Deaktivere spark: CRISPR/Cas9 Genova redigere i svakt Electric Fish

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Her er en protokoll presentert for å produsere og bak CRISPR/Cas9 Genova knockout elektrisk fisk. Skissert i detalj er nødvendig molekylærbiologi, avl og oppdrett krav til både en gymnotiform og en mormyrid, og injeksjon teknikker for å produsere Cas9-indusert indel F0 larver.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Constantinou, S. J., Nguyen, L., Kirschbaum, F., Salazar, V. L., Gallant, J. R. Silencing the Spark: CRISPR/Cas9 Genome Editing in Weakly Electric Fish. J. Vis. Exp. (152), e60253, doi:10.3791/60253 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Electroreception og electrogenesis har endret seg i evolusjons historien til virveldyr. Det er en slående grad av konvergens i disse uavhengig avledet fenotyper, som deler en felles genetisk arkitektur. Dette er kanskje best illustrert av de mange konvergent funksjonene i gymnotiforms og mormyrids, to arter-rik tetramerisk klader som produserer og oppdager svake elektriske felt og kalles svakt elektrisk fisk. I 50 år siden oppdagelsen at svakt elektrisk fisk bruker elektrisitet til å fornemme sine omgivelser og kommunisere, et voksende fellesskap av forskere har fått enorm innsikt i utviklingen av utvikling, systemer og kretser nevrovitenskap, cellulære fysiologi, økologi, evolusjonære biologi og atferd. Flere nylig har det vært en spredning av genomisk ressurser for elektrisk fisk. Bruk av disse ressursene har allerede tilrettelagt viktig innsikt med hensyn til sammenhengen mellom genotype og fenotype i disse artene. Et stort hinder for å integrere Genomics data med fenotypiske data av svakt elektrisk fisk er en gave mangel på funksjonelle Genomics verktøy. Vi rapporterer her en full protokoll for å utføre CRISPR/Cas9 mutagenese som utnytter endogene DNA reparasjon mekanismer i svakt elektrisk fisk. Vi viser at denne protokollen er like effektiv i både mormyrid arter Brienomyrus brachyistius og gymnotiform Brachyhypopomus GAUDERIO ved hjelp CRISPR/Cas9 å målrette indeler og punkt mutasjoner i den første ekson av natrium kanal gen scn4aa. Ved hjelp av denne protokollen ble embryo fra begge artene innhentet og genotyped for å bekrefte at de anslåtte mutasjoner i den første ekson av natrium kanalen scn4aa var til stede. Den Knock-Out suksess fenotype ble bekreftet med opptak viser redusert elektrisk organ utladning amplituder sammenlignet med uninjected størrelse matchet kontroller.

Introduction

Electroreception og electrogenesis har endret seg i evolusjons historien til virveldyr. To linjene av tetramerisk fisk, visninger og Maller, utviklet electroreception parallelt, og fem linjene av teleosts (Gymnotiformes, mormyrids, og slekter Astroscopus, Malapterurus og Synodontis) utviklet seg electrogenesis parallelt. Det er en slående grad av konvergens i disse uavhengig avledet fenotyper, som deler en felles genetisk arkitektur1,2,3.

Dette er kanskje best illustrert av de mange konvergent funksjonene i gymnotiforms og mormyrids, to arter-rik tetramerisk klader, som produserer og oppdager svake elektriske felt og kalles svakt elektrisk fisk. I 50 år siden oppdagelsen at svakt elektrisk fisk bruker elektrisitet til å fornemme sine omgivelser og kommunisere4, et voksende fellesskap av forskere har fått enorm innsikt i utviklingen av utviklingen1,5 ,6, systemer og kretser nevrovitenskap7,8,9,10, cellular fysiologi11,12, økologi og energi13 ,14,15,16,17, atferd18,19, og makroevolusjon3,20,21 .

Mer nylig har det vært en spredning av genomisk, transcriptomic, og Proteomikk ressurser for elektrisk fisk1,22,23,24,25,26, 27,28. Bruk av disse ressursene har allerede produsert viktig innsikt om sammenhengen mellom genotype og fenotype i disse artene1,2,3,28,29 ,30. Et stort hinder for å integrere Genomics data med fenotypiske data av svakt elektrisk fisk er en gave mangel på funksjonelle Genomics verktøy31.

Et slikt verktøy er den nylig utviklet gruppert regelmessig oppdelt Short Palindromic gjentar sammenkoblet med Cas9 endonuclease (CRISPR/Cas9, CRISPR) teknikk. CRISPR/Cas9 er en Genova redigere bort verktøyet det har inngikk utstrakt bruk inne begge to modell32,33,34 og ingen-modell organisere35,36,37 ens. CRISPR/Cas9 teknologi har kommet til et punkt der et laboratorium i stand til grunnleggende molekylærbiologi kan lett generere gen-spesifikke sonder kalt kort guide RNAs (sgRNAs), til en lav kostnad ved hjelp av en ikke-kloning metode38. CRISPR har fordeler fremfor andre knockout/knockdown strategier, slik som morpholinos39,40, transkripsjon aktivator-lignende effektor nukleaser (TALENs), og sink finger nukleaser (zfner), som er kostbare og tidkrevende å generere for hvert mål genet.

Den CRISPR/Cas9 System funksjoner for å skape genet Knockouts ved å målrette en bestemt region av Genova, regissert av sgRNA sekvensen, og forårsaker en dobbel-strandet pause. Den doble strandet pause oppdages av cellen og utløser endogene DNA reparasjon mekanismer fortrinnsvis bruker ikke-homologe slutten sammenføyning (NHEJ) veien. Denne veien er svært feil utsatt: under reparasjonsprosessen, DNA-molekylet vil ofte innlemme innsettinger eller slettinger (indeler) på dobbel-strandet pause området. Disse indeler kan føre til tap av funksjon på grunn av enten (1) Skift i den åpne lese RAM men, (2) innsetting av en for tidlig stopp-Codon, eller (3) endringer i den kritiske primære strukturen av genet produktet. I denne protokollen, bruker vi CRISPR/Cas9 redigering til målet punkt mutasjoner i målet gener ved hjelp av NHEJ i svakt elektriske fiskearter. Mens enklere og mer effektiv enn andre teknikker, er denne metoden for mutagenese forventes å resultere i en rekke fenotypiske alvorlighetsgradene i F0, som er tilskrevet genetisk mosaikk41,42,43 ,44.

Utvalg av organismer
For å tilrettelegge fremtidige studier på komparativ Genomics av svakt elektrisk fisk, en representativ arter for både gymnotiforms og mormyrids for protokoll utvikling nødvendig for å bli valgt. Etter diskusjoner i løpet av 2016 Electric Fish møte i Montevideo, Uruguay, det var samfunnet konsensus for å utnytte arter som allerede kan bli avlet i laboratoriet og som hadde genomisk ressurser tilgjengelig. Den gymnotiform Brachyhypopomus gauderio og mormyrid Brienomyrus brachyistius ble valgt som arter som passer disse kriteriene. I begge artene er naturlige indikatorer for å indusere og opprettholde avl forhold lett å etterligne i fangenskap. B. gauderio, en gymnotiform Art fra Sør-Amerika, har fordelen av krav til lav husdyrhold: fisk kan oppbevares ved relativt høy tetthet i relativt små (4 L) tanker. B. gauderio har også rask generasjonsskifte omsetning under forhold med fange. Under laboratorieforhold, kan B. gauderio utvikle seg fra egg til voksen i ca 4 måneder.

B. brachyistius, en art av mormyrid fisk fra Vest-Sentral-Afrika, raser lett i fangenskap. B. brachyistius er lett tilgjengelig gjennom akvariet handelen, har vært mye brukt i mange studier, og har nå en rekke genomisk ressurser tilgjengelig. Deres livssyklus spenner over 1 − 3 år, avhengig av laboratorieforhold. Kravene til reindrift er noe mer intensive for denne arten, som krever moderat store tanker (50 − 100 L) på grunn av aggresjon under avl.

Laboratorier som studerer andre arter av elektrisk fisk skal kunne enkelt tilpasse denne protokollen så lenge arten kan være avlet, og enkelt celle embryo kan samles og oppvokst i voksen alder. Boliger, larvestadiet husdyrhold, og in vitro befruktning (IVF) priser vil trolig endres med andre arter; Imidlertid kan denne protokollen brukes som et utgangspunkt for avl forsøk i andre svakt elektrisk fisk.

En ideal Gene mål for Proof av begrep: scn4aa
Svakt elektrisk mormyrid og gymnotiform fisk genererer elektriske felt (electrogenesis) ved å tømme en spesialisert organ, kalt elektrisk organ. Elektriske orgel utslipp (EODs) er et resultat av samtidig produksjon av handlings potensialer i de elektriske organ cellene som kalles electrocytes. EODs oppdages av en rekke elektroreseptorer i huden for å lage høyoppløselige elektriske bilder av Fiskene omgivelser45. Svakt elektrisk fisk er også i stand til å oppdage funksjoner i deres conspecifics ' EOD bølgeformer18 så vel som deres utslipp priser46, slik at EODs å fungere i tillegg som en sosial kommunikasjon signal analoge til fuglesang eller frosk vocalizations47.

En hovedkomponent i aksjon potensiell generasjon i electrocytes av både mormyrid og gymnotiform svakt elektrisk fisk er spenning-gated natrium kanal NaV 1.42. Ikke-elektriske teleosts uttrykker to paralogous gen kopier, scn4aa og scn4ab, koding for spennings-gated natrium kanal NAV 1.430. I både gymnotiform og mormyrid svakt elektrisk fisk linjene, scn4aa har utviklet seg raskt og gjennomgått mange aminosyre erstatninger som påvirker dens kinetisk egenskaper48. Viktigst, scn4aa har blitt compartmentalized i begge linjene til elektrisk organ2,3. Den relativt begrensede uttrykk for scn4aa til elektrisk organ, så vel som sin nøkkelrolle i generasjonen av EODs, gjør det til et ideelt mål for CRISPR/Cas9 knockout eksperimenter, som det har minimal skadelige pleiotropic effekter. Fordi svakt elektrisk fisk begynner å tømme sine larvestadiet elektriske organer 6 − 8 dager etter befruktning (DPF), er målretting av scn4aa ideell for rask bestemmelse av fenotype etter embryo microinjection.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle metoder beskrevet her over ha blitt anerkjent av det institusjonell dyr bekymre og bruk komité (IACUC) av Michigan begrunne universitet.

1. velge sgRNA mål

Merk: En protokoll er gitt for manuell utforming av sgRNAs i trinn 1,1. Dette ble benyttet for scn4aa Target valg. En ekstra protokoll er gitt for å forenkle denne prosessen (trinn 1,2) ved hjelp av EFISHGENOMICS webportal. Det anbefales at brukerne velger protokollen 1,2, som har flere automatiserte "sjekker" for å sikre suksess i utformingen sgRNAs for tilpassede mål.

  1. Design sgRNA mål.
    1. For å generere sgRNA guide oligos, er det best å målrette ekson 1, eller andre 5 ' exoner. De 5 ' UTR kan være målrettet; Det er imidlertid best å målrette 5 ' koding sekvens. Bruk av genomisk informasjon er å foretrekke, men det er mulig å utvikle vellykkede sgRNAs ved hjelp av transcriptome data. Kommentarer av Intronets opprinnelse/ekson grenser (genomisk data) eller ekson/ekson grenser er å foretrekke.
    2. Kandidat genomisk sekvenser fra 1,1 er søkt etter antatte mål sekvenser som samsvarer med mønsteret 5 '-N (18)-NGG-3 '. Dette kan automatisk utføres ved hjelp av desktop sekvens analyseprogramvare, egendefinerte skript, eller gjennom manuell inspeksjon av sekvenser.
    3. Sekvenser kan prioriteres ved hjelp av metoden for Doench et al.49 for on-Target aktivitet. I tillegg kan mål-sekvenser evalueres av et BLAST-søk mot genomisk/transcriptomic databaser for av-mål-binding.
    4. Sørg for at standard PCR-primere kan genereres som flanke mål sekvensen. Primere bør være minst 20 BP fra hver side av kuttet området (tre baser oppstrøms av NGG sekvensen). Ideelt sett bør PCR-produktet være 150 − 200 basis par (BP).
    5. Design oligomers møte kriteriene ovenfor ved hjelp av malen nedenfor, som inkluderer en T7 promoter (5 ' av N18) og en komplementær region (3 ' av n18) for annealing til konstant oligomer (1.1.6): 5 '-TAATACGACTCACTATAGG-N18 -GTTTTAGAGCTAGAAATAGCAAG-3 '
      Merk: N18 sekvensen omfatter ikke NGG PROTOSPACER tilstøtende motiv (Pam) sekvensen. Ikke Inkluder dette i oligomer.
    6. Bestill den konstante oligomer (tabell 1) som skal brukes til å syntetisere alle sgRNAs, Oligomers for sgRNA-mål (trinn 1.1.5) og PCR-primere (Step 1.1.4) som standard avsalte oligomers fra en oligonukleotid produksjonstjeneste. Oligomers og PCR-primere kan bestilles som standard avsalte Oligomers, ingen ytterligere rensing er nødvendig.
  2. Utfør Automatisert utforming av sgRNA-mål.
    1. Velg et mål gen ved hjelp av genomisk data. Transcriptome data kan brukes i stedet når ekson/Intronets opprinnelse grenser er kjent. Mål kan identifiseres ved hjelp av EFISHGENOMICS-portalen (http://efishgenomics.integrativebiology.msu.edu). Det ideelle målet vil være innenfor ekson 1; Imidlertid, annet 5 ' exoner og det 5 ' UTR kan betraktet som.
    2. Når målet sekvensen er identifisert, laste fritt tilgjengelig EFISHGENOMICS CRISPR Web verktøy (http://efishgenomics.integrativebiology.msu.edu/crispr_tool/). Dette Web verktøyet bruker en tilpasset versjon av CRISPOR algoritmen for mål generering50,51.
    3. I boksen for trinn 1skriver du inn navnet på sekvensen og angir mål sekvensen i den aktuelle boksen.
  3. Velg de aktuelle Genova som sekvensen er avledet fra. For øyeblikket er genomisk data tilgjengelig for b. brachyistius og b. gauderio. Genova sekvenser er ikke krevde for bruk av denne verktøyet bortsett fra er nyttig inne vurderingen muligheter uønsket av-mål virkninger.
  4. Velg riktig PAM. De 20 BP-NGG PAM anbefales, men det er flere ekstra PAM motiver å velge mellom, avhengig av Cas9 proteinet som brukes.
  5. En rapport vil bli generert med plasseringen av mål sekvensen i Genova med foreslåtte guide sekvenser. Velg tre mål med lav anslått off-mål effekter, høy spesifisitet score, og høy effektivitet score. De høyest rangerte guide sekvensene er uthevet med grønn på venstre side. Gule og røde markerte guide sekvenser bør unngås, hvis mulig.
  6. Ved å klikke på valgte mål sekvenser genereres en omfattende CRISPOR-rapport. Nøkkelinformasjon fra disse rapportene er for "T7 in vitro-uttrykk fra overlappende oligonukleotider". Fra denne rapporten kan du trekke ut følgende informasjon: anbefalte sgRNA-oligos, PCR-primere for målområdet og en konstant oligomer som skal brukes til å syntetisere alle sgRNAs.
  7. Bestill den valgte oligomers (trinn 1,6) fra en oligonukleotid produksjonstjeneste. Oligomers og PCR-primere kan bestilles som standard avsalte Oligomers, ingen ytterligere rensing er nødvendig.

2. Generer sgRNA

  1. Anneal oligomers i PCR-rør: Tilsett 1 μL av 100 μM konstant oligomer, 1 μL av 100 μM sgRNA spesifikke oligomer, og 8 μL av nuklease-fri H2O
  2. Anneal oligomers i en thermocycler med følgende program: varme ved 95 ° c i 5 min, kjølig til 85 ° c ved-2 ° c/s, kjølig til 25 ° c ved 0,1 ° c/s, og hold ved 4 ° c.
  3. For å generere sgRNA mal, tilsett 2,5 μL av dNTP mix (10 mM), 2 μL av 10x buffer, 0,5 μL av T4 DNA polymerase, og 5 μL av nuklease-Free H2O til glødet oligomers fra trinn 2,2. Ruge for 20 min ved 12 ° c.
  4. Rens malen ved å bruke en PCR-opprydding-kolonne i henhold til produsentens instruksjoner.
  5. Eluere på 20 – 30 μL. Bruk en spektrofotometer til å anslå konsentrasjon og renhet. Malen skal være 100 – 200 ng/μL og 1,8 – 1,9 A260/280.
  6. Kontroller via en agarose gel ved å kjøre 1 – 5 μL. Den dominerende band bør være 120 BP. Se figur 1a for representative resultater.
  7. Oppbevar gel-verifisert sgRNA-mal ved-20 ° c (lang sikt) eller 4 ° c (kort sikt, 1 – 4 uker).
  8. Transkribere sgRNA bruker T7 RNA transkripsjon Kit ved å legge til en 1,5 mL mikrosentrifugen rør ved romtemperatur 8 μL av dNTP mix (lik volumer av dA, dT, dG, dC), 2 μL av 10x buffer (romtemperatur), 2 μL av T7 RNA polymerase, 100-200 ng av sgRNA mal og nuklease H2O til 20 μL total volum. Spin å samle på bunnen. Ruge for 2 – 4 timer ved 37 ° c.
  9. Tilsett 1 μL av DNase og ruge ytterligere 15 min ved 37 ° c.
    1. Rydd opp i sgRNA ved å tilsette 1 μL av glykogen, 30 μL nuklease-fri H2O, 30 μL av 5 M ammonium acetate og 180 μL av 100% EtOH til å transkribere sgRNA. Bland godt og ruge minst 20 min ved-80 ° c (til frosset) eller ved-20 ° c over natten. Sentrifuger ved 4 ° c i 15 minutter med maksimal hastighet.
  10. Fjern og kast supernatanten uten å forstyrre pellet, og vask med 1 mL RNase-Free 70% EtOH kjølt ved-20 ° c. Snurr ytterligere 5 minutter med maksimal hastighet ved 4 ° c.
  11. Fjern og kast supernatanten uten å forstyrre pellet, og luft-tørke pellet i 5 min.
  12. Resuspend i 30 μL av nuklease-fri H2O og Bestem renhet og utbytte ved bruk av UV-spektroskopi (minimum utbytte på 200 ng/μL).
  13. Kontroller tilstedeværelsen av sgRNA på en RNase-fri gel. SgRNA vises mellom 50 og 150 BP som to band på grunn av den sekundære strukturen (figur 1B).
  14. Alikvot inn i 3 μL og oppbevares ved-80 ° c.

3. validere kutte effektivitet in vitro

  1. Pakk ut genomisk DNA fra mål artene ved hjelp av et kommersielt DNA-avsugs sett. Ventrale fin gresset kan brukes uten å måtte ofre fisken, fordi vevet er generert.
  2. Forsterke målet DNA regionen ved hjelp av primere utformet som beskrevet i trinn 1,6 og 1,7 ved hjelp av standard PCR. Kontroller produktet med gel elektroforese. Sekvensering fragmentet for å sikre at riktig region blir forsterket foreslås, men ikke nødvendig. Representative resultater for scn4aa -malen vises i figur 2.
  3. Rydd opp i PCR-fragmentet med en etablert laboratorie-eller firma protokoll.
  4. Oppbevar det forsterkede DNA ved-20 ° c. Vurder å skille den i alikvoter for å redusere fryse-tine sykluser.
  5. Bestem de nødvendige beløpene og volumene for hver komponent. Vurder å kjøre negative kontroller (unntatt enten sgRNA eller Cas9) og en positiv kontroll (en tidligere testet sgRNA som kløyver målet PCR forsterket DNA) hvis tilgjengelig, samt en konsentrasjon serie av sgRNA.
  6. Sett opp reaksjonsblandingen nedenfor i den spesifiserte rekkefølgen i et PCR-rør ved romtemperatur, og Legg til sgRNA-og Cas9-proteinet for best resultat: 50 – 100 ng av målet DNA PCR-produkt, 1 μL av 10x buffer 3, 1 μL av 10x BSA (0,1 g/mL) , 50 – 200 ng av Cas9 protein (1 mg/mL, 150 ng foreslo), og 30 – 200 av ng sgRNA (100 ng foreslo).
    1. Ruge reaksjonen ved 37 ° c i 1 time og deretter ved 65 ° c i 10 min for å deaktivere Cas9 protein.
    2. Kjør hele prøven på en 2%-3% agarose gel (forventet bandet størrelser mellom 30-200 BP) sammen med positive og negative kontroller. Vellykket kløft kan vise noen av PCR produktet, men vil også ha to mindre band. Representative resultater er vist i figur 2.

4. innhenting av embryo

Merk: Innhenting av embryo av svakt elektrisk fisk kan være utfordrende. Forsiktig avlytting av vannkvalitet, adekvat tid for fisken bekymre, og stamgjest mate er nøkkel å en heldig formering program. Fisk må først være betinget i flere uker for reproduksjon52 som beskrevet i protokollen trinn 4,1. Etter dette, en protokoll augmenting naturlig spermatogenese (4,2) for bruk i naturlig gyting atferd (4,3), et alternativ nylig utviklet in vitro teknikk for innhenting presist tidsbestemt embryo (4,4) er presentert. Protokoll 4,3 er like effektiv for b. brachyistius og b. gauderio, og protokoll 4,4 er overlegen i B. gauderio.

  1. Condition
    1. Behold B. brachyistius i par/små grupper (100 – 150 L tanker) eller i svært store tanker (2 hanner og 5 – 6 kvinner i ca. 475 L tank), ettersom de blir svært aggressive under avl. Det bør være minst 1 – 2 PVC-rør per fisk som skal brukes som husly (figur 3a,B).
    2. B. gauderio kan bli oppdratt med mye høyere tetthet. Hold opptil åtte individer i en 100 L tank (2 hanner og 6 kvinner). Det bør være minst 1 PVC rør per fisk som skal brukes som ly. Legge viklet garn øker berikelse og skjule flekker. Tilsett 50 mL sentrifugerør med 1 cm diameter hull boret inn i dem til toppen av tanken slik at voksne kan gyte naturlig inn i rørene (figur 3c).
    3. Under avl sesongen, fôr fisk daglige friske blackworms supplert med frosne bloodworms. Maten kan bli beriket med vitaminer og kosttilskudd, hvis ønskelig.
    4. House fisk normalt i en relativt høy ledningsevne (300-600 μS), pH balansert løsning. Under avl sesongen, gradvis senke ledningsevne med minst halvparten i løpet av 1-3 uker for å indusere gonad recrudescence og gyting. Lavere ledningsevne av daglige tillegg av omvendt osmose (RO) vann, holde nøye med pH når ledningsevne er lav (pH < 6).
    5. Formering forhold kan holdt for i nærheten 3 − 5 måneder med eggproduksjon som er ute av over tid. Etter denne tid, returnere fisk til høy ledningsevne langsomt over 1-3 uker. Hold ytterligere 3 måneder ved høy ledningsevne før de utsettes for avl forhold igjen.
  2. Bruk gyte agent (SGnRHa + Domperidone) injeksjoner.
    1. Identifiser kvinnelig fisk i avl forhold som vises gravid (Figur 4). I B. gauderio den kvinnelige vil ha hovne gonader bare caudal til ventilen. B. brachyistius kvinner vil ha hovne buk og vises dypt fylde (figur 4a). Hanner vanligvis ikke har et problem å produsere sperm. Imidlertid, større hanndyr er foretrakk på grunn av det større sperm kvantum avhentet.
      Merk: Gyte agent er et kommersielt hormon blanding som forenkler modning av kjønnscellene og koordinater gyting. Hvis fisken har blitt injisert med gyting agent i det siste, la > 4 uker med hvile og rikelig fôring mellom injeksjoner. Vi foreslår å injisere minst 2 hanner og 4 – 5 kvinner for å sikre et par klør av egg og rikelig med sperm.
    2. Bedøve fisk i MS-222 (0,4 g/3 L) i noen minutter, til fisken ikke er i stand til å beholde sin holdning, er Immobile, men fortsetter å ha opercular bevegelse (Stage II53).
    3. Veie fisken (g) for å beregne gyte middel beløp, (0,5 μL/g) + 0,5 μL. Den ekstra 0,5 μL-kontoen for pipettering feil.
    4. Legg til gyte agenten til 4X buffer volumer (1x PBS eller DPBS) i et PCR-rør og bland godt. Løsningen vil bli overskyet. Det bidrar til å dispensere gyte agenten på termoplastisk og deretter bruke en pipette for å måle den beregnede dosen. Gyte agenten er tyktflytende, så pass på å dispensere hele dosen og vær forsiktig med pipettering.
    5. Pipetter injeksjons løsningen på termoplastisk og trekk den til en presisjons glas sprøyte for å unngå luftbobler. Vi anbefaler en 28 G, 19-25 mm lengde, skrå nål.
    6. Injiser oppløsningen i rygg stammen muskelen med en jevn hastighet. La nålen sitte i 2 – 4 s og deretter fjerne. Umiddelbart sette fisken i friskt system vann for utvinning.
    7. Etter ca 24 h forberede for innsamling av embryo (se 4,3 eller 4,4). Samle alle nødvendige materialer, inkludert det som er nødvendig for enkelt celle microinjection (se pkt. 5).
  3. Skaff embryo gjennom naturlig gyting.
    1. House gyte agent-injisert voksne (4,2) i en stor 450 L tanker. Den mest effektive sex prosenter har vanligvis vært 1-2 hanner og 3-4 kvinner med tilstrekkelig gjemmesteder laget av PVC-rør, og mørk marmor substrat på tanken bunnen for å hindre egg forbruk. Klinkekuler er vanligvis viktigere for b. brachyistius enn b. gauderio, som foretrekker å sette sine klebrige egg i sprekker eller 50 ml sentrifugerør som beskrevet ovenfor.
    2. Plasser fisk i en omvendt lys syklus å matche natta gyting til vanlig Lab arbeidstid. Bruke en off-the-sokkel forbrukeren grade sikkerhetssystem, overvåke fisk ved hjelp av infrarød belysning for å minimere forstyrrelser fra en eksternt tilkoblet PC (Figur 3).
    3. Fisken vil spontant gyte under den mørke photoperiod ca 24 h poste gyting agent injeksjon.
    4. Når gyting begynner, samle egg hver time mens gyting atferd oppstår. I B. brachyistius, samle egg ved hjelp av en liten diameter sug over en fin bomulls netting nett for å minimere skade på ferske egg. Samle B. gauderio egg fra 50 ml sentrifugerør eller tank substrat. Arbeid effektivt med minimal forstyrrelse av gyting fisk ved å bruke en hodelykt med lav intensitet rødt lys. Som første kløft oppstår ca 1 t post befruktning (HPF), en stor del av egg vil være egnet for enkelt celle microinjection.
    5. Fortsett umiddelbart til microinjection (se avsnitt 5).
  4. Klem menn for in vitro befruktning av B. gauderio.
    1. Forbered sæden Extender-løsningen (SES) som beskrevet i The sebrafisk Book54: 10 mm HEPES, 80 mm KCl, 45 mm NaCl, 45 mm natrium acetate, 0,4 mm CaCl2, og 0,2 mm MgCl2.
      1. Bruk ddH2O for å bringe til volum og justere pH til 7,7 med 1 M NaOH.
      2. Oppbevares i kjøleskap.
      3. Filter gjennom et 0,22 μm filter før bruk.
    2. Bedøve fisk i MS-222 (0,4 g/3 L) i noen minutter, til fisken ikke er i stand til å beholde sin holdning, er Immobile, men fortsetter å ha opercular bevegelse (Stage II53). Plasser 500 μL alikvoter av SES i is.
    3. Tørre hender og fisk grundig, spesielt rundt hodet og ventilen. Plasser ventrale side opp, fremre til venstre (for høyre hånds individer) i en polystyren skum/svamp holderen dekket i en MS-222 gjennomvåt, fuktig papir håndkle. Hodet bør være så parallelt med tabellen som mulig.
      Merk: Trinn 4.4.4-4.4.6 bør gjøres så raskt som mulig, og fisken skal bare være ute av vannet i 30 – 60 s.
    4. Påfør trykket i caudal til rostral retning med lett klemme anteriort over gonader mot ventilen. Fisken kan utvise avfall. Vær forsiktig med å rengjøre ventilen med en delikat oppgave tørk hvis noe avfall er utvist. Ikke samle avfall med sperm. Avhengig av størrelsen på hannen er 10-60 μL vanlig.
    5. Ved hjelp av en micropipetter med et tips, forsiktig samle sperm som det er klemt fra den mannlige i 50 til μL trinn. Legg sæden direkte inn i 500 μL alikvoter av SES på isen. Det kan være nyttig å ha en annen forsker bistå i å samle sperm mens den andre klemmer. Sperm bør brukes så snart som mulig, men er fortsatt levedyktig for minst 1 time.
    6. Umiddelbart etter innsamling, settefisk i friskt system vann for utvinning. Fisken burde bare være ute av vann for 30 – 60 s.
  5. Klem kvinner for in vitro befruktning av B. gauderio.
    1. Bedøve fisk i MS-222 (0,4 g/3 L) i noen minutter, til fisken ikke er i stand til å beholde sin holdning, er Immobile, men fortsetter å ha opercular bevegelse (Stage II53). Plasser polytetrafluoroethene ark på arbeidsstasjonen.
      Merk: Seksjoner 4.5.1-4.5.5 bør gjøres så raskt som mulig og fisken skal bare være ute av vannet i 30-60 s.
    2. Tørre hender, verktøy, polytetrafluoroethene ark og fisk grundig, spesielt rundt hodet og ventilen. Plasser på siden med hodet vendt fremre (for høyre hånds individer).
    3. Påfør trykket i caudal til rostral retning med lett klemme anteriort over gonader mot ventilen. Fisken kan utvise avfall. Vær forsiktig med å rengjøre ventilen med en delikat oppgave tørk hvis noe avfall er utvist. Avhengig av størrelsen på fisken, er 20 – 150 egg vanlig. Ved hjelp av en polytetrafluoroethene belagt spatel/verktøyet nøye samle egg som de er klemt fra cloaca. Raskt flytte egg til en liten Petri parabol og dekk. Pass på at eggene forblir tørre under denne prosessen. Alternativt, etter klemme, berøre egg massen til bunnen av en liten Petri parabolen eller til polytetrafluoroethene arket som de er utvist fra hunnen.
    4. Umiddelbart etter innsamling, sette fisken i friskt system vann for utvinning.
  6. Utfør egg befruktning for in vitro befruktning av B. gauderio.
    1. Tilsett 100 μL av godt blandet sæd i SES (se trinn 4,4) direkte over egg massen.
    2. Tilsett 1 mL system vann (filtrert gjennom et 0,22 μm filter) og bland godt i 30 – 60 s.
    3. Tilsett ytterligere 1 – 2 mL system vann (la det være plass i Petri-fatet) og plasser det i inkubator. Rekordtid for IVF på Petri parabol og flytte til en 29 ° c inkubator. Sett en 50 min timer for å sjekke fremdriften av utviklingen (f. eks, dannelsen av én celle på dyrets Pol, se figur 6). I løpet av denne tiden, forberede materialer for microinjection.

5. enkelt celle Microinjection

  1. Trekk microinjection nåler før gyte agent injeksjoner (trinn 4,2) eller naturlig gyting (trinn 4,3). Bruk en Borosilikatglass glass kapillær med filament (OD 1,0 mm, ID 0,58 mm, 10 cm lengde) og en nål avtrekker for å trekke microinjection nåler. Forbered 2 – 4 nåler per planlagt behandlings injeksjon.
    Merk: Backloading nåler med filament foretrekkes, fordi filament transporterer løsningen mot spissen og eliminerer bobler. Men nåler uten filament kan brukes og immuniserings bør ikke ha noen effekt på utfallet. Nålen bør ha en lang, men solid taper. Bruk nålen trekke programmet med følgende spesifikasjoner som utgangspunkt: Heat = 500; Trekk = 70; Hastighet = 70; og tid = 100. Representative nål morfologier er vist i figur 5a.
  2. Forbered injeksjon løsning og forberede nål.
    1. Tilsett 0,9 μL av sgRNA og 0,9 μL av Cas9 enzym (1 mg/mL) til 0,2 μL av 10% eller 100% fenol rød (henholdsvis 1% og 10% endelig fenol rød konsentrasjon) i et PCR-rør. Bland godt og la sitte på is 2 − 5 min for å tillate sgRNA og Cas9 til komplekse. Beregn den endelige konsentrasjonen av sgRNA, Cas9, og fenol rød i injeksjons løsningen.
      Merk: Hvis det er problemer med nålen tilstopping eller skjæring effektivitet ved hjelp av ovenstående oppskrift, kan det være nyttig å bruke en 1x endelig konsentrasjon salt/buffer Mix å stabilisere Cas9 og forhindre nål tilstopping.
    2. Bruk et microloader pipette tips for å backload 2 μL oppløsning i microinjection nålen. Fjern væsken så nær spissen som mulig.
    3. Legg nålen inn i micromanipulator og angi trykk innstillinger (Start med 775 pi, 0,1 − 0,2 s og 8-12 pc).
    4. Under omfanget, bruke et par fine tang for å bryte nålen spissen i en skrå vinkel. Break mot der taper av nålen begynner å ha stivhet. Det er best å bryte nærmere spissen, teste størrelsen på injeksjons løsningen og deretter bryte ytterligere om nødvendig. Nålen skal forbli så liten som mulig og samtidig opprettholde en stiv taper (figur 5a).
    5. Bruk mineralolje og en mikrometer for å måle størrelsen på injeksjons løsningen. 1 – 2 nL brukes vanligvis; 0,1 mm diameter er 0,5 nL.
    6. Juster nålespissen eller trykk innstillingene for å få et injeksjonsvolum innenfor spesifikasjonene.
  3. Identifisere utvikle zygotes og forberede injeksjon scenen. Sett opp injeksjons stadiet. Ta en 100 mm diameter Petri parabolen. Inverter bunnen og plasser under invertert toppen. Plasser et glass mikroskop i den omvendte toppen. Avhengig av hvordan micromanipulator er montert på området, kan den ekstra høyden fra den omvendte basen være unødvendig.
    1. Se på å utvikle egg og identifisere antatte befruktet zygotes 50 – 60 min etter IVF. Dyret stangen vil begynne å danne og det vil være et overskudd av små fett dråper rundt eggeplomme/dyr celle grensesnittet (figur 6).
    2. Samle 10-20 egg med så lite vann som mulig ved hjelp av en plast overføring pipette (kutt spissen litt for å tillate egg å passere) og plasser på kanten av lysbildet. Vann vil være onde under raset og trekke egg mot kanten.
    3. Bruk en delikat oppgave tørk og trykk forsiktig på lysbildet for å fjerne overflødig vann og la eggene fast holder seg til kanten av lysbildet. Det bør være akkurat nok vann til å holde eggene fuktig og samtidig opprettholde lite stående fuktighet for å unngå egg bevegelse under injeksjon.
  4. Injiser direkte i en enkelt celle.
    1. Rett inn eggene mot det vertikale lysbildet, vinkelrett på nålen (figur 5B).
    2. Bruk micromanipulator til å plassere nålen mot chorionic. Ved omtrent en 45 ° vinkel, sett nålen inn i chorionic, og deretter inn i den ene cellen. Det kan være nyttig å gå inn i enkelt celle gjennom eggeplomme. Å flytte både injeksjons scenen med den ledige hånden og micromanipulator kan gi mer kontroll over injeksjons prosessen (figur 5B).
    3. Injiser den røde løsningen sgRNA/Cas9/fenol i én celle. Forsiktig fjerne nålen. Fortsett til neste egg og gjenta trinn 5.4.1-5.4.3 til alle eggene er injisert.
    4. Fjern eventuelle egg brutt under injeksjon med fin tang. Bruk 0,22 μm av filtrert system vann i en skvett flaske for å forsiktig fjerne egg fra injeksjons scenen til en ny 100 mm diameter Petri parabolen.
    5. Gjenta trinn 5.3.3-5.4.6 inntil alle eggene er injisert eller har utviklet seg til to-celle-scenen. Sørg for å sette til side ca 20 antatt befruktet egg som en nei-injeksjon kontroll for å fastslå befruktning priser og injeksjon suksess. For større klør bruke uninjected embryo som har utviklet seg til to-celle-scenen, og for mindre klør satt til side antatt befruktet egg.
    6. I tillegg bør du vurdere en sgRNA/injeksjon kontroll ved å injisere 15-25 embryo med Cas9 complexed med en sgRNA mot et gen som ikke er til stede i Genova. GFP-genet anbefales for vill type embryo. Noter antall egg, foreldre, IVF-tid og dato på hver Petri-rett. Inkluder sgRNA-mål eller-etikett som uninjected. Flytt til en 29 ° c inkubator.

6. husdyrhold

  1. Ta vare på eggene.
    1. Kontroller egg levedyktighet 4 – 6 h etter injeksjoner.
    2. Record antall døde egg, samt noen som er ubefruktede. De ubefruktede eggene vil arrestere rundt åtte-celle-scenen og har en rosett mønster av cellene på dyret polet (figur 6). Avhengig av antall døde egg og mengde egg rusk i vannet, fjerne minst 50%-80% av vannet og erstatte med filtrert system vann. Det kan være nyttig å skrubbe bunnen av Petri parabolen hvis en mobilnettet rusk film eller biofilm former.
    3. For de neste 2 – 3 dagene, sjekk eggene 1 – 2x daglig. Gjenta trinn 6.1.2 – 6.1.3 hver gang eggene sjekkes.
    4. Etter 2 − 3 dager vil Larvene klekkes. Fjern alle egge foringsrør når de klekkes. Lett pipettering kan bidra til å frigjøre halv-klekket larver.
  2. Stell for larver.
    1. Sjekk eggene 1 − 2x daglig. Gjenta trinn 6.1.2 – 6.1.3 hver gang Larvene blir sjekket.
    2. Fra 6-14 DPF, fôr eddik ål til larvene. Et lite overskudd av mat er bra, fordi eddik ål vil forbli i live i fatet. Legg eddik ål hver gang fatet er kontrollert og rengjort.
    3. Fra 11 – 14 DPF, tilsett 5 – 10 ferske klekket Artemia per larver i tillegg til eddik ål. I løpet av denne tiden Larvene vil lære å spise gratis svømming Artemia.
    4. Ved 15 DPF, flytte larver til egg kopper (se Seksjon 6.2.5) i en tank med rennende vann, filtrering og lufting. Det bør ikke være mer enn ca 25 embryo per kopp. Egg kopper er plast kopper med netting netting på bunnen. A 100 mm Petri parabolen topp/bunn kan legges til bunnen av egget koppen å bidra til å stoppe maten faller gjennom mesh. Egg kopper tillate fisken å bli plassert i et større volum av vann for vannkvalitet grunner, og samtidig opprettholde diskrete grupper. Fortsett å legge til både eddik ål og 15 − 30 fersk klekket Artemia per larver fra dager 15 – 18. Clean Petri parabolen stykke daglig og bruke en pipette for å fjerne masser av døde Artemia.
    5. Fra dager 18 – 30, fôr bare fersk klekket Artemia. Forhøye det fôring beløpet idet fisken avle og hvis hale skarp er sett.
    6. Etter ca 30 dager, flytte fisk til 10 L (2,5 gallon) stridsvogner, ca 25 personer per tank. Kontroller at det er filtrering, lufting, og steder for å skjule. Vurder sylindriske biofiltrering medier og liten diameter PVC-rør.
    7. Feed fersk klekket Artemia og blackworms fra ca 30-45 dager og framover. Oppretthold standard rengjøring og vann endringer for tanken (dvs. minimum ~ 10%-20% vann Skift per 1 uke).
    8. Etter ~ 45 DPF, fôr bare blackworms til ~ 60 DPF.
    9. Etter ~ 60 DPF, flytte kohorter av ca 15 fisk til 40 L (10 gallon) tanker og begynne voksen oppdrett prosedyrer. Legg PVC-rør og et garn "mopp" (en masse brunt garn bundet sammen rundt en kork) for å gjemmesteder (figur 3c). Fisken bør nærmer seg avl størrelsen (10 − 12 cm) etter ca. 3 − 4 måneder etter befruktning.

7. voksen oppdrett

  1. Mate fisken daglig med nok blackworms i den grad at en liten beløpet av blackworms er gave for morgendagen mate. Denne annonsen lib fôring tillater maksimal vekst.
  2. Et par ganger i uken, kan det være nyttig å supplere blackworm fôring med bloodworms.
  3. Rengjør tankene hver 2 – 4 uker med 20% – 30% vann SKIFT. Hvis garnet mopp blir full av biofilm/alger, gni det rent under RO vann.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

SgRNA målområder ble identifisert i ekson 1 av scn4aa i både B. gauderio og b. brachyistius som beskrevet i avsnitt 1. SgRNAs ble generert som beskrevet i avsnitt 2. Etter vellykket sgRNA utvelgelse og syntese (figur 1), ble in vitro testet (figur 2). Den sgRNAs demonstrere in vitro skjæring ble deretter valgt for enkelt celle microinjections.

Voksen fisk var betinget for reproduksjon (§ 4,1), deretter injisert med en gyting agent (§ 4,2) og deretter klemt (B. gauderio) for IVF som beskrevet i § 4,4 eller lov til å gyte naturlig (B. brachyistius) som beskrevet i avsnitt 4,3. Dette arbeidet ga enkelt celle embryo for microinjection i begge artene. Som beskrevet i punkt 5, 1.5 − 2.0 nL av scn4aa SgRNA/Cas9/fenol rødt kompleks (65-190 ng/uL sgRNA, 450 ng/uL Cas9, 1% − 10% fenol rød, endelige konsentrasjoner) ble injisert på en celle-scenen. Egg fra samme clutch ble brukt som uninjected kontroller. Alle embryo ble tatt vare på som beskrevet i § 6. Etter IVF ble 40% – 90% av eggene befruktet, og 70% – 90% av embryo overlevde til klekking etter injeksjon.

Omtrent 75% av fisken overlevde til 6 − 11 DPF og ble deretter phenotyped. Larvestadiet fisk ble plassert i en 35 mm Petri parabolen innebygd i en større tallerken med Sylgard immobilisert AG/CL innspillingen elektroder (figur 7a). Embryo bevegelse ble begrenset med 3% agarose muggsopp laget med system vann og kuttet til å passe fosteret (figur 7b). Det samme opptaket kammer ble brukt for både arter og samme agarose mold ble brukt blant arter sammenligninger. Embryo ble registrert for 60 s, som er tilstrekkelig til å fange hundrevis av EODs. Alder og størrelse matchet uninjected kontroller ble valgt for sammenligning. På dette tidspunktet, 10%-30% av overlevende embryo viser en redusert amplitude EOD. Embryo viser en reduksjon i EOD amplitude uten åpenbare morfologiske defekter og kontroll uninjected hele embryo ble fordøyd for DNA-ekstraksjon og påfølgende PCR av scn4aa målområdet. Det var ofte en rekke penetrans av fenotype, med noen individer har en sterkere reduksjon i EOD amplitude enn andre.

Etter PCR rydde opp og kloning, 30 + kloner fra hvert embryo ble valgt for sanger sekvensering. CRISPR/Cas9 induserte mutasjoner ble identifisert i B. gauderio (figur 8a,b) og b. brachyistius (figur 9a,b) personer med sterk EOD amplitude reduksjon (figur 8c og figur 9C , henholdsvis), der uninjected kontroller bare hadde referanse genotyper. Visualisering av EOD amplitude mellom bekreftede mutanter ("CRISPR") og alder/størrelse matchet uninjected kontroller viste at både scn4aa mutant B. Brachyistius (figur 10a) og B. gauderio (figur 10b ) embryo hadde signifikant lavere EOD amplitude enn kontroller (p < 2,2 x 10-16, Welch to-sample t-test). CRISPR/Cas9 målretting av scn4aa var vellykket i både B. brachyistius og b. gauderio og implisere scn4aa i larvestadiet/tidlig electrocyte utslipp i begge artene.

Figure 1
Figur 1: sgRNA mal syntese og transkripsjon. (A) gel bilde av sgRNA mal syntese. Etikettene tilsvarer forskjellige sgRNAs for myod (MYO2, MYO1) og tre sgRNAs for scn4aa (S1 − S3). Etter annealing oligomers, en ~ 120 BP mal er produsert. (B) gel bilde av sgRNA transkripsjon for tre SgRNAs for b. gauderio (bg2017) og to for b. brachyistius (bb2016, 2017). SgRNA vises som to band på grunn av sekundær struktur og vil være mellom 50 − 150 BP ved bruk av en dsDNA-stige. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: representativt gel bilde av vellykket (SG1) og mislykket (sg2 netters) in VITRO CRISPR-analyser. En tilsvarende mengde mal uten CRISPR-komponenter vises i scn4aa-feltet. Legg merke til duplikat båndene i SG1 som viser at skjæring har skjedd. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: avl tank oppsett for svakt elektrisk fisk. (A) skjematisk av de typiske oppsett for trådløs video overvåking av gyting atferd. Tre kommersielt tilgjengelige CCTV kameraer (Swann, Inc.) i stand til å produsere infrarødt lys er rettet mot toppen av vannet og koblet til en digital video opptaker (DVR). Video overvåkes i sanntid for gyte oppførsel i et tilstøtende rom fra en nettverks tilkoblet datamaskin (PC). (B) gyting atferd tatt med et slikt oppsett i B. brachyistius. (C) et typisk avl oppsett for B. gauderio med PVC skjule rør og garn mopper. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4: avl menn og kvinner. (A) b. Brachyistius og (B) b. gauderio. Begge artene er seksuelt dimorphic og lett skilles visuelt når seksuelt modne. Begge kvinner er gravid i disse bildene, viser karakteristisk hovne buk som er full av modne egg. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 5
Figur 5: Microinjection. (A) glass kapillær nål tips må brytes for å levere en passende microinjection volum. Spissen til venstre er ubrutt. Den midtre og høyre tips er brutt med en litt vinklet skråkant å Pierce egget chorionic. (B) eggene er foret mot et glass Slide (1%-10% fenol rød er inkludert som en Tracer for å visualisere levering av injeksjon) og injisert med glass kapillær nåler. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 6
Figur 6: utviklingstrinn. (A) b. Gauderio og (B) b. brachyistius. Alle egg antas befruktet og utvikling overvåkes til 24 HPF. Mellom 12 − 24 HPF embryo er synlig i levedyktige egg, ellers egg utstillingen degradering. Flere divisjoner ser ut til å finne sted på egg aktivering, uavhengig av befruktning. Ubefruktede egg utstilling uvanlige mønstre av kløft som er mye mer symmetrisk i befruktet egg. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 7
Figur 7: fotografi av larvestadiet opptaks kammer som brukes i denne studien. (A) elektrodene er innebygd i Sylguard men strekker seg inn i 35mm parabolen inneholder et embryo begrenset via en 3% agarose mold. (B) høyere forstørrelses bilde fremhever den begrensede bevegelsen til fosteret på grunn av agarose. Legg merke til bitene av agarose som kan fjernes etter hvert som embryo skifter størrelse. B. gauderio embryo står overfor den positive elektroden. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 8
Figur 8: CRISPR/Cas9 forårsaket mutasjoner i B. gauderio(A) 32 klone SEKVENSER fra genomisk DNA av Cas9-indusert mutasjoner i en enkelt scn4aa målrettet F0B. gauderio embryo (11 DPF). Referanse sekvensen er understreket med sgRNA målområdet uthevet i grått, protospacer motiv (PAM) sekvensen uthevet i rødt, og Cas9 kuttet området merket med "|". Endringen fra den forventede ville type sekvensen er gitt, og antall kloner for hver sekvens er gitt i parentes. (Forkortelser: + = innsetting,-= sletting, ± = indel) Eventuelle ikke-CRISPR tilknyttede sekvens-dissimilarities er uthevet. Figur modellert etter Jao et al.60. (B) amino acid sekvens spådd fra sekvensert kloner av scn4aa knockdown B. gauderio fra (A). Cas9-indusert endringer fra den ville type sekvensen er uthevet i rødt, og det nukleotid-indusert endre nummeret er gitt. (C) tjue andre elektriske opptak fra fem størrelse-matchet larver, alle spilt inn 6 DPF i samme opptaks kammer. Innstillinger for forsterkning er identiske for alle spor. Spor i rødt er fra B. gauderio larver med bekreftede mutasjoner (ett individ vist i figur 8a, B ovenfor), spor i svart er fra uninjected B. gauderio larver. Samlet, CRISPR/Cas9 redigering av scn4aa viste en reduksjon i EOD amplitude, men effekten var heterogen. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 9
Figur 9: CRISPR/Cas9 indusert mutasjoner i B. brachyistius(A) 42 klone SEKVENSER fra genomisk DNA av Cas9-indusert mutasjoner i en enkelt scn4aa målrettet F0B. brachyistius embryo (11 DPF). Referanse sekvensen er understreket med sgRNA målområdet uthevet i grått, protospacer motiv (PAM) sekvensen uthevet i rødt, og Cas9 kuttet området merket med "|". Endringen fra den forventede ville type sekvensen er gitt, og antall kloner for hver sekvens er gitt i parentes. (Forkortelser: + = innsetting,-= sletting, ± = indel) Eventuelle ikke-CRISPR tilknyttede sekvens-dissimilarities er uthevet. Figur modellert etter Jao et al.60. (B) amino acid sekvensen spådd fra sekvensert kloner fra scn4aa knockdown B. brachyistius i (A). Cas9-indusert endringer fra Wild type sekvensen er uthevet i rødt og nukleotid indusert endre nummeret er gitt. (C) ti andre elektriske innspillinger fra fire størrelse-matchet larver, alle spilt inn 10 DPF i samme opptaks kammer. Innstillinger for forsterkning er identiske for alle spor. Spor i rødt er fra B. brachyistius larver med bekreftede mutasjoner (ett individ vist i A, B ovenfor), spor i svart er fra uninjected B. brachyistius larver. Samlet, CRISPR/Cas9 redigering av scn4aa viste en reduksjon i EOD amplitude, men effekten var heterogen. Invertert EODs er fra fisken skiftende orientering under innspillingen. Ingen forskjell er merkbar mellom eksperimentell fisk og kontroller til tross for dette. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 10
Figur 10: Box tomter gjennomsnittlig EOD amplitude av CRISPR og uninjected størrelse/alder matchet søsken. (A) EOD amplitude av B. brachyistius larver ved 10 DPF. Innspilt med en gevinst på 100, CRISPR n = 56 EODs fra to individer, uninjected n = 114 EODs fra tre individer. (B) EOD amplitude av B. gauderio larver ved 6 DPF. Innspilt med en gevinst på 500, CRISPR n = 34 EODs fra to individer, uninjected n = 148 EODs fra tre individer. Amplitude av CRISPR fisk var betydelig mindre enn uninjected kontroller (p < 2,2 x 10-16, Welch to-sample t-test). Alle individer ble tatt opp med opptaks kammeret beskrevet i figur 7. Vennligst klikk her for å se en større versjon av dette tallet.

Beskrivelse Sekvens
Konstant oligomer 5 '-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGC TATTTCTAGCTCTAAAAC-3 '
Target oligomer ryggrad (GG-N18, ingen PAM) 5 '-TAATACGACTCACTATAGG-N18-GTTTTAGAGCTAGAAATAGCAAG-3 '
Target oligomer ryggrad (N20, ingen PAM) 5 '-TAATACGACTCACTATAG-N20-GTTTTAGAGCTAGAAATAGCAAG-3 '
Brienomyrus brachyistius
scn4aa bb sgRNA mål (N18, med PAM): 5 '-TCTTCCGCCCCTTCACCACGG-3 '
Scn4aa bb sgRNA oligomer (GG-N18): 5 '-TAATACGACTCACTATAGG TCTTCCGCCCCTTCACCA GTTTTAGAGCTAGAAATAGCAAG-3 '
scn4aa bb PCR primer (218 BP)
Scn4aa_bb_exon1_F: 5 '-ATGGCCGGCCTTCTCAATAA-3 '
Scn4aa_bb_exon1_R: 5 '-TCTTCCAGGGGAATATTCATAAACT-3 '
Brachyhypopomus gauderio
Scn4aa BG sgRNA målet (N17, med PAM): 5 '-CAAGAAGGATGTAGTGGAGG-3 '
Scn4aa BG sgRNA oligomer (GG-N17): 5 '-TAATACGACTCACTATAGG CAAGAAGGATGTAGTGG GTTTTAGAGCTAGAAATAGCAAG-3 '
Scn4aa BG PCR primer par (204 BP)
scn4aa_bg_exon1_F: 5 '-CGCCTTGTCCCTCCTTCAG-3 '
scn4aa_bg_exon1_R: 5 '-ATCTTCAGGTGGCTCTCCAT-3 '

Tabell 1: Oligonukleotider er nødvendig for protokollen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Den fenotypiske rikdommen av svakt elektrisk fisk, sammen med en fersk spredning av Genomics ressurser, motiverer et sterkt behov for funksjonelle genomisk verktøy i svakt elektrisk fisk modell. Dette systemet er spesielt attraktivt på grunn av den konvergent utviklingen av mange fenotypiske trekk i parallelle linjene av fisk, som er lett oppbevares i laboratoriet.

Protokollen som beskrives her demonstrerer effekten av CRISPR/Cas9 teknikk i linjene av svakt elektrisk fisk som utviklet seg electrogenesis og electroreception parallelt, og derfor representerer et stort skritt for denne modellens løfte adressering fremtidig arbeid i sammenlignende Genomics av fenotypiske evolusjon.

Denne enkle metodisk tilnærming krever bare grunnleggende molekylærbiologi ferdigheter og opplæring, etter en grunnleggende adopsjon av Gagnon protokollen38, mye brukt for sebrafisk. Det er verdt å merke seg at etter hvert som teknologien utvikler seg, er det mer kommersielle kits for sgRNA produksjon så vel som selskaper som kan syntetisere guide RNAs, noe som gjør denne protokollen mer tilgjengelig for laboratorier som mangler molekylærbiologi erfaring og utstyr. Vi noterer først at den høye mutagenese effektiviteten tillater direkte bestemmelse av fenotype av injisert larver. Det synes imidlertid å være en betydelig grad av fenotypiske mosaikk, som ikke er uvanlig og er konsistent med litteraturen41,42,43,44. For eksempel, i denne scn4aa studien, noen individer bærer mutasjoner utstilt mye større amplitude EODs enn andre som var forholdsvis stille (figur 7, Figur 8). Det er i dag uklart hvor mange av disse mutasjoner er gjennomført i germline. Umiddelbar fremtidig innsats vil bli rettet mot å skape stabile, muterte linjer.

Utnytte NHEJ Pathway for Knockouts er bare en av flere potensielle anvendelser av CRISPR/Cas9 genredigering: metodene skissert her er et springbrett for mer avanserte applikasjoner55,56. Fremtidig innsats bør være rettet mot å designe co-injisert DNA donor maler med sgRNA/Cas9 kompleks. Denne enkle endringen vil utnytte endogene mal-baserte reparasjon mekanismer (dvs. homologi rettet reparasjon, eller HDR) og tillate presise knock-ins. Selv om HDR oppstår med lavere effektivitet enn NHEJ tilnærminger, har det blitt gjort fremskritt for å øke effekt57,58. Denne lavere effektivitet vil kreve innsats for å optimalisere utformingen av DNA-donor Template/CRISPR/Cas9 konstruere, gjøre endogene reparere mekanismer mer effektiv, og øke embryo produksjon (se nedenfor). Hvis dette spørsmålet om effektivitet kan løses, knockins kan utnyttes til å legge til fluorescerende koder, uttrykke en mutert form av genet produktet, eller endre promoter eller Enhancer sekvenser.

Selv om molekyl biologi bak denne teknikken er ganske grei, er kravene til reindrift betydelige, men ikke umulig. B. gauderio er allment tilgjengelig og avle raskt nok for alle forskningsprogram å ha en koloni på under et år. I kontrast, B. brachyistius utvikle seg langsomt, og anatomiske særegenheter har bevist forsøk på IVF så langt mislykket. Andre, større arter, for eksempel Campylomormyrus59 kan være mer bidrar til denne tilnærmingen. For B. brachyistius, alle injisert embryo ble samlet utnytte den naturlige gyting tilnærming, som er betydelig mer arbeidsintensiv. Fremtidig innsats for å øke effektiviteten i B. brachyistius IVF vil gi et høyere utbytte av embryo for effektivitets problemene som er beskrevet ovenfor.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgments

Forfatterne erkjenner den heroiske innsatsen til Monica Lucas, Katherine Shaw, Ryan Taylor, Jared Thompson, Nicole Robichaud, og Hope Healey for hjelp med fiskeoppdrett, datainnsamling, og tidlig protokoll utvikling. Vi vil også gjerne takke de tre anmeldere for deres forslag til manuskriptet. Vi tror det endelige produktet til å være av bedre kvalitet etter adressering sine kommentarer. Dette arbeidet ble finansiert av støtte fra National Science Foundation #1644965 og #1455405 til JRG, og naturvitenskap og engineering Research Council DG stipend til VLS.

Materials

Name Company Catalog Number Comments
20 mg/mL RNA grade Glycogen Thermo Scientific R0551
50 bp DNA ladder NEB N3236L
Borosilicate glass capillary with filament Sutter Instrument BF100-58-10 (O.D. 1.0 mm, I.D. 0.58 mm, 10 cm length)
Cas9 protein with NLS; 1 mg/mL PNA Biology CP01
Dneasy Blood & Tissue Kit Qiagen 69506
Eppendorf FemptoJet 4i Microinjector Fisher Scientific E5252000021
Eppendorf Microloader Pipette Tips Fisher Scientific 10289651
Hamilton syringe Fisher Scientific 14-824-654 referred to as "precision glass syringe" in the protocol
Kimwipe Fisher Scientific 06-666 referred to as "delicate task wipe" in the protocol
MEGAscript T7 Transcription Kit Invitrogen AM1334
NEBuffer 3 NEB B7003S used for in vitro cleavage assay
OneTaq DNA kit NEB M0480L
Ovaprim Syndel USA https://www.syndel.com/ovaprim-ovammmlu010.html referred to as "spawning agent" in the protocol
Parafilm Fisher Scientific S37440 referred to as "thermoplastic" in the protocol
Pipette puller WPI SU-P97 sutter brand
QIAquick PCR Purification Kit Qiagen 28106
Reusable needle- requires customization Fisher Scientific 7803-02 Customize to 0.7 inches long; point style 4 and angle 25
T4 DNA polymerase NEB M0203L Use with the 10x NEB buffer that is included
Teflon coated tools bonefolder.com T-SPATULA4PIECE referred to as "polytetrafluoroethene" in the protocol

DOWNLOAD MATERIALS LIST

References

  1. Gallant, J. R., et al. Genomic basis for the convergent evolution of electric organs. Science. 344, (6191), 1522-1525 (2014).
  2. Zakon, H. H., Lu, Y., Zwickl, D. J., Hillis, D. M. Sodium channel genes and the evolution of diversity in communication signals of electric fishes: convergent molecular evolution. Proceedings of the National Academy of Sciences of the United States of America. 103, (10), 3675-3680 (2006).
  3. Arnegard, M. E., Zwickl, D. J., Lu, Y., Zakon, H. H. Old gene duplication facilitates origin and diversification of an innovative communication system--twice. Proceedings of the National Academy of Sciences of the United States of America. 107, 22172-22177 (2010).
  4. Lissmann, H. W. Continuous electrical signals from the tail of a fish. Gymnarchus niloticus Cuv. Nature. 167, (4240), 201-202 (1951).
  5. Cuellar, H., Kim, J. A., Unguez, G. A. Evidence of post-transcriptional regulation in the maintenance of a partial muscle phenotype by electrogenic cells of S. macrurus. FASEB Journal. 20, (14), 2540 (2006).
  6. Modrell, M. S., Baker, C. V. Evolution of electrosensory ampullary organs: conservation of Eya4 expression during lateral line development in jawed vertebrates. Evolution & Development. 14, (3), 277-285 (2012).
  7. Hopkins, C. D. Design features for electric communication. Journal of Experimental Biology. 202, Pt 10 1217-1228 (1999).
  8. Kawasaki, M. Sensory hyperacuity in the jamming avoidance response of weakly electric fish. Current Opinion in Neurobiology. 7, (4), 473-479 (1997).
  9. Bell, C. C., Han, V. Z., Sugawara, Y., Grant, K. Synaptic plasticity in a cerebellum-like structure depends on temporal order. Nature. 387, (6630), 278-281 (1997).
  10. Heiligenberg, W. Neural Nets in Electric Fish. (1991).
  11. Ban, Y., Smith, B. E., Markham, M. R. A highly polarized excitable cell separates sodium channels from sodium-activated potassium channels by more than a millimeter. Journal of Neurophysiology. 114, (1), 520-530 (2015).
  12. Markham, M. R., Kaczmarek, L. K., Zakon, H. H. A sodium-activated potassium channel supports high-frequency firing and reduces energetic costs during rapid modulations of action potential amplitude. Journal of Neurophysiology. 109, (7), 1713-1723 (2013).
  13. Gavassa, S., Stoddard, P. K. Food restriction promotes signaling effort in response to social challenge in a short-lived electric fish. Hormones and Behavior. 62, (4), 381-388 (2012).
  14. Sinnett, P. M., Markham, M. R. Food deprivation reduces and leptin increases the amplitude of an active sensory and communication signal in a weakly electric fish. Hormones and Behavior. 71, 31-40 (2015).
  15. Salazar, V. L., Stoddard, P. K. Sex differences in energetic costs explain sexual dimorphism in the circadian rhythm modulation of the electrocommunication signal of the gymnotiform fish Brachyhypopomus pinnicaudatus. Journal of Experimental Biology. 211, Pt 6 1012-1020 (2008).
  16. Lewis, J. E., Gilmour, K. M., Moorhead, M. J., Perry, S. F., Markham, M. R. Action potential energetics at the organismal level reveal a trade-off in efficiency at high firing rates. Journal of Neuroscience. 34, (1), 197-201 (2014).
  17. Salazar, V. L., Krahe, R., Lewis, J. E. The energetics of electric organ discharge generation in gymnotiform weakly electric fish. Journal of Experimental Biology. 216, (13), 2459-2468 (2013).
  18. Hopkins, C. D., Bass, A. Temporal coding of species recognition signals in an electric fish. Science. 212, (4490), 85-87 (1981).
  19. Arnegard, M. E., Jackson, B. S., Hopkins, C. D. Time-domain signal divergence and discrimination without receptor modification in sympatric morphs of electric fishes. The Journal of Experimental Biology. 209, Pt 11 2182-2198 (2006).
  20. Sullivan, J. P., Lavoue, S., Arnegard, M. E., Hopkins, C. D. AFLPs resolve phylogeny and reveal mitochondrial introgression within a species flock of African electric fish (Mormyroidea: Teleostei). Evolution. 58, (4), 825-841 (2004).
  21. Crampton, W. G. R. Effects of anoxia on the distribution, respiratory strategies and electric signal diversity of gymnotiform fishes. Journal of Fish Biology. 53, 307-330 (1998).
  22. Pinch, M., Guth, R., Samanta, M. P., Chaidez, A., Unguez, G. A. The myogenic electric organ of Sternopygus macrurus: a non-contractile tissue with a skeletal muscle transcriptome. PeerJ. 4, 1828 (2016).
  23. Lamanna, F., Kirschbaum, F., Waurick, I., Dieterich, C., Tiedemann, R. Cross-tissue and cross-species analysis of gene expression in skeletal muscle and electric organ of African weakly-electric fish (Teleostei; Mormyridae). BMC Genomics. 16, 668 (2015).
  24. Traeger, L. L., et al. Unique patterns of transcript and miRNA expression in the South American strong voltage electric eel (Electrophorus electricus). BMC Genomics. 16, 243 (2015).
  25. Salisbury, J. P., et al. The central nervous system transcriptome of the weakly electric brown ghost knifefish (Apteronotus leptorhynchus): de novo assembly, annotation, and proteomics validation. BMC Genomics. 16, 166 (2015).
  26. Lamanna, F., Kirschbaum, F., Tiedemann, R. De novo assembly and characterization of the skeletal muscle and electric organ transcriptomes of the African weakly electric fish Campylomormyrus compressirostris (Mormyridae, Teleostei). Molecular Ecology Resources. 14, (6), 1222-1230 (2014).
  27. Mate, S. E., Brown, K. J., Hoffman, E. P. Integrated genomics and proteomics of the Torpedo californica electric organ: concordance with the mammalian neuromuscular junction. Skeletal Muscle. 1, (1), 20 (2011).
  28. Swapna, I., et al. Electrostatic Tuning of a Potassium Channel in Electric Fish. bioRxiv. (2017).
  29. Futuyma, Evolution. Third Edition. Sinauer Associates Inc. (2013).
  30. Thompson, A., Vo, D., Comfort, C., Zakon, H. H. Expression Evolution Facilitated the Convergent Neofunctionalization of a Sodium Channel Gene. Molecular Biology and Evolution. 31, (8), 1941-1955 (2014).
  31. Pitchers, W. R., Constantinou, S. J., Losilla, M., Gallant, J. R. Electric fish genomics: Progress, prospects, and new tools for neuroethology. Journal of Physiology Paris. (2016).
  32. Liang, X., et al. Rapid and highly efficient mammalian cell engineering via Cas9 protein transfection. Journal of Biotechnology. 208, 44-53 (2015).
  33. Jung, C. J., et al. Efficient gene targeting in mouse zygotes mediated by CRISPR/Cas9-protein. Transgenic Research. 26, (2), 263-277 (2017).
  34. Liu, K., Petree, C., Requena, T., Varshney, P., Varshney, G. K. Expanding the CRISPR Toolbox in Zebrafish for Studying Development and Disease. Frontiers in Cell and Developmental Biology. 7, (13), (2019).
  35. Zu, Y., et al. Biallelic editing of a lamprey genome using the CRISPR/Cas9 system. Scientific Reports. 6, 23496 (2016).
  36. Crispo, M., et al. Efficient Generation of Myostatin Knock-Out Sheep Using CRISPR/Cas9 Technology and Microinjection into Zygotes. PLoS One. 10, (8), 0136690 (2015).
  37. Sun, D., Guo, Z., Liu, Y., Zhang, Y. Progress and Prospects of CRISPR/Cas Systems in Insects and Other Arthropods. Frontiers in Physiology. 8, 608 (2017).
  38. Gagnon, J. A., et al. Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guide RNAs. PLoS One. 9, (5), 98186 (2014).
  39. Kok, F. O., et al. Reverse genetic screening reveals poor correlation between morpholino-induced and mutant phenotypes in zebrafish. Developmental Cell. 32, (1), 97-108 (2015).
  40. Morcos, P. A., Vincent, A. C., Moulton, J. D. Gene Editing Versus Morphants. Zebrafish. 12, (5), 319 (2015).
  41. Mehravar, M., Shirazi, A., Nazari, M., Banan, M. Mosaicism in CRISPR/Cas9-mediated genome editing. Developmental Biology. 445, (2), 156-162 (2019).
  42. Yen, S. T., et al. Somatic mosaicism and allele complexity induced by CRISPR/Cas9 RNA injections in mouse zygotes. Developmental Biology. 393, (1), 3-9 (2014).
  43. Singh, P., Schimenti, J. C., Bolcun-Filas, E. A Mouse Geneticist's Practical Guide to CRISPR Applications. Genetics. 199, (1), 1-15 (2015).
  44. Mianné, J., et al. Analyzing the outcome of CRISPR-aided genome editing in embryos: screening, genotyping and quality control. Methods. 121-122, 68-76 (2017).
  45. van der Emde, G. Encyclopedia of Animal Behavior. Breed, M. D., Moore, J. 1, Academic Press. 16-23 (2010).
  46. Carlson, B. A. Encyclopedia of Neuroscience. Binder, M. D., Hirokawa, N., Windhorst, U., Hirsch, M. C. Springer. 4039-4044 (2009).
  47. Hopkins, C. D. Neruoethology of Electric Communication. Annual Reviews of Neuroscience. 11, 497-535 (1988).
  48. Arnegard, M., Zwickl, D., Lu, Y., Zakon, H. H. Old gene duplication facilitates origin and diversification of an innovative communication system- twice. Proceedings of the National Academy of Sciences of the United States of America. 107, (51), 22172-22177 (2010).
  49. Doench, J. G., et al. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nature Biotechnology. 32, (12), 1262-1267 (2014).
  50. Concordet, J. P., Haeussler, M. CRISPOR: intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens. Nucleic Acids Resarch. 46, 242-245 (2018).
  51. Haeussler, M., et al. Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR. Genome Biology. 17, (1), 148 (2016).
  52. Kirschbaum, F. Environmental factors control the periodical reproduction of tropical electric fish. Experientia. 31, (10), 1159-1160 (1975).
  53. Iwama, G. K., McGeer, J. C., Pawluk, M. P. The effects of five fish anaesthetics on acid-base balance, hematocrit, cortisol and adrenaline in rainbow trout. Canadian Journal of Zoology. 67, 2065-2073 (1989).
  54. Westerfield, M. The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). 4th ed. Univ. of Oregon Press. (2000).
  55. Barrangou, R., Doudna, J. A. Applications of CRISPR technologies in research and beyond. Nature Biotechnology. 34, (9), 933-941 (2016).
  56. Adli, M. The CRISPR tool kit for genome editing and beyond. Nature Communications. 9, (1), 1911 (2018).
  57. Maruyama, T., et al. Increasing the efficiency of precise genome editing with CRISPR-Cas9 by inhibition of nonhomologous end joining. Nature Biotechnology. 33, (5), 538-542 (2015).
  58. Liu, M., et al. Methodologies for Improving HDR Efficiency. Frontiers in Genetics. 9, 691 (2018).
  59. Kirschbaum, F., et al. Intragenus (Campylomormyrus) and intergenus hybrids in mormyrid fish: Physiological and histological investigations of the electric organ ontogeny. Journal of Physiology Paris. 110, 3 Pt B 281-301 (2016).
  60. Jao, L. E., Wente, S. R., Chen, W. Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proceedings of the National Academy of Science of the United States of America. 110, (34), 13904-13909 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics