Justering nedbrytning för att uppnå specifik och effektiv protein utarmning

Immunology and Infection
 

Summary

Här presenterar vi ett protokoll för att effektivt och specifikt bryter ett protein av intresse i jästen Saccharomyces cerevisiae med hjälp av β-Est stödsystemet.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Barrass, J. D., Mendoza-Ochoa, G. I., Maudlin, I. E., Sani, E., Beggs, J. D. Tuning Degradation to Achieve Specific and Efficient Protein Depletion. J. Vis. Exp. (149), e59874, doi:10.3791/59874 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Växten auxin bindande receptor, TIR1, erkänner proteiner som innehåller en specifik auxin-inducerbara degron (stöd) motiv i närvaro av auxin, riktade dem för nedbrytning. Detta system utnyttjas i många icke-plantera Eukaryoter, så att ett målprotein, märkta med stöd motiv, bryts ned vid auxin tillägg. Nivån på TIR1 uttryck är kritisk; överdrivet uttryck leder till nedbrytning av det stöd-märkta proteinet även i avsaknad av auxin, medan lågt uttryck leder till långsam utarmning. Ett β-estradiol-inducerbart stödsystem skapades, med uttryck för TIR1 under kontroll av en β-estradiol inducerbara promotor. Nivån på TIR1 är avstämbara genom att ändra tiden för inkubering med β-estradiol innan auxin tillägg. Detta protokoll beskriver hur man snabbt bryter ned ett målprotein med hjälp av stödsystemet. Den lämpliga β-estradiol inkubationstiden beror på överflödet av målproteinet. Därför, effektiv utarmning beror på optimal timing som också minimerar auxin oberoende utarmning.

Introduction

Villkorliga mutationer, såsom temperaturkänsliga mutanter, är ett kraftfullt verktyg för studiet av essentiella proteiner, vilket möjliggör celltillväxt under tillåtande tillstånd men orsakar förlust av funktion under icke-tillåtande förhållanden. Emellertid, cell metabolism kan vara allvarligt oroad av förändringen i tillväxtförhållanden som krävs för att inducera felet och kan också skapa off-mål effekter. Flera metoder har utvecklats, i vilka proteinet av intresse är villkorligt binds1 eller dess uttryck styrs2,3 genom tillsats av en liten molekyl. Detta protokoll använder auxin och det auxin-inducerbara degron (AID) systemet för att effektivt tömma ett målprotein.

Stödsystemet har sitt ursprung i växter, där en auxin (i detta protokoll indol-3-ättiksyra (IAA) används), stimulerar samspelet mellan AUX/IAA protein med TIR1, en medlem av SCF U3 ubiquitin Ligase Complex4. SCF Complex interaktion orsakar polvubiquitinering av AUX/IAA familj proteiner, vilket resulterar i deras nedbrytning av proteasom5,6.

Detta system har tidigare anpassats för användning i jästen Saccharomyces cerevisiae7,8 genom att uttrycka TIR1 protein från Oriza sativa (Ostir) i jästceller, där det kan interagera med endogena jäst SCF-komplexet. Proteinet av intressera var märket med en motiv från AUX/IAA proteinet IAA17 till måltavlan den för degradering. Funktionella trunkerade av IAA17 utvecklades senare, såsom stöd *8,9,10, som innehåller 43 Amino Acid auxin-känsligt motiv från Arabidopsis thaliana IAA17, tillsammans med en epitop tagg för att möjliggöra Upptäckt.

Systemet ursprungligen anpassat för användning i spirande jäst7,8 uttryckte osTIR1 protein från en jäst gal promotor. Uttrycket kräver förskjutning till odlingssubstrat med galaktos som enda kol källa, vilket tyvärr resulterar i en diauxisk förskjutning med omfattande förändringar i cellernas metabolism11. Å andra sidan har det rapporterats att konstitutivt uttryck för TIR1 kan leda till nedbrytning av målproteinet i avsaknad av auxin/IAA12 om uttrycksnivån är hög, medan lågt TIR1 uttryck orsakar ineffektiv utarmning. Ett förbättrat stödsystem som heter β-Est stöd utvecklades där Ostir är under kontroll av en inducerbar promotor som är avstämbara för att passa målproteinet, med minimal effekt på cellernas metabolism. För att uppnå detta, en konstgjord transkriptionsfaktor (ATF) konstruerades där VP16 viral transkription Activator är smält till en östrogen receptor och en fyra Zn Fingers DNA-bindande domän (DBD). När β-estradiol (ett östrogen) är närvarande, kan ATF komma in i kärnan och inducera Ostir transkription genom bindning till dess promotor (Z4EVpr)13,12.

Ouppståndelse uttryck är vanligtvis detekterbar ca 20 min efter tillsats av β-estradiol12. Emellertid, den optimala varaktigheten av osTIR uttryck för att uppnå effektiv utarmning av det taggade proteinet med auxin, samtidigt undvika utarmning innan auxin tillägg, måste vara empiriskt bestäms för varje målprotein. En ungefärlig tid för denna pre-inkubation kan uppskattas från överflöd värden i Saccharomyces Genome databas (SGD https://www.yeastgenome.org/). Som kan ses i figur 1, det rikliga proteinet, Dcp1 (2880 till 4189 molekyler/cell), kräver 40 min av pre-inkubering med β-estradiol, utan auxin-oberoende utarmning observerats. Den mycket mindre rikligt protein, Prp2 (172 till 211 molekyler/cell), är starkt utarmat efter bara 20 min före inkubering. Det är tillrådligt att testa två ytterligare pre-inkubationstider, 10 till 20 min före eller efter denna initiala Beräknad tid (20 min är den kortaste tid som rekommenderas). Den optimala pre-inkubationstiden är den tid då målproteinet inte har uttömda innan du lägger till auxin och en gång auxin tillsätts utarmning är acceptabelt eller proteinnivåer närma sig minsta möjliga. Så, från figur 1b, för Prp22 med 30 min av pre-inkubation, nivåerna har inte minskat mycket 10 min efter auxin tillägg. Jämföra detta med 40 min före inkubering och 15 min med IAA, där det finns lite ytterligare utarmning, det finns ingen fördel i inkubering med auxin längre än 10 min eller förinkuberande längre än 30 min, särskilt eftersom det finns tecken på icke-auxin beroende utarmning på 40 min. För Dcp1 med 40 min av pre-inkubation (den sista punkten vid vilken proteinnivån är cirka 100% innan auxin tillägg), 15 till 20 min av utarmning med auxin är acceptabelt. Det rekommenderas att hålla utarmning tid så kort som möjligt för att minska sekundära effekter på cellernas metabolism14.

Denna artikel visar hur man använder β-Est stödsystemet genom att optimera tidpunkten för β-estradiol inkubation för osTIR uttryck för att uppnå snabb målprotein utarmning på IAA tillägg utan utarmning innan auxin.

Protocol

Anmärkning: Se figur 2 för en grafisk Sammanfattning.

1. stamberedning

  1. Med hjälp av en ura3-stam, införa β-Est stödsystemet (dvs gener kodning av β-estradiol lyhörd transkription Factor (ATF) och Ostir) och stöd * tag målproteinet (se figur 3 och tabell 1 för en sammanfattning av förfarandet).
    1. Omvandla15 antingen pztrk (G418 Resistance marker) eller pztrl (LEU2 markör) plasmid (tillgänglig från jäst genetiska resurscentrum) i ura3- jäst stam eller använda plasmid som en mall för att producera PCR-produkt för genomisk Integration.
    2. PCR förstärker ATF (märkt Z4EVATF på plasmidkartan) och Ouppståndelse med hjälp av en HiFi-polymeras från någon av plasmiderna pZTRK eller pZTRL. Använd primers med 50 till 60 bas 3 ' förlängningar med homologi till genomisk regionen, att direkt integration av homolog rekombination16. För genomisk integration av de två komponenterna, antingen separat eller tillsammans, se tabell 1 för primers och villkor.
      Anmärkning: Stammen pZ4EV-NTR1 har de komponenter som redan är integrerade i genomet (tillgängliga från jäst genetiska resurscentrum, Japan).
    3. Se till att målproteinet är stöd * märkt med Longtine-proceduren17 (se figur 3b och tabell 1).
    4. Utföra en Tillväxtanalys på stammen utan β-estradiol och IAA närvarande för att avgöra om stödet * taggen påverkar tillväxten och att förutsäga tillväxttakt för användning i steg 1,5.

2. allmänt förfarande för utarmning

  1. Beräkna hur mycket kultur som krävs för att alla prover ska samlas in, till exempel, 10 mL kultur vid OD600 av 0,8 är tillräcklig för protein, RNA och DNA-extraktion för ett enda prov, så för 6 prover, minst 60 ml kultur behövs.
  2. Från en övernattning kultur, ställa in tillräcklig ny kultur på OD600 0,1 till 0,2 och låt växa vid 30 ° c. Ett rikt medium som YPDA rekommenderas, även om andra tillväxtförhållanden kan användas:
    Jästextrakt 10 g
    Pepton 20 g
    Glukos 20 g
    Adeninsulfat 40 mg
    H2O till 1 L

    Anmärkning: Autoklav eller filter sterilisera; filter sterilisering är att föredra som peptid/socker komplex som produceras av Autoklavera fällning i metanol som används i provinsamling.
  3. Förbered för att ta emot proverna.
    1. Sätt 30 till 50% av den avsedda provvolymen av metanol i ett rör. Om till exempel ett 10 mL-prov ska tas, Lägg 5 mL metanol i ett 15 mL Falcon-rör och Stäng röret tätt. När den är stängd, Märk röret och sätta på torris eller vid-80 ° c för att kyla.
      Försiktighet: Fördela metanol i ett draghuv.
    2. Etikett 1,5 mL rör för långtidsförvaring av proverna och placera i is för att kyla.
    3. Kyl tillräckligt med H2O (minst 1 ml per prov) på is.
  4. Förutse kulturens tillväxt. Målet OD för insamling av proverna är cirka 0,7 till 0,8, men pre-inkubering steg (inkubering med β-estradiol för att inducera Ouppståndelse), måste inledas tidigare så att kulturen kommer att nå ungefär rätt OD med den tid som proverna är Samlas in.
    Anmärkning: Det är tillrådligt att utföra en tillväxtkurva i de villkor som ska användas i experimentet så att denna start OD kan uppskattas.
  5. När mål-OD för början av pre-inkubationen har uppnåtts, ta ett prov (vanligtvis 10 mL), i det förberedda röret som innehåller kall metanol. Vänd kort för att blanda och placera tillbaka i torris.
    Anmärkning: Provet kan flyttas till vattenis efter ca 5 min, om det är lämpligt att göra det.
  6. Tillsätt omedelbart β-estradiol, 1 μL/mL kultur (slutlig koncentration av 10 μM); har β-estradiol pre-mätt i en pipett klar för användning för att minska den tid det tar mellan att samla in provet och lägga till β-estradiol. Blanda snabbt genom virvlande kraftigt.
  7. Fortsätta att odla kulturen som förut (steg 2,2), inkubera (detta är "pre-inkubering" steg) med β-estradiol för optimal tid (för bestämning av den optimala pre-inkubationstiden se figur 1).
  8. Förbered att lägga till IAA (auxin). Ta upp den volym av IAA som behövs för steg 2,10 (dvs. 0,5 μL av IAA per mL kultur). Detta gör steg 2,20 snabbare.
  9. Samla ett prov som steg 2,5.
  10. Tillsätt omedelbart IAA 0,5 μL/mL av kulturen till en slutlig koncentration av 750 μM som beretts i steg 2,8. Blanda snabbt genom virvlande kraftigt.
  11. Samla prover, som steg 2,5, enligt din experimentella design. Antingen ett enda prov, vid en tidpunkt då det förväntas att proteinet kommer att vara tillförlitligt utarmat, eller flera prover i en tid kurs av utarmning. Till exempel, 5 min intervall är bekvämt för timing och ge en rad proteinnivåer. Optimerings strategin, som visas i figur 1, kommer att ge en indikation på lämpliga tider.
  12. Bearbeta proverna.
    1. Placera proverna på is, om inte redan gjort. Se till att inget av proverna har frysts. om de har, försiktigt värma i handen, Invertera hela tiden så att temperaturen inte stiger lokalt.
      Anmärkning: Detta görs bäst i handen eftersom provets temperatur kan bedömas, det ska alltid kännas kallt. Plats på isen. Detta är inte en paus punkt-när alla prover är flytande, gå vidare till nästa steg.
    2. När alla prover har samlats in och inte längre är frysta, snurra på 3 500 x g för 2 min (vid 4 ° c om möjligt).
    3. Häll av metanol/medium mix och placera tillbaka på isen; oroa dig inte om inte all vätska har avlägsnats.
    4. Omsuspendera cellpelleten i 1 mL iskall H2O (från steg 2.3.3) och överför till ett märkt 1,5 ml-rör (berett i steg 2.3.2) på isen.
    5. Snurra kort (t. ex. 10 s total tid) på > 15000 x g för att åter pelleten cellerna, placera tillbaka på isen och ta bort vätskan.
    6. Ta bort H2O genom aspiration. Cell pellets kan förvaras vid-20 ° c, eller-80 ° c för långtidsförvaring.
  13. Kontrollera nivån som proteinet har utarmat av Western blot analys18.
    Anmärkning: Tillräckligt protein19 och/eller nukleinsyra kan extraheras från en enda cellpellet för de flesta ändamål, även om sällsynta RNA-arter kan kräva mer provvolym.

Representative Results

Representativa exempel på utarmning visas i figur 1. De tre experiment som presenteras i denna siffra var optimerings experiment för utarmning av proteinerna Prp2, Prp22 och Dcp1. Den låga överflöd, Spliceosomal Prp2 och Prp22 proteiner båda utarmade till mindre än 20% efter 40 min pre-inkubation med β-estradiol följt av 15 min med auxin. Längre pre-inkubationstider leda till snabbare utarmning men också visa oönskade protein utarmning innan auxin tillägg. I jämförelse, den mer rikliga Dcp1 var bara utarmat till cirka 30% med samma behandling, men 60 min av pre-inkubation resulterade i utarmning till 13% med samma auxin behandling, på bekostnad av utarmning innan auxin tillsätts. Det är möjligt att 50 min av pre-inkubation med β-estradiol och 15 min med auxin skulle ha uppnått liknande resultat på en kortare tid och så skulle ha varit mer optimalt.

Figure 1
Figur 1: utarmning kan justeras genom att modulera varaktigheten av β-estradiol före inkubering. Western blot18 av målproteiner: (a och b) PRP22-Aid *-6flag, (c och d) Prp2-stöd *-6flag, och (e och f) Dcp1-Aid *-6ha, från kulturer förinkuberat med β-estradiol (β-EST) för 20, 30, 40, eller 60 min före auxin tillägg12. Lika mängder totalt protein lastades i varje körfält. Pgk1 identifieras som en visuell inläsning kontroll, utom för panel e, där Pgk1 och Dcp1 sammigrera. Kvantifiering av protein banden i panelerna a, c och e visas i panelerna b, drespektive f . Som ett mått på utarmnings graden beräknades lutningen (m) för den linjära delen (från 100% till 30% av initiala värden) för varje kurva. Den optimala före inkubationstiden är den tid då proteinnivåerna fortfarande ligger nära de FN-inducerade nivåerna (100%) och den efterföljande graden av utarmning är snabb. För Dcp1 (f), 60 min av pre-inkubation är för lång, som proteinet har börjat brytas ned i avsaknad av auxin, medan 20 min är för kort, eftersom proteinet inte avsevärt bryter i denna tid kurs. Efter 40 min före inkubering, 15 min med auxin kan användas som proteinet är cirka 70% utarmat och, även om 20 min skulle resultera i ytterligare utarmning, det kan också resultera i sekundära effekter. Felstaplar representerar standardavvikelsen för två biologiska replikat. För varje experiment visas en representativ blot. Denna siffra kommer från tidigare publikation9. Vänligen klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: grafisk Sammanfattning. Tillsätt β-estradiol till tillräcklig kultur växer i rika medium och vid önskad temperatur för att starta pre-inkubering. Fortsätt tillväxten för önskad före inkubering tid innan du lägger IAA (auxin) att börja utarmning. Pre-inkubation och utarmning gånger beror på proteinet som skall utarmat, men pre-inkubation är ofta i intervallet 20-60 min och utarmning tid är typiskt i storleksordningen 10 till 20 min. 10 mL prover bör tas i början och slutet av pre-inkubering och Durin g den utarmning. Proverna fixeras snabbt i kall metanol före pelletering och förvaring. Vänligen klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: stamgenerering för B-Est systemet. (a) för att generera en jäststam med hjälp * systemet, antingen pZTRL (LEU2) eller pztrk (kanamycin (G418) resistens), plasmid bör införas i stammen eller, alternativt, ATF och Ostir kan sättas in i genomet genom homologa rekombination av ett fragment som genereras av PCR från 3 ' änd primers (se figur 3B och tabell 1). b) C-terminalmärkning av målproteinet uppnås genom PCR-förstärkning av lämplig region i plasmid PURA3-Aid *-6flag (pURA3_AID *-6ha skiljer sig endast i märkningen och kan behandlas på exakt samma sätt), med longtine primers S3-F och S2-R med 3 ' förlängningar homologa till 3 ' slutet av målproteinet. Den främre primer förlängningen bör innehålla den sista aminosyran kodon i ram med början av Aid * tag och får inte innehålla Stop kodon. Omvänd primer förlängningen bör vara att en region nedströms i kodnings regionen. När in i genomet, celler som har förlorat URA3 markör (genom homolog rekombination mellan de identiska regioner som finns i båda ändar av markören) kan väljas genom tillväxt med 5-FOA, som motverkar-väljer URA3 celler. Vänligen klicka här för att se en större version av denna siffra.

a. primer sekvenser
Mål Plats Primer Namn Sekvens TM (° c)
pZTRL 516 F pZTRL_F <-regionen för homologi-> GCGACAGCATCACCGACTTCG 61,23
7897 R pZTR_R CGCCGCCTCTACCTTGCAGA <-regionen för homologi (RC)-> 61,30
pZTRK 9154 F pZTRK_F <-regionen för homologi-> ACGTTGAGCCATTAGTATCAATTTGCTTACC 59,40
5897 R pZTR_R CGCCGCCTCTACCTTGCAGA <-regionen för homologi (RC)-> 61,30
pURA3-stöd *-6FLAGGA eller pURA3_AID *-6HA F S3-F <-regionen för homologi-> CGTACGCTGCAGGTCGAC 59,21
R S2-R ATCGATGAATTCGAGCTCG <-regionen för homologi (RC)-> 52,76
pZRTL/K är att förstärka den β-Est stödsystem
pURA3-stöd *-6flag/6ha att förstärka stödet * och epitop tagg för att märka målproteinet (lontine förfarande)
<-regionen homologi-> Region som är homolog mot de kompletterande regioner där systemet skall sättas in. Ju längre denna region är desto troligare är ändringen att bli framgångsrik; 50-100 baser rekommenderas.
<-regionen homologi (RC)-> Region homolog till de kompletterande regioner där systemet skall införas, kom ihåg att använda omvänd komplement. Som ovan, ju längre den här regionen är desto bättre.
TM (° c) TM med hjälp av metoden% GC med 50 mM NaCl
b. PCR-blandning
Komponent Volym (μL)
Mall < 10
NEB Phusion HF-buffert (5x) * 100
Framåt primer 100 μM 2,5
Omvänd primer 100 μM 2,5
dNTPs 10 mM vardera 10
H2O till 500
* Den NEB Phusion GC buffert (5x) kan också användas men är inte att föredra
Gör denna blandning, uppdelad i 10 tuber med 50 μl blandning vardera och utför PCR som tabell 1 c.
Kontrollera att PCR har fungerat genom att köra på en agaros gel
Kombinera alla lyckade reaktioner i ett rör och etanol fällningen
Omvandla jästen med allt material som produceras av PCR
c. PCR-villkor
Steg Temp (° c) Tid
Initial denaturering 98 30 s
25-35 cykler Denaturera 98 10 s
Glödga 45 – 60 20 s
Förlängning 72 30 s/KB
Final extension 72 10 min
Hålla 8
Anneal vid 45 ° c för Lontine primer set (S3-F och S2-R) och 60 ° c för pZTRL/K primers
Förläng 3 minuter för Lontine PCR och 3 minuter för pZTRL/K

Tabell 1: primer-sekvenser, PCR-mix och PCR-villkor.

Discussion

Ett väl optimerat protokoll kan ge snabb och effektiv utarmning av målproteinet. Bestämning av ungefärlig före inkubationstid med β-estradiol är viktigt, eftersom detta ökar reproducerbarhet av utarmning, men små variationer i pre-inkubationstiden kan tolereras. Å andra sidan, försiktighet måste iakttas med timing efter auxin tillägg, som proteinnivån minskar mycket snabbt.

En fördel med detta tillvägagångssätt är att trimmad utarmning kan uppnås genom varierande kombinationer av pre-inkubationstid med β-estradiol och IAA inkubationstid. Till exempel, om så önskas, målproteinet kan vara långsammare uttömda genom att minska pre-inkubationstiden.

Β-Est stödsystemet erbjuder vissa fördelar jämfört med system där Ouppståndelse är konstitutivt uttrycks. Om målproteinet till exempel är avgörande för lönsamheten kan det reglerade uttrycket av Ouppståndelse undvika för tidig utarmning av målproteinet. Dessutom kan uttrycket av osTIR justeras för att passa överflödet av målproteinet och dess känslighet för nedbrytning, och utarmningen kan vara antingen snabb eller långsam. De två små molekyl effektorer, β-estradiol och auxin, inte stör jästen metabolism under de villkor som används här, till skillnad från rapamycin, som används i ankare-away system1.

Det bör noteras att märka vissa proteiner stör deras funktion, vilket är ett problem med någon riktad utarmning system. I det här fallet kan en N-Terminal-tagg fungera när en C-Terminal-tagg inte. Också, inte alla proteiner kommer att utarmat effektivt; till exempel, stöd-taggen på målproteinet kan vara otillgängliga för osTIR protein. Därför, efter stöd-märkning, bör varje målprotein testas för någon effekt av taggen på tillväxt, och för att avgöra om utarmning är effektiv, innan timings av β-estradiol pre-inkubation och auxin behandling optimeras.

Detta stöd * system är mycket enkelt och är förenligt med alla efterföljande experimentella förfaranden som inte innebär ytterligare tillväxt, såsom protein, DNA eller RNA-analys eller mikroskopi. Dessutom fungerar systemet bra i kombination med tiolabelling att rena begynnande RNA20.

Detta system ger en snabb, specifik, och reproducerbara sätt att tömma ett protein utan att annars påverka metabolismen av jästcellen.

Disclosures

Författarna har inget att avslöja.

Acknowledgments

Tack till Jane Reid för att initiera detta program, Barbara Terlouw för utveckling, Vahid Aslanzadeh för "URA Looper" konstruktioner och Susana de Lucas för många hjälpsamma diskussioner. Detta arbete stöddes av ett stipendium till GIMO från Consejo Nacional de Ciencia y Tecnología, Mexiko (CONACYT) och University of Edinburgh school of Biological Sciences, en Wellcome Doktorandanställning till IEM [105256] och av Wellcome finansiering [104648] till JD Beggs . Arbetet i Wellcome centrum för cell bio Logi stöds av Wellcome Core-finansiering [092076].

Materials

Name Company Catalog Number Comments
Adenine sulphate Formedium DOC0230
Agar Formedium AGA03
Β-estradiol Sigma Aldrich E2758-1G 10 mM solution in ethanol. Store at -20 °C
DMSO Alfa Aesar 42780 DMSO should be solid at 4 °C
Glucose Fisher Scientific G/0500/60
IAA 1H-Indole-3-acetic acid Across Orgainics 122150100 Auxin analogue. 1.5 M in DMSO. The solution will be a russet colour and darken as time goes on; a deep red solution should be discarded and a new one made. Store at -20 °C.
Methanol Fisher Scientific M/4000/PC17 CAUTION Toxic and flammable
Phusion High-Fidelity DNA Polymerase NEB M0530
Peptone Formedium PEP03
SCSM single drop-out –ura Formedium DSCS101
Yeast Extract Formedium YEA03
Yeast nitrogen base without amino acids with amonium sulphate Formedium CYN0410

DOWNLOAD MATERIALS LIST

References

  1. Haruki, H., Nishikawa, J., Laemmli, U. K. The Anchor-Away Technique: Rapid, Conditional Establishment of Yeast Mutant Phenotypes. Molecular Cell. 31, 925-932 (2008).
  2. Bellí, G., Garí, E., Piedrafita, L., Aldea, M., Herrero, E. An activator/repressor dual system allows tight tetracycline-regulated gene expression in budding yeast. Nucleic Acids Research. 26, 942-947 (1998).
  3. Alexander, R. D., et al. RiboSys, a high-resolution, quantitative approach to measure the in vivo kinetics of pre-mRNA splicing and 3′-end processing in Saccharomyces cerevisiae. RNA. 16, 2570-2580 (2010).
  4. Deshaies, R. J., Joazeiro, C. A. P. RING Domain E3 Ubiquitin Ligases. Annual Review of Biochemistry. 78, 399-434 (2009).
  5. Tan, X., et al. Mechanism of auxin perception by the TIR1 ubiquitin ligase. Nature. 446, 640-645 (2007).
  6. Teale, W. D., Paponov, I. A., Palme, K. Auxin in action: signalling, transport and the control of plant growth and development. Nature Reviews Molecular Cell Biology. 7, 847-859 (2006).
  7. Nishimura, K., Fukagawa, T., Takisawa, H., Kakimoto, T., Kanemaki, M. An auxin-based degron system for the rapid depletion of proteins in nonplant cells. Nature Methods. 6, 917-922 (2009).
  8. Morawska, M., Ulrich, H. D. An expanded tool kit for the auxin-inducible degron system in budding yeast. Yeast. 30, 341-351 (2013).
  9. Kubota, T., Nishimura, K., Kanemaki, M. T., Donaldson, A. D. The Elg1 Replication Factor C-like Complex Functions in PCNA Unloading during DNA Replication. Molecular Cell. 50, 273-280 (2013).
  10. Brosh, R., et al. A dual molecular analogue tuner for dissecting protein function in mammalian cells. Nature Communications. 7, 11742 (2016).
  11. DeRisi, J. L., Iyer, V. R., Brown, P. O. Exploring the metabolic and genetic control of gene expression on a genomic scale. Science. 278, 680-686 (1997).
  12. Mendoza-Ochoa, G. I., et al. A fast and tuneable auxin-inducible degron for depletion of target proteins in budding. Yeast. (2018).
  13. McIsaac, R. S., et al. Synthetic gene expression perturbation systems with rapid, tunable, single-gene specificity in yeast. Nucleic Acids Res. 41, e57 (2013).
  14. Prusty, R., Grisafi, P., Fink, G. R. The plant hormone indoleacetic acid induces invasive growth in Saccharomyces cerevisiae. PNAS. 101, 4153-4157 (2004).
  15. Geitz, D., St Jean, A., Woods, R. A., Schiest, R. H. Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Research. 20, 1425 (1992).
  16. Widlund, P. O., Davis, T. N. A high-efficiency method to replace essential genes with mutant alleles in yeast. Yeast. 22, 769-774 (2005).
  17. Longtine, M. S., et al. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast. 14, 953-961 (1998).
  18. Eaton, S. L., et al. A Guide to Modern Quantitative Fluorescent Western Blotting with Troubleshooting Strategies. Journal of Visualized Experiments. e52099 (2014).
  19. Volland, C., Urban-Grimal, D., Géraud, G., Haguenauer-Tsapis, R. Endocytosis and degradation of the yeast uracil permease under adverse conditions. Journal of Biological Chemistry. 269, 9833-9841 (1994).
  20. Barrass, J. D., et al. Transcriptome-wide RNA processing kinetics revealed using extremely short 4tU labeling. Genome Biology. 16, 282 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics