كفاءه التمايز العصبي باستخدام ثقافة خليه واحده من الخلايا الجذعية الجنينية البشرية

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

المعروض هنا هو بروتوكول لتوليد ثقافة خليه واحده من الخلايا الجذعية الجنينية البشرية والتمايز اللاحقة في خلايا السلف العصبية. البروتوكول بسيط وقوي وقابل للتطوير ومناسب للكشف عن المخدرات وتطبيقات الطب التجديدي.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Jeon, K., Park, K., Jetten, A. M. Efficient Neural Differentiation using Single-Cell Culture of Human Embryonic Stem Cells. J. Vis. Exp. (155), e60571, doi:10.3791/60571 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

التفريق في المختبر من الخلايا الجذعية الجنينية البشرية (hESCs) قد حولت القدرة علي دراسة التنمية البشرية علي المستويين البيولوجي والجزيئي وتوفير الخلايا لاستخدامها في التطبيقات التجديدية. النهج القياسية للثقافة hESC باستخدام ثقافة نوع مستعمره للحفاظ علي Hesc غير متمايزة والجسم الجنيني (EB) وتشكيل الوردة للتمييز في طبقات جرثوميه مختلفه غير فعاله وتستغرق وقتا طويلا. المقدمة هنا هو أسلوب ثقافة خليه واحده باستخدام hESCs بدلا من ثقافة من نوع مستعمره. هذا الأسلوب يسمح الحفاظ علي السمات المميزة لل hESCs غير متمايزة ، بما في ذلك التعبير عن علامات Hescs علي مستويات مماثله لنوع مستعمره hESCs. الاضافه إلى ذلك ، يقدم البروتوكول طريقه فعاله للجيل الخلايا العصبية (المجلس الوطني لنواب الشعب) من نوع خليه واحده hESCs التي تنتج NPCs في غضون أسبوع 1. هذه الخلايا تعبر كثيرا عن الجينات علامة المجلس الوطني ويمكن التفريق في أنواع مختلفه من الخلايا العصبية ، بما في ذلك الخلايا العصبية الدوبامين و astrocytes. هذا النظام الثقافة خليه واحده لل hESCs سيكون مفيدا في التحقيق في أليات الجزيئية لهذه العمليات ، ودراسات لبعض الامراض ، وشاشات اكتشاف المخدرات.

Introduction

الخلايا الجذعية الجنينية البشرية (hESCs) لديها القدرة علي التفريق في الطبقات الجرثومية الاوليه الثلاث ، والتي تفرق بعد ذلك إلى مختلف السلالات خلايا السلف متعددة القوي. هذه السلالات تؤدي فيما بعد إلى جميع أنواع الخلايا في جسم الإنسان. وقد حولت نظم الثقافة في المختبر القدرة علي دراسة تطور الاجنه البشرية واستخدمت كاداه قيمه للحصول علي رؤى جديده حول كيفيه تنظيم هذه العمليات علي المستويين البيولوجي والجزيئي. المثل ، فان دراسات الخلايا الجذعية مستحث المستحثة (iPSCs) المتولدة من أعاده برمجه الخلايا الجسدية المعزولة عن المرضي البشريين توفر رؤى جديده للامراض المختلفة. الاضافه إلى ذلك ، يمكن للبروجنتور والخلايا المتمايزة المستمدة من hescs ان تكون مفيده للبحوث التي تنطوي علي العلاج بالخلايا الجذعية وفحص المخدرات1،2،3،4.

يمكن ان يكون مستحثا hESCs للتمييز في خلايا السلف العصبية (NPCs) ، والتي هي خلايا متعددة الإمكانات مع قدره واسعه التجديد الذاتي. فيما بعد, هذا خلايا يستطيع كنت ميزت داخل خليه عصبيه, [استروستس], و [اوليجوندروسايتس]5,6. كما تقدم NPCs نظاما خلويا للدراسات المختبرية لبيولوجيا النمو العصبي والامراض العصبية المختلفة. ومع ذلك ، فان أساليب الثقافة نوع مستعمره الحالية التي تنطوي علي hescs وتمايزها في npcs غير فعاله وغالبا ما تنطوي علي الزراعة وكذلك الجسم الجنيني (EB) وتشكيل الوردة5،7،8،9. وتظهر هذه البروتوكولات معدلات بقاء اقل وتمايزا عفويا وتستغرق وقتا أطول.

المعروض هنا هو نظام ثقافة محسنه وقويه التي هي قابله للتطوير بسهوله ويستخدم عاليه الكثافة خليه واحده ثقافة نوع من hESCs10. وساهم ادراج مثبطات روه-كيناز (روك) في تعزيز كفاءه البقاء علي قيد الحياة بشكل كبير اثناء ثقافة الخلية الواحدة من النوع hesc10و11و12و13و14. في هذا النظام الثقافي ، يمكن الحفاظ علي الhescs بسهوله وتوسيعها. الاضافه إلى ذلك ، يقدم البروتوكول طريقه فعاله لتوليد npcs من ثقافة نوع خليه واحده من hescs ، الذي يسمح لإنتاج npcs نقيه للغاية. تثبيط BMP/tgfβ/اكتيسين مسارات الإشارات مع مثبطات ألك بكفاءة للحث علي التمايز من نوع واحد من الخلايا hescs في npcs15،16، والتي يمكن ان يسببها بعد ذلك للتمييز في السلالات العصبية وظيفية ، مثل الخلايا العصبية الدوبامين و astrocytes

وباختصار ، فان بروتوكول ثقافة نوع خليه واحده باستخدام hESCs يقدم نموذجا جذابا لدراسة التفريق بين هذه الخلايا في مختلف السلالات ، بما في ذلك NPCs. هذا البروتوكول هو قابل للتطوير بسهوله ، التالي مناسبه لتوليد خلايا للبحوث التي تنطوي علي العلاج التجديدي وفحص المخدرات.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. اعداد الطبقة السفلية المؤهلة لغشاء القبو-لوحات مغلفه

  1. الذوبان ببطء في مصفوفة غشاء الطابق السفلي المؤهلة hESC (انظر جدول المواد) الحل في 4 درجه مئوية لمده لا تقل عن 2-3 h أو بين عشيه وضحيها لتجنب تشكيل هلام.
  2. لاعداد الطابق السفلي غشاء مصفوفة المغلفة لوحات ، وتمييع مصفوفة في DMEM الباردة/F12 إلى تركيز النهائي 2 ٪. تخلط جيدا ومعطف كل بئر من 6 لوحه جيدا مع 1 مل من محلول مصفوفة المخفف.
  3. احتضان الغشاء السفلي مصفوفة الصفائح المغلفة في درجه حرارة الغرفة (RT) لمده 3 ساعات علي الأقل أو عند 4 درجه مئوية بين عشيه وضحيها.
    ملاحظه: يمكن تخزين لوحات مع مصفوفة غشاء الطابق السفلي في 4 درجه مئوية لمده 1 أسبوع قبل أزاله الحل مصفوفة ويتم استخدام لوحات.

2. التكيف من نوع مستعمره hESCs إلى خليه واحده Hescs الثقافة

  1. لتمرير الثقافات الخالية من المغذيات من مستعمره نوع H9 (WA09) hESCs نمت علي مصفوفة غشاء الطابق السفلي ، يستنشق المتوسطة من الآبار (الشكل 1ا)9.
  2. غسل 1x مع 1 مل من DPBS. أضف 1 مل من محلول الاستغناء (1 U/mL) لكل بئر وحضن في 37 درجه مئوية لمده 20 دقيقه.
  3. أزاله الاستغناء ، وغسل الخلايا 1x بلطف مع 2 مل من DMEM/F12 ، وأزاله المتوسطة ، وأضافه 2 مل من DMEM/F12 لكل لوحه.
  4. افصل المستعمرات برفق عن طريق الوضع برفق صعودا وهبوطا ونقلها إلى أنبوب 15 مل.
  5. الطرد المركزي الكريات لمده 2 دقيقه في 370 x g و يستنشق المتوسطة.
  6. لفصل الكريات الخلية في خلايا واحده ، أضافه 2 مل من حل انفصال الخلية (1x تركيز ، انظر جدول المواد) واحتضان في 37 درجه مئوية لمده 10 دقيقه.
  7. خلايا الطرد المركزي لمده 2 دقيقه في 370 x g وأزاله حل مفرزه.
  8. أضافه الطازجة mTeSR1 الإنسان ESC المتوسطة وانفصال الخلايا في خلايا واحده عن طريق الأنابيب لطيف صعودا وهبوطا.
  9. للتكيف نوع مستعمره hESCs إلى ثقافة نوع خليه واحده ، لوحه ما يقرب من 1.5-2.0 x 106 hescs في كل بئر من غشاء القبو مصفوفة المغلفة 6 لوحه جيدا في 2 مل من mTeSR1 التي تحتوي علي 10 ΜM الصخرة المثبط ل 24 ح (الشكل 1ا).
  10. بعد 24 ساعة ، استبدل الوسط hESC مع mTeSR1 الطازجة دون المانع روك والسماح لل Hesc لتنمو كنوع خليه واحده لمده 3 أيام. تغيير المتوسطة يوميا.
  11. في اليوم 4 ، عندما تصل الثقافات إلى ما يقرب من 100 ٪ كونفلوينسي ، فصل الخلايا في حل مفرزه ، ثم أعاده زرع كما هو موضح في الخطوة 2.6.
    ملاحظه: المثبط روك يحسن بقاء الخلية اثناء الاوليه 24 h من نوع خليه واحده الثقافة hESC.

3. تشكيل الجسم الجنيني والتمايز إلى ثلاث طبقات جرثوميه (الشكل 2)

  1. لتشكيل الحديدية ، أول أعاده التعليق الخلايا في 3 مل من المتوسط mTeSR1 مع 10 μM المانع روك خلال 24 ح الاولي ، ثم احتضان بين عشيه وضحيها في 60 مم الاطباق المرفقة منخفضه في 37 درجه مئوية حاضنه للسماح التجميع.
  2. بعد 24 ساعة ، يتم نقل الحديدية الصغيرة إلى أنبوب 15 مل. السماح لل الحديدية يستقر في الجزء السفلي من الأنبوب وأزاله بلطف المتوسطة مع ماصه. نقل الحديدية إلى المستوي المتوسط (الضربة القاضية-DMEM تكمله مع 20% استبدال المصل بالضربة القاضية, 1x الجلوتامين الملحق [انظر جدول المواد], 1% neaa [الأحماض الامينيه غير الاساسيه; انظر جدول المواد], و 0.2% β-mercaptoethanol) والسماح لهم بالتوسع في الاطباق ويمكن تغيير الوسيط كل يوم علي النحو الموصوف أعلاه (الشكل 2ا).
  3. في اليوم 7 ، وجمع الحديدية من الاطباق ونقلها إلى أنبوب 15 مل. أزاله بلطف المتوسطة مع ماصه ونقل الحديدية إلى غشاء الطابق السفلي مصفوفة المغلفة 6 لوحه جيدا.
  4. السماح لل الحديدية لنعلق علي لوحه واحتضان لمده 12 يوما في المتوسط EB ، وخلالها سوف التفريق في طبقات الجرثومية الثلاث (الشكل 2ب). تغيير المتوسطة كل يوم.
    ملاحظه: اثناء تجميع الخلايا ، يساعد طبق المرفق المنخفض علي تجنب المرفق EB.

4. التمايز من نوع خليه واحده hESCs إلى NPCs (الشكل 3)

  1. للحث علي التمايز المجلس الوطني ، انفصال الخلايا أحاديه النوع hESCs مع 1 مل من حل مفرزه (1x) واحتضان لمده 10 دقيقه في 37 درجه مئوية.
  2. الطرد المركزي الخلايا لمده 2 دقيقه في 370 x g وأزاله الحل مفرزه supernatant. أضافه 1 مل من DMEM/F12 وأعاده التعليق الخلايا عن طريق التنضيد لطيف.
  3. خلايا لوحه علي غشاء الطابق السفلي مصفوفة المغلفة 6 لوحه جيدا في كثافة من 2 × 105 خلايا/بئر في 2 مل من mTeSR1 التي تحتوي علي 10 μM المانع روك.
  4. بعد 24 ساعة ، استبدل الوسط الثقافي مع متوسط الحث العصبية (DMEM مع 1 ٪ B27 ناقص فيتامين A) تستكمل مع 1 μM دورسومورفين و 5 μM SB431542.
  5. تغيير المتوسطة كل يوم خلال الأيام الاربعه الاولي من الحث العصبي ، ثم كل يوم حتى الوصول إلى التقاء في اليوم 7 (الشكل 3ب).
    ملاحظه: (1) دورسومورفين يمنع المسار BMP من خلال استهداف ALK2 ، 3 ، 6 مستقبلات وأيضا يمنع AMPK ؛ SB431542 هو مثبط للمسار TGFβ/Activin من خلال استهداف ALK5 ، 7. (2) تم اختبار نفس البروتوكول مع خط ESC آخر (WA01) ، الذي أسفر عن نتائج مماثله كما WA0916. (3) لقد استخدمنا عموما الحاكم لمصفوفة غشاء الطابق السفلي ؛ مهما, خلايا يستطيع كنت مثقفه علي [جلتريكس] وبعد ذلك ميزت داخل [نبكس] مع نتيجات مماثله جدا بما ان يدل بالتعبير من عده [لشعب] علامات (شكل 4[د], [ا]). التعامل مع Geltrex بنفس الطريقة مثل الحاكم (انظر القسم 1).

5. توسيع المجلس الوطني وحجز التبريد

  1. بعد 7 أيام من الحث العصبي ، انفصال الخلايا مع 1 مل من حل مفرزه (1x) واحتضان لمده 10 دقيقه في 37 درجه مئوية.
  2. الطرد المركزي الخلايا لمده 2 دقيقه في 370 x g وأزاله الحل مفرزه supernatant. أضافه 1 مل من المتوسط التوسع المجلس الوطني (انظر جدول المواد) وأعاده التعليق الخلايا عن طريق التنضيد لطيف.
  3. لوحه 1 × 105 خلايا في 2 مل من المجلس الوطني للتوسع المتوسطة علي غشاء القبو مصفوفة المغلفة 6 لوحات جيدا.
  4. مرور NPCs عده مرات ، حسب الضرورة ، عندما تصل الثقافات ما يقرب من 90 ٪ كونفلوينسي. خلال الممرات 3 – 4 الاولي ، أضافه 10 μM المانع روك خلال 24 ح الاولي لمنع موت الخلايا. بعد هذه الممرات ، يمكن ان تكون الخلايا المرور ومثقف دون المانع روك. تغيير المتوسطة كل يوم خلال التوسع.
  5. أجهزه الكمبيوتر الشخصية بالتبريد عندما تصل الثقافات إلى كونفلوينسي.
    1. بالنسبة للحجز بالتبريد ، يتم فصل الخلايا في 1 مل من محلول الانفصال (1x) لمده 5 دقائق عند 37 درجه مئوية ، ثم التعليق الطارد المركزي لمده 2 دقيقه عند 370 × g لأزاله حل الانفصال.
    2. أضافه محلول تجميد الخلية (انظر جدول المواد) لفصل npcs في 1 × 106 خلايا/مل وتوزيع 1 مل قسامات لتخزن.
    3. وضع تخزن في حاويه تجميد وتخزينها بين عشيه وضحيها في 80 درجه مئوية الفريزر.
  6. تخزين التخزن في النيتروجين السائل.

6-اعداد الصفائح المطلية بالبولي-L-اورنيثين (منظمه التحرير الفلسطينية) Laminin

  1. لاعداد لوحات منظمه التحرير الفلسطينية/laminin المغلفة ، تمييع الحل الأسهم منظمه التحرير الفلسطينية في تلفزيوني أو المياه إلى تركيز نهائي من 10 ميكروغرام/مل. تخلط جيدا ومعطف كل بئر من 6 لوحه جيدا مع 1 مل من حل منظمه التحرير الفلسطينية المخفف.
  2. احتضان لمده 2 ساعة علي الأقل في 37 درجه مئوية أو بين عشيه وضحيها في 4 درجه مئوية.
  3. اغسل كل بئر مع تلفزيوني.
  4. تمييع حل الأسهم laminin في الباردة أو المياه بالماء في 10 ميكروغرام/مل. مزيج الحل laminin جيدا. أزاله التلفزيونية وعلي الفور معطف كل بئر مع 1 مل من الحل laminin. حافظ علي الصفائح عند درجه حرارة 4 درجات مئوية واستخدمها خلال أسبوع واحد. غسل مع تلفزيوني وأضافه فورا الثقافة المتوسطة.
    ملاحظه: لا تدع لوحات منظمه التحرير الفلسطينية/laminin المغلفة تجف.

7. التفريق بين NPCs المشتقة hESC إلى الخلايا العصبية دوامينرجيك (الشكل 6ا)

  1. لوحه NPCs في منظمه التحرير الفلسطينية/laminin الاطباق المغلفة في وسط التوسع المجلس الوطني في كثافة ما يقرب من 50 ٪.
  2. بعد 24 ساعة ، تغيير المتوسطة إلى DA1 المتوسطة (المتوسطة العصبية التي تحتوي علي 2 مم الجلوتامين الملحق ، 1x NEAA ، 1x B27 ، 200 ng/mL ش ، و 100 ng/mL FGF8) وتغيير المتوسطة كل يوم.
  3. مرور الثقافات عندما تصل إلى كونفلوينسي. فصل الخلايا مع 1 مل من حل انفصال (1x) واحتضان لمده 10 دقيقه في 37 درجه مئوية.
  4. الطرد المركزي الخلايا لمده 2 دقيقه في 370 x g وأزاله الحل مفرزه supernatant. أضافه 1 مل من DA1 المتوسطة وأعاده تعليق الخلايا عن طريق الأنابيب لطيف.
  5. لوحه 1 × 105 خلايا في 2 مل من DA1 المتوسطة علي منظمه التحرير الفلسطينية/laminin المغلفة 6 لوحات جيدا.
  6. بعد 10 أيام ، تغيير إلى DA2 المتوسطة (المتوسطة العصبية التي تحتوي علي 2 مم الجلوتامين الملحق ، 1x NEAA ، 1x B27 ، حمض الاسكوربيك 200 μM ، 20 نانوغرام/مل BDNF ، و 20 نانوغرام/مل GNDF) وتغيير متوسطه كل يوم لمده 20 يوما اضافيه (الشكل 6ا).
    ملاحظه: أضافه حمض الاسكوربيك الطازجة يوميا إلى DA2 المتوسطة. خلال الأيام ال 14 الاولي ، يجب ان يتم تمرير الخلايا المتمايزة عندما تصل إلى 90 ٪ كونفلوينسي ، ولكن لم يعد بعد ذلك.

8. التمايز من NPCs المستمدة من ESC إلى Astrocytes

  1. لوحه خلايا السلف العصبية علي لوحات منظمه التحرير الفلسطينية/laminin المغلفة في وسط توسيع المجلس الوطني في كثافة من حوالي 50 ٪.
  2. بعد 24 ساعة ، تغيير المتوسطة إلى المتوسطة تموت (dmem/F12 المتوسطة بما في ذلك 1:100 N2 ، 1:100 B27 ، 200 ng/ml igf-1 ، 10 نانوغرام/مل activin A ، 10 نانوغرام/مل heregulin β-1 ، و 8 نانوغرام/مل bfgf) وتغيير المتوسطة كل يوم.
  3. مرور الثقافات عندما تصل إلى كونفلوينسي. فصل الخلايا مع 1 مل من حل انفصال (1x) واحتضان لمده 10 دقيقه في 37 درجه مئوية.
  4. الطرد المركزي الخلايا لمده 2 دقيقه في 370 x g وأزاله الحل مفرزه supernatant. أضافه 1 مل من المتوسطة تموت وأعاده تعليق الخلايا عن طريق الأنابيب لطيف.
  5. لوحه 1 × 105 خلايا في 2 مل من المتوسطة تموت علي منظمه التحرير الفلسطينية/laminin 6 اطباق جيدا.
  6. السماح باستمرار التمايز لما مجموعه 5-6 أسابيع (الشكل 6ب).

9. تلطيخ المناعي

  1. الخلايا الثقافية في 35 مم μ-اطباق كما هو موضح أعلاه لكل نوع الخلية. يستنشق المتوسطة وأضافه 1 مل من 4 ٪ الحل PFA لكل طبق واحتضان لمده 20 دقيقه في RT.
  2. غسل 2x لمده 5 دقائق مع تلفزيوني.
    ملاحظه: بمجرد ان يتم إصلاح الخلايا ، يمكن ان تكون مختومه لوحات الفحص مع بارافيلم وتخزينها في 4 درجه مئوية. وصمه عار مع الأجسام المضادة في غضون أسبوع 1 بعد التثبيت.
  3. أضف 300 μL من محلول الحجب (مصل الماعز أو الحمير في التليفزيون) لكل طبق واحتضانه في RT لمده 30 – 60 دقيقه.
  4. غسل الطبق 2x مع تلفزيوني لمده 5 دقائق.
  5. أضافه 300 μL من الأجسام المضادة الاساسيه (الجدول 1) حل (المخفف في حل الحجب) واحتضان في RT ل 1.5 h أو بين عشيه وضحيها في 4 ° c.
  6. غسل 2x مع تلفزيوني لمده 10 دقيقه.
  7. أضافه 300 μL من الأجسام المضادة الثانوية التي مترافقة مع الفلورسنت (الجدول 1) في حل الحجب واحتضان في الظلام لمده 1 ساعة في RT.
  8. غسل الخلايا 2x لمده 10 دقيقه مع تلفزيوني.
  9. أضافه الحل تلطيخ Hoechst (1 μM التركيز النهائي في الاذاعه التلفزيونية) إلى نوى وصمه عار. احتضان الخلايا في الظلام لمده 5 دقائق في RT.
  10. غسل الخلايا 1x مع تلفزيوني لمده 5 دقائق ثم أضافه 500 μL من تلفزيوني. الحفاظ علي الاطباق في الظلام ، ثم لاحظ مضان مع المجهر البؤري (الشكل 2ب، الشكل 5ج، الشكل 6ا، والشكل 7ب).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

المعروض هنا هو بروتوكول محسن للحفاظ علي وتوسيع ثقافة نوع خليه واحده من hESCs وتمايزها كفاءه في خلايا السلف العصبية ، والتي تميز في وقت لاحق إلى مختلف السلالات العصبية المصب ، بما في ذلك الخلايا العصبية والاستروسيتيه.

تظهر الصور المتباينة للمرحلة التمثيلية شكل الخلية في خطوات مختلفه اثناء التكيف مع نوع المستعمرات hESCs إلى ثقافة نوع الخلية الواحدة (الشكل 1ا). ومن خلال الحالة الثقافية للخلية الواحدة ، تبين انه يمكن الاحتفاظ بالhescs المعدلة بكثافة عاليه ، ثم تتم زراعتها بسهوله وكفاءه عند الوصول إلى الكونفلوينسي (الشكل 1ا ، باء). واحتفظت هذه الخلايا بخصائص دوره الخلية (اي مرحله G1 القصيرة ونسبه عاليه من الخلايا في المرحلة S) نموذجيه من نوع المستعمرة hESCs (الشكل 1ج ، د). كما أعربوا عن علامات ESC (اي OCT4, TRA 1-81, SOX2, و NANOG) علي مستويات مماثله لتلك التي من نوع المستعمرات hESCs كما هو مبين في QRT-PCR وتحليل المناعة (الشكل 7، الجدول 2). وعلاوة علي ذلك ، تبين ان الاجهزه أحاديه الخلية قادره علي تشكيل الأجسام الجنينية التي تحتوي علي خلايا من جميع الطبقات الجرثومية الثلاث: الأديم الباطن (تعبير SOX17) ، والأديم المتوسط (التعبير SMA) والأديم الإحيائي (التعبير Tuj-1) (الشكل 2).

بعد ذلك ، تم التدليل علي ان الخلايا أحاديه الخلية من النوع الذي يميز بكفاءة في زنزانات السلف العصبية باستخدام بروتوكول المجلس الوطني لنواب الشعب (الشكل 3ا) ، كما يدل علي ذلك فقدان الشكل والمظهر النموذجي لمجلس الشعب (الصورة3ب)16. وكانت التفرقة بين مجلس الشعب مدعومة بالتعبير المتزايد عن علامات التوقيع علي المجلس الوطني (اي SOX1 و OTX2 و ZIC1 و OTX1 ؛ الشكل 5(ا) ، الجدول 2) وأكده تحليل المناعة والfacs. واظهر نفس التحليل أيضا ان أكثر من 90 ٪ من الخلايا الملونة الايجابيه لSOX1 ، PAX6 ، وبروتين NCAM (الشكل 5ب ، ج). لفحص قدره الخلايا الاحاديه المشتقة hESC للتمييز في مختلف السلالات العصبية المصب ، تم فحص التفريق بين هذه الخلايا في الخلية العصبية والخلية الفلكية. وكما هو مبين في الشكل 6ا ، باء، كانت أجهزه الكمبيوتر المحمولة المشتقة من الخلية الواحدة قادره علي التفريق في الخلايا العصبية والأسطرلابات التي تتميز بالخلايا ، كما يدل علي ذلك ظهور التحويرات المميزة والتعبير عن علامات النسب الخاصة بالسلالات (اي. الشكل 6(ا) وعلامات تموت (اي gfap و S100B ؛ الشكل 6(ب).

Figure 1
الشكل 1: التكيف مع نوع المستعمرات الخاصة بثقافة نوع الخلية الواحدة. (ا) صور النقيض المرحلة التمثيلية للثقافات خليه واحده من H9 hescs في أوقات مختلفه بعد الطلاء علي 2 ٪ غشاء الطابق السفلي مصفوفة المغلفة الاطباق. انخفاض (يسار) وارتفاع (يمين) التكبير. اللوحة العلوية: صوره تمثيليه لنوع المستعمرة hESCs. وتظهر لوحات أخرى صورا تمثيليه للثقافات في أوقات مختلفه اثناء التكيف مع الخلايا الاحاديه النوع hESCs. شريط مقياس = 200 μm. (ب) تم رصد منحنيات النمو من H9 hescs في 2 ٪ غشاء الطابق السفلي مصفوفة المغلفة لوحات مع 10 μM المانع روك لل 24 ساعة الاولي خلال حاله ثقافة خليه واحده. (جيم ، دال) تحليل دوره الخلية من نوع المستعمرة (C) ونوع الخلية الواحدة (D) H9 hescs بواسطة قياس التدفق الخلوي. يرجى النقر هنا لعرض نسخه أكبر من هذا الرقم.

Figure 2
الشكل 2: التفريق في المختبر لمعدلات الخلايا المفردة المكيفة في ثلاث طبقات جرثوميه. (ا) صور المرحلة التمثيلية للهيئات الجنينية المستمدة من نوع الخلية الواحدة. شريط مقياس = 100 μm. (ب) الصور المناعية لل hescs المتمايزة التي حللت للتعبير عن علامات الطبقات الجرثومية الثلاث المختلفة: SOX17 (الأديم الباطن) ، SMA (الأديم المتوسط) ، و tuj-1 (ectoderm). وكانت النوى ملطخه DAPI. شريط مقياس = 50 μm. يرجى النقر هنا لعرض نسخه أكبر من هذا الرقم.

Figure 3
الشكل 3: التفريق بين التردد الأحادي الخلية في الخلايا الجذعية العصبية بالتمايز المباشر. (ا) التخطيط لبروتوكول التمايز الخاص بالترددات الوراثية في خلايا السلف العصبية (npcs). وعولجت الhescs مع دورسومورفين (DMH) و SB431542 (SB) بعد يوم واحد من الطلاء. (ب) صور تباين المرحلة التمثيلية لمورفولوجية الخلية اثناء التمايز العصبي. شريط مقياس = 200 μm. يرجى النقر هنا لعرض نسخه أكبر من هذا الرقم.

Figure 4
الشكل 4: الثقافة hESC علي مختلف المنتجات مصفوفة غشاء الطابق السفلي. (ا) أظهرت الhescs المستزرعة علي الجهاز الحاكم أو جيلتريكس قدره علي النمو والتفريق في الحواسيب الشخصية التي كانت مشابهه لثقافة الخلية الواحدة. كانت ملطخه الخلايا مع الأجسام المضادة NESTIN. وكانت النوى ملطخه DAPI. شريط مقياس = 50 μm. (ب) وأظهرت الhescs المستزرعة علي الجهاز الأمومي أو geltrex امكانيه مماثله للتمييز في الاجهزه الكترونيه كما هو مبين في النسبة المئوية للخلايا الموجبة لل npcs-و PAX6. تم تحليل الخلايا عن طريق التدفق الخلوي في اليوم 7 من تمايز المجلس الوطني. يرجى النقر هنا لعرض نسخه أكبر من هذا الرقم.

Figure 5
الشكل 5: التعبير عن علامات المجلس الوطني. (ا) بعد 7 أيام من التمايز العصبي ، تم تحليل التعبير عن جينات علامة المجلس الوطني (اي ، OTX1 ، OTX2 ، SOX1 ، و ZIC1) من قبل QRT-PCR. تم تطبيع القيم إلى جابده وتحسب بالنسبة إلى قيم hESCs (p < 0.05). (ب) تم تحديد النسبة المئوية للخلايا الموجبة لSOX1-، nestin-، SOX2-و nestin من خلال قياس التدفق الخلوي في اليوم 7 من تمايز المجلس الوطني. (ج) في اليوم 7 التمايز المجلس الوطني ، كانت ملطخه الخلايا مع الأجسام المضادة ضد علامات العصبية SOX1 ، NESTIN ، NESTIN ، OTX2 ، و PAX6. وكانت النوى ملطخه DAPI. شريط مقياس = 100 μm. يرجى النقر هنا لعرض نسخه أكبر من هذا الرقم.

Figure 6
الشكل 6: الخلايا العصبية والتمايز تموت من npcs مشتقه من أحاديه الخلية نوع hescs. (ا) صوره النقيض المرحلة التمثيلية من الخلايا العصبية الدوبامين (اللوحة العليا). شريط مقياس = 100 μm. كانت ملطخه الخلايا المتمايزة مع الأجسام المضادة ضد مؤشر الخلية العصبية الدوبامين (تيروزين هيدروكسيلاز) كما هو مبين. وكانت النوى ملطخه DAPI. شريط مقياس = 50 μm. (ب) صوره النقيض من المرحلة التمثيلية لأسطرلاب الفلكي (اللوحة العليا). شريط مقياس = 100 μm. كانت ملطخه الخلايا المتمايزة مع الأجسام المضادة ضد علامة تموت (البروتين الحمضي الليفي الدليطي) و S100 (S100 الكالسيوم ملزمه البروتين B) ، كما هو مبين. وكانت النوى ملطخه DAPI. شريط مقياس = 50 μm. يرجى النقر هنا لعرض نسخه أكبر من هذا الرقم.

Figure 7
الشكل 7: توصيف نوع الخلية الواحدة. (ا) تم تحليل الhescs المتكيفة مع ثقافة النوع أحاديه الخلية للتعبير عن علامات ESC (اي OCT4 و NANOG و SOX2) بواسطة QRT-PCR. تم تطبيع القيم إلى جابده (ص < 0.05). (ب) الصور المناعية لل hescs الملطخة للتعبير عن علامات التعدد OCT4 ، TRA-1-81 ، و ssea-1. وكانت النوى ملطخه DAPI. شريط مقياس = 50 μm. يرجى النقر هنا لعرض نسخه أكبر من هذا الرقم.

الأجسام المضادة الاوليه الانواع التخفيف رقم الكتالوج الشركه
OCT4 الماوس 1:1000 sc-5279 سانتا كروز
هيئه تنظيم ال1-81 الماوس 1:500 sc-21706 سانتا كروز
SSEA-1 الماوس 1:500 sc-21702 سانتا كروز
SOX1 الماعز 1:500 AF-3369 R & D
SOX2 الارنب 1:1000 sc-20088 سانتا كروز
Sma الارنب 1:500 ab-5694 سهم abcam
Tuj1 الماوس 1:1000 T8578 سيغما
النستين الماوس 1:1000 ab-22035 سهم abcam
OTX2 الماوس 1:250 ab-21990 سهم abcam
هنكام الماوس 1:200 sc-106 سانتا كروز
hPAX6 الماوس 1:250 561664 دينار بحريني
ال الماوس 1:500 T1299 سيغما
S100b الماوس 1:250 ab4066 سهم abcam
توصيني الارنب 1:1000 ab7260 سهم abcam
الأجسام المضادة الثانوية
المضادة للماوس الماعز 1:1000 AF 488 أو 647 تقنيات الحياة
المضادة للأرانب الماعز 1:1000 AF 488 أو 647 تقنيات الحياة

الجدول 1: الأجسام المضادة المستخدمة في الكيمياء المناعية وتحليل FACS.

اسم التمهيدي تسلسل التمهيدي
OCT4 F: GGAGGTATTCAGCCAAACG
R: CTCCAGGTTGCCTCTCACTC
NANOG اللغة الانجليزيه:
البحث والتطوير:
SOX1 F: CCTTAGGTTTCCTCGCTTT
R: CAGGCTGAATTGTTCTCATT
OTX1 اللغة الانجليزيه: الإناث
R: CGTGAATTCCACTGCTTT
OTX2 F: TGGAAGCACTGTTTGCCAAG
R: TAAACCATACCTGCACCCTCG
ZIC1 F: آككككااااجتكجتجكاك
R: TCCTCCCAGAAGCAGATGTGA
في المغربية F: CCCATCACCATCTTCCAGGAG
R: CTTCTCCATGGTGGTGAAGACG

الجدول 2: قائمه الإشعال المستخدمة في تحليل QRT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

ومن المعايير الهامه لفحص المخدرات والعلاج بالخلايا الجذعية الطرق القابلة للتطوير والكفاءة للتفريق بين الhescs والسلالات المختلفة وتوليد اعداد كافيه من الخلايا المتمايزة. وقد نشرت مختلف طرق تمرير خليه واحده, في الخلايا التي يتم استزراعها في وجود مثبطات الصخور أو غيرها من الجزيئات الصغيرة لتحسين البقاء علي قيد الحياة, ولكن المنتجات النهائية لهذه الأساليب الثقافة هي مستعمره نوع hescs17,18,19,20,21. بروتوكول ESC أحاديه الخلية ، الذي يستند جزئيا إلى الأساليب المنشورة سابقا19،20،21،22، بنجاح بإنشاء ويحافظ علي الثقافات hesc أحاديه النوع الخلية ويمنع الثقافة نوع المستعمرة hesc. ويشمل ارتفاع كثافة الطلاء خليه واحده ، وجمعيه متعددة الخلايا ، والنمو أحاديه الطبقة ، والثقافة الفرعية كفاءه (الشكل 1). وقد تحقق هذا الأخير من خلال أضافه مثبطات الصخور خلال 24 ساعة الاولي من ثقافة نوع خليه واحده من hescs ، مما يحسن بقاء الخلية17،18،19،20،21. هذا البروتوكول هو أكثر سهوله للتطوير ويسمح توسيع هذه الخلايا للتطبيقات العلاجية في فحص المخدرات والخلايا الجذعية.

ومن الواضح أيضا ان التردد الأحادي الخلية يمكن ان يميز بكفاءة مع سلاله المجلس الوطني (الشكل 3) دون استخدام المرحلة المتوسطة ، مثل تشكيل EB والوردة23،24،25. تم تحقيق التحويل العصبي العالي من نوع خليه واحده hescs من خلال تثبيط BMP/tgfβ/اكتيبين مسارات الإشارات عن طريق العلاج مع مثبطات ألك ، دورسومورفين ، و SB43154215،16،26. مع هذا البروتوكول ، يمكن التمييز بين نوع الخلية الواحدة المعدلة بكفاءة في أجهزه الكمبيوتر الشخصية دون الحاجة إلى تشكيل EB والوردة (الشكل 5) و أو تكون مستحثه للتمييز في الخلايا العصبية والأسطرلابات الفلكية (الشكل 6).

باختصار ، ثقافة نوع خليه واحده من hESCs يوفر نظام سريع وفعال لدراسة أليات الجزيئية التي تنظم التمايز متعدد الخطوات لسلالات مختلفه. وعلي وجه التحديد ، استخدم هذا البروتوكول npcs ووصف التمايز اللاحقة إلى السلالات العصبية اضافيه ، مثل استروسيتيس والخلايا العصبية الدوبامين. يوفر البروتوكول منصة لإنتاج بسيطه وقويه وقابله للتطوير من السلف والخلايا المتمايزة التي يمكن ان تكون مناسبه للدراسات الاساسيه ، وفحص المخدرات ، والتطبيقات في الطب التجديدي.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

ولا يعلن أصحاب البلاغ عن اي تضارب في المصالح.

Acknowledgments

نشكر الدكتور كارل د. بورتنر (NIEHS) علي مساعدته في تحليل النظام. وقد حظي هذا البحث بدعم برنامج البحوث داخل المعهد الوطني للعلوم الصحية البيئية ، والمعاهد الوطنية للصحة ، Z01-101585 إلى AMJ.

Materials

Name Company Catalog Number Comments
35 mm m-dishes ibidi 81156 Cell culture dish
6-well plates Corning 3516
Accutase Innovative Cell Technologies AT104-500 Cell detachment solution
Activin A R&D system 338-AC-050
Ascorbic Acid Sigma Aldrich A4403
B27 supplement Thermo Fisher 17504044
B27 supplement (-Vit A) Thermo Fisher 12587010
BDNF Applied Biological Materials Z100065
bFGF Peprotech 100-18C
Centrifuge DAMON/ICE 428-6759
CO2 incubator Thermo Fisher 4110
Corning hESC-qulified Matrix (Magrigel) Corning 354277 Basement membrane matrix (used for most of the protocol here)
Cryostor CS 10 Stemcell Technologies 7930 Cell freezing solution
Dispase Stemcell Technologies 7923
DMEM Thermo Fisher 10569-010
DMEM/F12 Thermo Fisher 10565-018
Dorsomorphin Tocris 3093
EGF Peprotech AF-100-16A
Fetal Bovine Serum Fisher Scientific SH3007003HI
FGF8 Applied Biological Materials Z101705
GDNF Applied Biological Materials Z101057
Geltrex matrix Thermo Fisher A1569601 Basement membrane matrix
GlutaMax Thermo Fisher 35050061 Glutamine supplement, 100X
H9 (WA09) human embryonic stem cell line WiCell WA09
Heregulin b-1 Peprotech 100-3
IGF Peprotech 100-11
Knockout DMEM Thermo Fisher 10829018
Knockout Serum Replacement Thermo Fisher 10828028
Laminin Sigma Aldrich L2020
mTeSR1 Stemcell Technologies 85850 hESC culture medium
N2 supplement Thermo Fisher 17502001
NEAA Thermo Fisher 11140050
Neurobasal Thermo Fisher 21103049
Poly-L-ornithine Sigma Aldrich P3655
ROCK inhibitor Tocris 1254
SB431542 Tocris 1614
SHH Applied Biological Materials Z200617
Stemdiff Neural Progenitor medium Stemcell Technologies 5833 NPC expansion medium

DOWNLOAD MATERIALS LIST

References

  1. Thomson, J. A., et al. Embryonic stem cell lines derived from human blastocysts. Science. 282, (5391), 1145-1147 (1998).
  2. Rosler, E. S., et al. Long-term culture of human embryonic stem cells in feeder-free conditions. Developmental Dynamics. 229, (2), 259-274 (2004).
  3. Mallon, B. S., Park, K. Y., Chen, K. G., Hamilton, R. S., McKay, R. D. Toward xeno-free culture of human embryonic stem cells. The International Journal of Biochemistry & Cell Biology. 38, (7), 1063-1075 (2006).
  4. Hoffman, L. M., Carpenter, M. K. Characterization and culture of human embryonic stem cells. Nature Biotechnology. 23, (6), 699-708 (2005).
  5. Yan, Y., et al. Efficient and rapid derivation of primitive neural stem cells and generation of brain subtype neurons from human pluripotent stem cells. Stem Cells Translational Medicine. 2, (11), 862-870 (2013).
  6. Goncalves, J. T., Schafer, S. T., Gage, F. H. Adult Neurogenesis in the Hippocampus: From Stem Cells to Behavior. Cell. 167, (4), 897-914 (2016).
  7. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nature Biotechnology. 25, (6), 681-686 (2007).
  8. International Stem Cell Initiative. Characterization of human embryonic stem cell lines by the International Stem Cell Initiative. Nature Biotechnology. 25, (7), 803-816 (2007).
  9. Hartung, O., Huo, H., Daley, G. Q., Schlaeger, T. M. Clump passaging and expansion of human embryonic and induced pluripotent stem cells on mouse embryonic fibroblast feeder cells. Current Protocols in Stem Cell Biology. 14, (1), Chapter 1 Unit 1C 10 (2010).
  10. Chen, K. G., et al. Non-colony type monolayer culture of human embryonic stem cells. Stem Cell Research. 9, (3), 237-248 (2012).
  11. Chen, G., Hou, Z., Gulbranson, D. R., Thomson, J. A. Actin-myosin contractility is responsible for the reduced viability of dissociated human embryonic stem cells. Cell Stem Cell. 7, (2), 240-248 (2010).
  12. Li, X., Krawetz, R., Liu, S., Meng, G., Rancourt, D. E. ROCK inhibitor improves survival of cryopreserved serum/feeder-free single human embryonic stem cells. Human Reproduction. 24, (3), 580-589 (2009).
  13. Ohgushi, M., et al. Molecular pathway and cell state responsible for dissociation-induced apoptosis in human pluripotent stem cells. Cell Stem Cell. 7, (2), 225-239 (2010).
  14. Pakzad, M., et al. Presence of a ROCK inhibitor in extracellular matrix supports more undifferentiated growth of feeder-free human embryonic and induced pluripotent stem cells upon passaging. Stem Cell Reviews and Reports. 6, (1), 96-107 (2010).
  15. Chambers, S. M., et al. Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling. Nature Biotechnology. 27, (3), 275-280 (2009).
  16. Jeon, K., et al. GLIS3 Transcriptionally Activates WNT Genes to Promote Differentiation of Human Embryonic Stem Cells into Posterior Neural Progenitors. Stem Cells. 37, (2), 202-215 (2019).
  17. Emre, N., et al. The ROCK inhibitor Y-27632 improves recovery of human embryonic stem cells after fluorescence-activated cell sorting with multiple cell surface markers. PLoS ONE. 5, (8), e12148 (2010).
  18. Hanna, J., et al. Human embryonic stem cells with biological and epigenetic characteristics similar to those of mouse ESCs. Proceedings of the National Academy of Sciences of the United States of America. 107, (20), 9222-9227 (2010).
  19. Saha, K., et al. Surface-engineered substrates for improved human pluripotent stem cell culture under fully defined conditions. Proceedings of the National Academy of Sciences of the United States of America. 108, (46), 18714-18719 (2011).
  20. Tsutsui, H., et al. An optimized small molecule inhibitor cocktail supports long-term maintenance of human embryonic stem cells. Nature Communications. 2, 167 (2011).
  21. Xu, Y., et al. Revealing a core signaling regulatory mechanism for pluripotent stem cell survival and self-renewal by small molecules. Proceedings of the National Academy of Sciences of the United States of America. 107, (18), 8129-8134 (2010).
  22. Ungrin, M. D., Joshi, C., Nica, A., Bauwens, C., Zandstra, P. W. Reproducible, ultra high-throughput formation of multicellular organization from single cell suspension-derived human embryonic stem cell aggregates. PLoS ONE. 3, (2), e1565 (2008).
  23. Kim, D. S., et al. Highly pure and expandable PSA-NCAM-positive neural precursors from human ESC and iPSC-derived neural rosettes. PLoS ONE. 7, (7), e39715 (2012).
  24. Sun, Y., Hu, J., Zhou, L., Pollard, S. M., Smith, A. Interplay between FGF2 and BMP controls the self-renewal, dormancy and differentiation of rat neural stem cells. Journal of Cell Science. 124, (Pt 11), 1867-1877 (2011).
  25. Zhou, J. M., Chu, J. X., Chen, X. J. An improved protocol that induces human embryonic stem cells to differentiate into neural cells in vitro. Cell Biology International. 32, (1), 80-85 (2008).
  26. Smith, J. R., et al. Inhibition of Activin/Nodal signaling promotes specification of human embryonic stem cells into neuroectoderm. Developmental Biology. 313, (1), 107-117 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics