnået lignende resultater på et kortere tidspunkt, og så ville have været mere optimal.

Figure 1
Figur 1: nedbrydningen kan justeres ved at moduere varigheden af β-estradiol præ-inkubation. Western blot18 af målproteiner: (a og b) PRP22-Aid *-6flag, (c og d) Prp2-Aid *-6flag, og (e og f) Dcp1-støtte *-6ha, fra kulturer, der er præinkuberet med β-estradiol (β-EST) for 20, 30, 40 eller 60 min før auxin addition12. Lige store mængder af totalt protein blev indlæst i hver vognbane. Pgk1 detekteres som en visuel loading kontrol, undtagen for panel e, hvor Pgk1 og Dcp1 Co-migrere. Kvantificering af protein båndene i panelerne a, c og e er vist i henholdsvis panelerne b, dog f . Som et mål for udtynding blev hældningen (m) beregnet for den lineære sektion (fra 100% til 30% af de oprindelige værdier) for hver kurve. Den optimale præ-inkubationstid er det tidspunkt, hvor protein niveauerne stadig er tæt på de FN-inducerede niveauer (100%) og den efterfølgende nedfiskning er hurtig. For Dcp1 (f) er 60 min før inkubation for lang, da proteinet er begyndt at nedbrydes i fravær af auxin, hvorimod 20 min er for kort, da proteinet ikke nedbryder mærkbart i dette tidsforløb. Efter 40 min præ-inkubation, 15 min med auxin kan anvendes som proteinet er ca 70% forarmet og, selv om 20 min ville resultere i yderligere udtømning, det kan også resultere i sekundære virkninger. Fejllinjer repræsenterer standardafvigelsen for to biologiske replikater. For hvert eksperiment vises en repræsentant blot. Dette tal stammer fra den foregående publikation9. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: grafisk oversigt. Tilsæt β-østradiol til tilstrækkelig kultur dyrkning i rigt medium og ved den ønskede temperatur for at starte præ-inkubation. Fortsætte væksten for den krævede præ-inkubationstid før tilsætning af IAA (auxin) til at starte udtømning. Præ-inkubationen og udtømnings tiderne afhænger af, at proteinet er opbrugt, men præ-inkubation er ofte i intervallet 20-60 min, og nedbrydningen er typisk i en rækkefølge fra 10 til 20 min. der skal udtages 10 mL prøver ved start og afslutning af præ-inkubationen og Durin- g nedbrydningen. Disse prøver fastsættes hurtigt i kold methanol før pelletering og oplagring. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: generering af stamme til B-Est-systemet. (a) for at generere en GÆRSTAMME med støtte * systemet, enten pZTRL (LEU2) eller pztrk (kanamycin (G418) resistens), plasmid bør indføres i stammen eller alternativt kan ATF og ostir indsættes i genomet ved homologt rekombination af et fragment genereret af PCR fra 3 ' ende primere (Se figur 3B og tabel 1). b) C-terminalens mærkning af målproteinet opnås ved PCR-forstærkning af den relevante region af plasmid-pURA3-Aid *-6flag (pURA3_AID *-6ha er kun forskellig i mærket og kan behandles på nøjagtig samme måde) ved hjælp af longtine primere S3-F og S2-R med 3 ' extensions homolog til 3 ' ende af målproteinet. Forlæns primer udvidelse bør omfatte den sidste aminosyre codon i ramme med starten af støtten * tag og må ikke omfatte stop codon. Den omvendte primer udvidelse bør være til en region nedstrøms for kodnings området. Når indsat i genomet, celler, der har mistet URA3 markør (ved homologe rekombination mellem de identiske områder fundet i begge ender af markøren) kan vælges ved vækst med 5-FOA, at Counter-vælger URA3 celler. Venligst klik her for at se en større version af dette tal.

a. primer-sekvenser
Mål Placering Primer Navn Sekvens TM (°C)
pZTRL 516 F pZTRL_F <-region af Homology-> GCGACAGCATCACCGACTTCG 61,23
7897 R pZTR_R Cgccgcctctaccttgcaga <-region of Homologi (RC)-> 61,30
pZTRK 9154 F pZTRK_F <-region af homologi-> ACGTTGAGCCATTAGTATCAATTTGCTTACC 59,40
5897 R pZTR_R Cgccgcctctaccttgcaga <-region of Homologi (RC)-> 61,30
pURA3-støtte *-6 flag eller pURA3_AID *-6HA F S3-F <-region af Homology-> CGTACGCTGCAGGTCGAC 59,21
R S2-R Atcgatgaattcgagctcg <-region of Homologi (RC)-> 52,76
pZRTL/K er at forstærke den β-Est støttesystem
pURA3-Aid *-6flag/6ha at forstærke støtten * og epitop tag at mærke målet protein (lontine procedure)
<-region for homologi-> Regioner, der er homologe, til de flankkende områder, hvor systemet skal indsættes. Jo længere denne region er, jo mere sandsynligt er det, at ændringen bliver en succes. 50-100 baser anbefales.
<-regionen Homologi (RC)-> Region homologe til de ledsage regioner, hvor systemet skal indsættes, Husk at bruge det omvendte supplement. Som ovenfor, jo længere denne region er bedre.
TM (°C) TM ved hjælp af metoden% GC med 50 mM NaCl
b. PCR mix
Komponent Volumen (μL)
Skabelon < 10
NEB Phusion HF buffer (5x) * 100
Fremad primer 100 μM 2,5
Omvendt primer 100 μM 2,5
dNTPs 10 mM hver 10
H2O til 500
* NEB Phusion GC buffer (5x) kan også bruges, men er ikke foretrukket
Denne blanding, opdelt i 10 rør af 50 μl blandes hver og udføre PCR som tabel 1 c.
Kontrollér, at PCR har virket ved at køre på en agrose gel
Kombinere alle vellykkede reaktioner i ét rør og ethanol bund fældelse
Omdanne gæren med alt det materiale, der produceres af PCR
c. PCR-betingelser
Trin Temp (°C) Tid
Indledende denaturering 98 30 s
25-35 cyklusser Denaturere 98 10 s
Anneal 45 – 60 20 s
Udvidelse 72 30 s/KB
Endelig udvidelse 72 10 min
Holde 8
Anneal ved 45 °C for Lontine primer-sættet (S3-F og S2-R) og 60 °C for pZTRL/K-primere
Forlæng i 3 minutter for Lontine PCR og 3 minutter for pZTRL/K

Tabel 1: primer-sekvenser, PCR-mix og PCR-betingelser.

Discussion

En godt optimeret protokol kan producere hurtig og effektiv udtømning af målproteinet. Det er vigtigt at bestemme den omtrentlige præ-inkubationstid med β-estradiol, da dette øger reproducerbarhed af nedbrydningen, men små variationer i præ-inkubationstiden kan tolereres. På den anden side skal man være forsigtig med timing efter auxin tilsætning, da proteinniveauet falder meget hurtigt.

En fordel ved denne fremgangsmåde er, at tunet udtynding kan opnås ved varierende kombinationer af præ-inkubationstid med β-estradiol og IAA inkubationstiden. For eksempel, hvis det ønskes, kan målproteinet være mere langsomt forarmet ved at reducere præ-inkubationstiden.

Det β-Este støttesystem giver visse fordele i forhold til systemer, hvor OsTIR udtrykkes i forfatningsgrad. Hvis målproteinet for eksempel er afgørende for levedygtigheden, kan det regulerede udtryk for osTIR undgå for tidlig udtømning af målproteinet. Desuden kan ekspression af osTIR indstilles til at passe til den overflod af målproteinet og dets modtagelighed for nedbrydning, og nedbrydningen kan enten være hurtig eller langsom. De to små molekyle efftorer, β-estradiol og auxin, ikke forstyrrer gær metabolisme under de betingelser, der anvendes her, i modsætning til Rapamycin, anvendes i anker-Away system1.

Det skal bemærkes, at tagging nogle proteiner forstyrrer deres funktion, hvilket er et problem med enhver målrettet nedbrydning system. I dette tilfælde kan et N-terminal-tag fungere, når et C-Terminal-tag ikke gør det. Også, ikke alle proteiner vil blive opbrugt effektivt; f. eks. kan støtte mærket på målproteinet være utilgængeligt for osTIR-proteinet. Derfor bør hvert målprotein efter støtte mærkning testes for enhver effekt af mærket på vækst og for at afgøre, om udtynding er effektiv, før timingerne af β-estradiol præ-inkubation og auxin-behandling optimeres.

Dette støttesystem er meget enkelt og er kompatibelt med enhver efterfølgende eksperimentel procedure, der ikke indebærer yderligere vækst, såsom protein, DNA eller RNA-analyse eller mikroskopi. Derudover fungerer systemet godt, når det kombineres med thiolabelling for at rense spirende RNA20.

Dette system giver en hurtig, specifik, og reproducerbare midler til at nedbryder et protein uden på anden måde påvirker metabolismen af gærcellen.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgments

Takket være Jane Reid for at starte dette program, Barbara Terlouw for udvikling, Vahid Aslanzadeh for "URA Looper" konstruktioner og Susana de Lucas for mange nyttige diskussioner. Dette arbejde blev støttet af et stipendium til GIMO fra Consejo Nacional de Ciencia y Tecnología, Mexico (CONACYT) og University of Edinburgh School of Biological Sciences, et Wellcome PhD-Studentship til IEM [105256] og af Wellcome-finansiering [104648] til JD Beggs . Arbejdet i Wellcome Center for Cell Biology understøttes af Wellcome Core-finansiering [092076].

Materials

Name Company Catalog Number Comments
Adenine sulphate Formedium DOC0230
Agar Formedium AGA03
Β-estradiol Sigma Aldrich E2758-1G 10 mM solution in ethanol. Store at -20 °C
DMSO Alfa Aesar 42780 DMSO should be solid at 4 °C
Glucose Fisher Scientific G/0500/60
IAA 1H-Indole-3-acetic acid Across Orgainics 122150100 Auxin analogue. 1.5 M in DMSO. The solution will be a russet colour and darken as time goes on; a deep red solution should be discarded and a new one made. Store at -20 °C.
Methanol Fisher Scientific M/4000/PC17 CAUTION Toxic and flammable
Phusion High-Fidelity DNA Polymerase NEB M0530
Peptone Formedium PEP03
SCSM single drop-out –ura Formedium DSCS101
Yeast Extract Formedium YEA03
Yeast nitrogen base without amino acids with amonium sulphate Formedium CYN0410

DOWNLOAD MATERIALS LIST

References

  1. Haruki, H., Nishikawa, J., Laemmli, U. K. The Anchor-Away Technique: Rapid, Conditional Establishment of Yeast Mutant Phenotypes. Molecular Cell. 31, 925-932 (2008).
  2. Bellí, G., Garí, E., Piedrafita, L., Aldea, M., Herrero, E. An activator/repressor dual system allows tight tetracycline-regulated gene expression in budding yeast. Nucleic Acids Research. 26, 942-947 (1998).
  3. Alexander, R. D., et al. RiboSys, a high-resolution, quantitative approach to measure the in vivo kinetics of pre-mRNA splicing and 3′-end processing in Saccharomyces cerevisiae. RNA. 16, 2570-2580 (2010).
  4. Deshaies, R. J., Joazeiro, C. A. P. RING Domain E3 Ubiquitin Ligases. Annual Review of Biochemistry. 78, 399-434 (2009).
  5. Tan, X., et al. Mechanism of auxin perception by the TIR1 ubiquitin ligase. Nature. 446, 640-645 (2007).
  6. Teale, W. D., Paponov, I. A., Palme, K. Auxin in action: signalling, transport and the control of plant growth and development. Nature Reviews Molecular Cell Biology. 7, 847-859 (2006).
  7. Nishimura, K., Fukagawa, T., Takisawa, H., Kakimoto, T., Kanemaki, M. An auxin-based degron system for the rapid depletion of proteins in nonplant cells. Nature Methods. 6, 917-922 (2009).
  8. Morawska, M., Ulrich, H. D. An expanded tool kit for the auxin-inducible degron system in budding yeast. Yeast. 30, 341-351 (2013).
  9. Kubota, T., Nishimura, K., Kanemaki, M. T., Donaldson, A. D. The Elg1 Replication Factor C-like Complex Functions in PCNA Unloading during DNA Replication. Molecular Cell. 50, 273-280 (2013).
  10. Brosh, R., et al. A dual molecular analogue tuner for dissecting protein function in mammalian cells. Nature Communications. 7, 11742 (2016).
  11. DeRisi, J. L., Iyer, V. R., Brown, P. O. Exploring the metabolic and genetic control of gene expression on a genomic scale. Science. 278, 680-686 (1997).
  12. Mendoza-Ochoa, G. I., et al. A fast and tuneable auxin-inducible degron for depletion of target proteins in budding. Yeast. (2018).
  13. McIsaac, R. S., et al. Synthetic gene expression perturbation systems with rapid, tunable, single-gene specificity in yeast. Nucleic Acids Res. 41, e57 (2013).
  14. Prusty, R., Grisafi, P., Fink, G. R. The plant hormone indoleacetic acid induces invasive growth in Saccharomyces cerevisiae. PNAS. 101, 4153-4157 (2004).
  15. Geitz, D., St Jean, A., Woods, R. A., Schiest, R. H. Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Research. 20, 1425 (1992).
  16. Widlund, P. O., Davis, T. N. A high-efficiency method to replace essential genes with mutant alleles in yeast. Yeast. 22, 769-774 (2005).
  17. Longtine, M. S., et al. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast. 14, 953-961 (1998).
  18. Eaton, S. L., et al. A Guide to Modern Quantitative Fluorescent Western Blotting with Troubleshooting Strategies. Journal of Visualized Experiments. e52099 (2014).
  19. Volland, C., Urban-Grimal, D., Géraud, G., Haguenauer-Tsapis, R. Endocytosis and degradation of the yeast uracil permease under adverse conditions. Journal of Biological Chemistry. 269, 9833-9841 (1994).
  20. Barrass, J. D., et al. Transcriptome-wide RNA processing kinetics revealed using extremely short 4tU labeling. Genome Biology. 16, 282 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics