בידול עצבי יעיל באמצעות התרבות תא יחיד של תאי גזע האדם העובריים

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

מוצג כאן הוא פרוטוקול עבור הדור של התרבות תא יחיד של תאי גזע האדם העובריים והבידול שלהם לתוך תאים מחולל קדמון. הפרוטוקול הוא פשוט, חסון, מדרגי, ומתאים לסינון סמים וליישומים רפואת התחדשות.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Jeon, K., Park, K., Jetten, A. M. Efficient Neural Differentiation using Single-Cell Culture of Human Embryonic Stem Cells. J. Vis. Exp. (155), e60571, doi:10.3791/60571 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

בבידול חוץ גופית של תאי גזע האדם העובריים (hESCs) הפכה את היכולת ללמוד התפתחות אנושית על רמות ביולוגיות ומולקולרי וסיפק תאים לשימוש ביישומים משובי. גישות סטנדרטיות עבור תרבות hESC באמצעות תרבות סוג המושבה כדי לשמור על מובחן hESCs ו embryoid הגוף (EB) ו שושנת היווצרות עבור בידול לתוך שכבות נבט שונות הם יעילים זמן רב. המוצג כאן הוא שיטת תרבות חד-תאית באמצעות hESCs במקום תרבות מסוג מושבה. שיטה זו מאפשרת תחזוקה של התכונות האופייניות של hESCs מובחן, כולל ביטוי של סמנים hESC ברמות הדומות לסוג המושבה hESCs. בנוסף, הפרוטוקול מציג שיטה יעילה תא מחולל קדמון (NPC) הדור מסוג תא יחיד hESCs המייצרת NPCs בתוך שבוע 1. תאים אלה מאוד לבטא מספר הגנים NPC סמן והוא יכול להבדיל לתוך סוגים שונים של תאים עצביים, כולל נוירונים ומיאסטאלוגיים ו astrocytes. זו מערכת התרבות היחידה עבור hESCs יהיה שימושי בחקירת מנגנונים מולקולריים של תהליכים אלה, מחקרים של מחלות מסוימות, מסכי גילוי סמים.

Introduction

האדם תאים גזע עובריים (hESCs) יש את הפוטנציאל להבדיל לתוך שלוש שכבות הנבט הראשי, אשר לאחר מכן להבדיל לתוך שונים מרובי עוצמה מחולל שורה של תאים. לאחר שנים אלה מעניקים את כל סוגי התאים בגוף האדם. ב מערכות התרבות hESC הפכה את היכולת ללמוד פיתוח עובריים האדם שימשו ככלי רב ערך לקבלת תובנות חדשות לגבי איך תהליכים אלה מוסדרים ברמות הביולוגי והמולקולרי. באופן דומה, מחקרים של תאי גזע פלוריטי המושרה (iPSCs) שנוצרו מתאים סומלי מחדש מבודדים מחולים אנושיים לספק תובנות הרומן לתוך מחלות שונות. בנוסף, התאים מחולל והבדיל שנגזר מ hESCs יכול להיות שימושי עבור מחקר מעורבים טיפול בתאי גזע והקרנת סמים1,2,3,4.

hESCs יכול להיות המושרה להבדיל לתוך תאים מחולל קדמון (NPCs), שהם תאים פוטנציאליים רב עם קיבולת עצמית לחידוש עצמי. לאחר מכן, תאים אלה יכולים להיות מובחנים לנוירונים, astrocytes, ו oligodendrocytes הפוך5,6. NPCs מציעים גם מערכת סלולרית ללימודי חוץ גופית של ביולוגיה נוירו-התפתחותית ומחלות נוירולוגיות שונות. עם זאת, המושבה הנוכחית סוג שיטות תרבות מעורבים hESCs והבידול שלהם לתוך npcs הם יעילים ולעתים קרובות כרוכים התרבות, כמו גם embryoid הגוף (EB) ו שושנת המערך5,7,8,9. פרוטוקולים אלה מציגים שיעורי הישרדות נמוכים יותר והבחנה ספונטנית והיא צורכת זמן רב יותר.

מוצג כאן היא מערכת תרבותית משופרת ואיתנה, כי הוא מדרגי בקלות ומשתמש בצפיפות גבוהה תא בודד התרבות סוג של hESCs10. הכללת roh-קינאז (רוק) מעכב תרמו באופן משמעותי יעילות ההישרדות במהלך התרבות סוג תא יחיד של hesc10,11,12,13,14. במערכת זו של התרבות, hESCs ניתן לשמור ולהרחיב בקלות. בנוסף, הפרוטוקול מציג שיטה יעילה להפקת npcs מתרבות סוג תא בודד של hESCs, אשר מאפשר את הייצור של npcs טהור מאוד. עיכוב של BMP/TGFβ/פעילות מסלולים איתות עם מעכבי האלק ביעילות לגרום בידול של תא יחיד סוג hESCs לתוך npcs15,16, אשר לאחר מכן יכול להיות המושרה להבדיל לתוך שורה עצבית תפקודית, כגון נוירונים מתוגיים ו astrocytes.

לסיכום, פרוטוקול התרבות סוג תא בודד באמצעות hESCs מציע מודל אטרקטיבי ללמוד את הבידול של תאים אלה לתוך הגילאים שונים, כולל NPCs. פרוטוקול זה הוא מדרגי בקלות ולכן מתאים ליצירת תאים למחקר מעורבים טיפול משובי והקרנת סמים.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. הכנת ממברדת מרתף מוסמכת-צלחות מצופות

  1. הפשרת לאט את מטריצת קרום המרתף של hESC-מוסמך (ראה טבלת חומרים) ב -4 ° c עבור לפחות 2 – 3 h או לילה כדי למנוע היווצרות של ג'ל.
  2. כדי להכין ממברדת מרתפים לוחות מצופים, לדלל את המטריצה ב-DMEM קר/F12 2% הריכוז הסופי. מערבבים היטב ומעילים כל באר של 6 היטב צלחת עם 1 מ ל של פתרון מטריצה מדולל.
  3. מודדת ממברנה במרתף לוחות מצופה מטריקס בטמפרטורת החדר (RT) עבור לפחות 3 h או ב 4 ° c בלילה.
    הערה: ניתן לאחסן צלחות עם מטריצת ממברנה במרתף ב -4 ° c במשך שבוע לפני הסרת פתרון המטריצה ולוחיות השימוש.

2. הסתגלות מסוג המושבה hESCs לתרבות היחידה

  1. כדי לעבור את התרבויות ללא מאכיל של המושבה סוג H9 (WA09) hESCs גדל על מטריקס קרום המרתף, ומכה את המדיום מן הבארות (איור 1א)9.
  2. שטוף 1x עם 1 mL של DPBS. הוסף 1 מ ל של הפתרון dispase (1 U/mL) לטוב ו-דגירה ב 37 ° c עבור 20 דקות.
  3. הסר את dispase, לשטוף את התאים 1x בעדינות עם 2 מ ל של Dמאמ/F12, להסיר את המדיום, ולהוסיף 2 מ ל של DMEM/F12 לכל צלחת.
  4. לנתק בעדינות מושבות על ידי ליטוף בעדינות למעלה ולמטה ולהעביר לצינור 15 מ ל.
  5. צנטריפוגה את כדורי עבור 2 דקות ב 370 x g ומכה את המדיום.
  6. כדי לנתק את כדורי התא לתוך תאים בודדים, להוסיף 2 מ"ל של פתרון התנתקות התא (ריכוז 1x, ראה טבלת חומרים) ו-דגירה ב 37 ° c עבור 10 דקות.
  7. תאים צנטריפוגה עבור 2 דקות ב 370 x g ולהסיר את פתרון הניתוק.
  8. הוסף טרי mTeSR1 האדם בינונית ESC לנתק את התאים לתוך תאים בודדים על ידי בעדינות ללטף למעלה ולמטה.
  9. כדי להתאים את סוג המושבה hESCs לתרבות סוג תא יחיד, צלחת בקירוב 1.5 – 2.0 x 106 hESCs לתוך כל טוב של המרתף קרום מטריקס מצופה 6 צלחת היטב 2 מ ל של mTeSR1 המכיל 10 ΜM סלע מעכבי עבור 24 h (איור 1א).
  10. לאחר 24 שעות, להחליף את המדיום hESC עם mTeSR1 טריים ללא מעכב רוק ולאפשר hESCs לגדול כמו תא בודד סוג עבור 3 ימים. שנה את המדיום מדי יום.
  11. ביום 4, כאשר תרבויות להגיע כמעט 100% השטף, הנתק תאים בפתרון ניתוק, לאחר מכן replate כפי שמתואר בשלב 2.6.
    הערה: מעכב הסלע משפר את ההישרדות של התאים במהלך הראשוני 24 h של מסוג תא יחיד התרבות hESC.

3. Embryoid גוף היווצרות והבידול לתוך שלוש שכבות הנבט (איור 2)

  1. כדי ליצור בס, השעיית מחדש התאים הראשון 3 מ ל של mTeSR1 בינוני עם 10 μM סלע מעכב במהלך הראשון 24 h, ולאחר מכן הדגירה לילה לתוך 60 mm מצורף נמוך מנות בחממה 37 ° c כדי לאפשר צבירה.
  2. לאחר 24 שעות, ה-בס הקטן מועבר לשפופרת של 15 מ ל. תנו לג להתיישב בתחתית הצינור ולהסיר בעדינות את המדיום עם הפיפטה. העברת בס לתוך EB בינונית (בנוקאאוט-Dמאמ) בתוספת של 20% החלפת סרום, תוספת גלוטמין 1x [ראה טבלת חומרים], 1% neaa [חומצות אמינו לא חיוניות; ראה לוח חומרים], ו 0.2% β-mercaptoethanol) ולאפשר להם להרחיב מנות מצורף נמוך במשך 7 ימים. ניתן לשנות את המדיום בכל יום אחר כמתואר לעיל (איור 2א).
  3. ביום השביעי, אספו את הבס מהמנות והעבירו אותם לשפופרת של 15 מ ל. להסיר בעדינות את המדיום עם הפיפטה ולהעביר את בס כדי קרום מרתף ממברנה מצופה מטריקס 6 צלחת.
  4. לאפשר בס לצרף את הצלחת ו הדגירה של 12 ימים ב EB בינונית, במהלכו הם להבדיל לתוך שלוש שכבות הנבט (איור 2B). . לשנות את המדיום כל יום
    הערה: במהלך צבירת תאים, מנת הקובץ המצורף הנמוכה מסייעת להימנע מקובץ מצורף של EB.

4. הבידול של תא בודד סוג hESCs לתוך NPCs (איור 3)

  1. כדי לגרום NPC בידול, לנתק את סוג תא יחיד hESCs עם 1 מ ל של התנתקות פתרון (1x) ו הדגירה עבור 10 דקות ב 37 ° c.
  2. צנטריפוגה את התאים עבור 2 דקות ב 370 x g ולהסיר את פתרון הניתוק על-ידי. להוסיף 1 מ ל של Dמאמ/F12 ולהשעות את התאים מחדש על ידי ליטוף עדין.
  3. תאים לוחית על קרום המרתף מצופה מטריצה 6 צלחת הבאר בצפיפות של 2 x 105 תאים/גם ב 2 מ ל של mTeSR1 המכיל 10 ΜM סלע מעכב.
  4. לאחר 24 שעות, להחליף את מדיום התרבות עם בינונית אינדוקציה עצבית (DMEM עם 1% B27 מינוס ויטמין A) שיושלם עם 1 μM dorsomיתום ו 5 μM SB431542.
  5. שנה את המדיום כל יום אחר במהלך ארבעת הימים הראשונים של האינדוקציה העצבית, כל יום עד שהגיע המפגש ביום 7 (איור 3ב).
    הערה: (1) דורסומפין מעכב את מסלול BMP על ידי התמקדות ALK2, 3, 6 קולטנים וגם מעכב AMPK; SB431542 הוא מעכב של מסלול TGFβ/פעילות באמצעות מיקוד ALK5, 7. (2) אותו פרוטוקול נבדק עם קו אחר של ESC (WA01), אשר הניב תוצאות דומות כ-WA0916. (3) השתמשנו בדרך כלל במטריקס עבור מטריצת הממברנה של המרתף; עם זאת, תאים יכולים להיות מתורבתים על Geltrex ולאחר מכן מובחנת לתוך NPCs עם תוצאות דומות מאוד כפי שצוין על ידי ביטוי של מספר סמנים NPC (איור 4ד, E). לטפל Geltrex באותו אופן כמו מטריצות (ראה סעיף 1).

5. NPC התפשטות הקריוגנית

  1. לאחר 7 ימים של אינדוקציה עצבית, הנתק תאים עם 1 מ ל של ניתוק פתרון (1x) ו הדגירה עבור 10 דקות ב 37 ° c.
  2. צנטריפוגה את התאים עבור 2 דקות ב 370 x g ולהסיר את פתרון הניתוק על-ידי. הוסף 1 mL של הרחבה NPC בינונית (ראה טבלת חומרים) ולהשעות את התאים מחדש על ידי ליטוף עדין.
  3. צלחת 1 x 105 תאים 2 מ ל של NPC הרחבה בינונית על קרום המרתף מטריצה מצופה 6 צלחות היטב.
  4. מעבר NPCs מספר פעמים, לפי הצורך, כאשר תרבויות להגיע כמעט 90% השטף. במהלך הראשון 3 – 4 מעברים, להוסיף 10 מעכבי סלע μM במהלך הראשון 24 h כדי למנוע מוות תאים. לאחר מעברים אלה, תאים יכול להיות מיושן ותרבותי ללא מעכב רוק. שנה את המדיום כל יום אחר במהלך ההתרחבות.
  5. Cryopreserve NPCs כאשר תרבויות להגיע שליטה.
    1. עבור הקריוגנית, תאים השעיית 1 מ ל של פתרון ניתוק (1x) עבור 5 דקות ב 37 ° צ', אז השעיית צנטריפוגה עבור 2 דקות ב 370 x g כדי להסיר את פתרון הניתוק.
    2. הוסף פתרון הקפאת תא (ראה טבלת חומרים) כדי לנתק npcs ב-1 x 106 תאים/mL ולפזר 1 mL השורק לקריובקבוקונים.
    3. הניחו את מיכלי ההקפאה במיכל ההקפאה ואחסנו אותם למשך הלילה במקפיא של 80 ° c.
  6. אחסן את הקריובקבוקונים. בחנקן הנוזלי

6. הכנת כיריים (אש ף) וצלחות מצופות למינציה

  1. כדי להכין את אש ף/למינציה בצלחות מצופות, לדלל את הפתרון של מניות אש ף לתוך ה-PBS או מים לריכוז הסופי של 10 μg/mL. מערבבים היטב ומעילים כל טוב של צלחת 6 טוב עם 1 מ ל של תמיסת אש ף מדולל.
  2. מודלון לפחות 2 h ב 37 ° צ' או לילה ב 4 ° c.
  3. . תשטוף כל טוב עם הערוץ
  4. לדלל את התמיסה מניות ב-PBS קר או מים ב 10 μg/mL. מערבבים היטב את התמיסה למינציה. הסר את ה-PBS ואת המעיל מיד כל הטוב עם 1 מ ל של התמיסה למינציה. שמרו על הצלחות ב -4 ° c והשתמשו בתוך שבוע אחד. לשטוף עם PBS ומיד להוסיף מדיום התרבות.
    הערה: אל תתנו ללוחות אש ף מצופים להתייבש.

7. בידול של hESC-נגזר NPCs לתוך הנוירונים הדוגיים (איור 6א)

  1. לוחית NPCs במנות אש ף/מצופה למינציה במדיום הרחבה NPC בצפיפות של כ 50%.
  2. לאחר 24 שעות, לשנות את המדיום ל DA1 בינונית (מדיום נוירובסיס המכיל 2 מילימטר גלוטמין תוסף, 1x NEAA, 1x B27, 200 ng/mL ששש, ו 100 ng/mL FGF8) ולשנות את המדיום בכל יום אחר.
  3. תרבויות המעבר כשהן מגיעות לשטף. הנתק תאים עם 1 מ ל של התנתקות פתרון (1x) ו הדגירה עבור 10 דקות ב 37 ° c.
  4. צנטריפוגה את התאים עבור 2 דקות ב 370 x g ולהסיר את פתרון הניתוק על-ידי. הוסף 1 mL של DA1 בינונית והשהה מחדש את התאים על ידי ליטוף עדין.
  5. צלחת 1 x 105 תאים 2 מ ל של DA1 בינוני על אש ף/למינציה מצופה 6 צלחות היטב.
  6. לאחר 10 ימים, לשנות DA2 בינונית (נוירוסיס בינונית המכילה 2 מילימטר גלוטמין תוסף, 1x NEAA, 1x B27, 200 μM חומצה אסקורבית, 20 ng/mL BDNF, ו 20 ng/mL GNDF) ולשנות את המדיום כל יום אחר 20 ימים נוספים (איור 6א).
    הערה: הוסף חומצה אסקורבית טרייה מדי יום למדיום DA2. בתוך 14 הימים הראשונים, התאים הבדיל יש להעביר כאשר הם מגיעים 90% השטף, אבל לא יותר לאחר מכן.

8. הבידול של NPCs שנגזרו ESC לתוך האסטרוציטים

  1. תאים בעלי מבנה עצבי לוחית על אש ף/למינציה מצופה בינונית הרחבה של NPC בצפיפות של כ 50%.
  2. לאחר 24 שעות, לשנות את המדיום כדי אסטרוציט בינונית (dmem דיום/F12 בינונית כולל 1:100 N2, 1:100 B27, 200 ng/ml IGF, 10 ng/ml הפעילות A, 10 ng/ml כיום β-1, ו 8 ng/ml bfgf) ולשנות את המדיום כל יומיים.
  3. תרבויות המעבר כשהן מגיעות לשטף. הנתק תאים עם 1 מ ל של התנתקות פתרון (1x) ו הדגירה עבור 10 דקות ב 37 ° c.
  4. צנטריפוגה את התאים עבור 2 דקות ב 370 x g ולהסיר את פתרון הניתוק על-ידי. הוסף 1 מ ל של המדיום אסטרוציט והשהה מחדש את התאים על ידי הפיג עדין.
  5. צלחת 1 x 105 תאים 2 מ ל של מדיום אסטרוציט על אש ף/מצופה למינציה 6 מנות היטב.
  6. אפשר לבידול להמשיך בסך של 5 – 6 שבועות (איור 6ב).

9. כתמים אימונולואורוסנס

  1. תאי תרבות ב35 מ"מ מנות שתוארו לעיל עבור כל סוג תא. מתיף את המדיום ולהוסיף 1 מ ל של 4% בתחתית הפתרון לכל מנה ו דגירה עבור 20 דקות ב RT.
  2. לשטוף 2x עבור 5 דקות עם PBS.
    הערה: לאחר תיקון התאים, ניתן לאטום את לוחות התיקון באמצעות parafilm ולאחסנו ב-4 ° c. כתם עם נוגדן בתוך 1 שבוע לאחר קיבעון.
  3. הוסף 300 μL של פתרון חסימה (סרום עז או חמור ב-PBS) לכל מנה ו-דגירה ב-RT עבור 30 – 60 דקות.
  4. לשטוף את הצלחת 2x עם PBS עבור 5 דקות.
  5. הוסף 300 μL של הנוגדן העיקרי (טבלה 1) פתרון (מדולל בפתרון חסימה) ו-דגירה ב RT עבור 1.5 h או לילה ב 4 ° c.
  6. שטוף 2x עם PBS במשך 10 דקות.
  7. הוסף 300 μL של הנוגדן משני מצותת פלורסנט (שולחן 1) בפתרון חסימה ו דגירה בחושך במשך 1 h ב RT.
  8. לשטוף את התאים 2x עבור 10 דקות עם PBS.
  9. הוסף הואכסט פתרון מכתים (1 μM ריכוז סופי ב-PBS) כדי להכתים גרעינים. דגירה את התאים בחושך עבור 5 דקות ב RT.
  10. לשטוף את התאים 1x עם PBS עבור 5 דקות ולאחר מכן להוסיף 500 μL של PBS. לשמור על כלים בחושך, ולאחר מכן להתבונן הזריחה עם מיקרוסקופ קונפוקלית וקד (איור 2b, איור 5ג, איור 6a, ואיור 7ב).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

מוצג כאן הוא פרוטוקול משופר עבור תחזוקה והתרחבות של תרבות אחת סוג תא של hESCs והבידול יעיל שלהם לתוך תאים מחולל קדמון, אשר מבדיל לאחר מכן לתוך שונים במורד הזרם העצבי, כולל נוירונים.

תמונות חדות שלב מייצגים מציגות מורפולוגיה של תאים בשלבים שונים במהלך ההסתגלות של סוג המושבה hESCs לתרבות סוג תא יחיד (איור 1א). באמצעות תנאי התרבות של התא היחיד, התגלה כי hESCs המותאם הצליחו להישמר בצפיפות גבוהה, ולאחר מכן בקלות וביעילות משנה כאשר הגיע שליטה (איור 1א, ב). תאים אלה שמרו על מאפייני מחזור התא (כלומר, שלב קצר G1 ושיעור גבוה של תאים בשלב S) אופייני מסוג המושבה hESCs (איור 1ג, ד). הם גם הביעו את סמני ESC (כלומר, OCT4, TRA 1-81, SOX2 ו-NANOG) ברמות הדומות לאלה של סוג המושבה hESCs כפי שמצוין על ידי רביעיית ה-PCR וניתוח חיסוני (איור 7, טבלה 2). יתר על כן, הוכח כי תא בודד hESCs היו מסוגלים ליצור embryoid גופים המכילים תאים מכל שלוש שכבות הנבט: אנדועור (ביטוי SOX17), מזועור (ביטוי SMA) ו אאקטודרם (ביטוי tuj-1) (איור 2).

הבא, זה הוכיח כי תא בודד סוג hESCs הבדיל ביעילות לתוך תאים מחולל קדמון באמצעות פרוטוקול NPC (איור 3A), כפי שצוין על ידי אובדן של מורפולוגיה hesc אופייני המראה של NPC מורפולוגיה (איור 3ב)16. בידול NPC נתמך על ידי ביטוי מוגבר של החתימה NPC סמנים (כלומר, SOX1, OTX2, ZIC1, ו OTX1; איור 5א, שולחן 2) ואושר על ידי ניתוח חיסוני ו facs. אותו ניתוח הראה גם כי יותר מ 90% התאים מוכתם חיובי עבור SOX1, PAX6, ו NCAM חלבון (איור 5B, C). כדי לבחון את היכולת של תא יחיד hESC-נגזרות NPCs להבדיל לתוך שונים במורד הזרם העצבי, הבידול של תאים אלה לתוך נוירונים הדוגיים ואסטרוציטים שנבדקו. כפי שמוצג באיור 6A, B, בודד תא Hesc-נגזר npcs היו מסוגלים להבדיל לתוך נוירונים ומורפולוגיות ו astrocytes, כפי שמצוין על ידי המראה של מורלוגיות אופייני וביטוי של שושלת היוחסין-סמנים ייחודיים דואמיניגיים (כלומר, TH; איור 6א) וסמנים אסטרוציט (כלומר, gfap ו-S100B; איור 6ב).

Figure 1
איור 1: הסתגלות מסוג המושבה hESCs לתרבות סוג תא בודד. (א) מייצג תמונות בניגוד לשלב של תרבויות תא בודד של H9 hESCs בזמנים שונים לאחר ציפוי על 2% קרום המרתף ממברנות מצופה מנות. הגדלה נמוכה (שמאלית) וגבוהה (ימין). הפאנל העליון: דמות מייצגת של המושבה סוג hESCs. חלוניות אחרות מציגות תמונות מייצגות של תרבויות בזמנים שונים במהלך ההסתגלות לסוג תא בודד hESCs. סרגל קנה מידה = 200 μm. (ב) עקומות הצמיחה של H9 hESCs היו מנוטרים ב 2% ממברנה קרום המרתף לוחות מצופים עם 10 ΜM סלע מעכב עבור הראשון 24 שעות במהלך מצב התרבות תא יחיד. (ג, ד) ניתוח מחזור התא של סוג המושבה (C) וסוג תא בודד (D) H9 hESCs על ידי הזרמת cy try. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 2
איור 2: בבידול חוץ גופית של התאמה תא יחיד סוג hESCs לתוך שלוש שכבות הנבט. (א) דמות מייצגת תמונות של גופים עובריים (EB) נגזר מסוג תא יחיד של hESCs. סרגל קנה מידה = 100 μm. (ב) מובחנים הhESCs מנותח לביטוי של שלושת סמני שכבת הנבט השונים: SOX17 (בעלי עור), SMA (מזועור), ו-tuj-1 (אקטועור). גרעינים היו מוכתמים DAPI. סרגל קנה מידה = 50 μm. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 3
איור 3: הבידול של תא בודד סוג hESCs לתוך תאים מחולל קדמון על ידי בידול ישיר. (א) סכימטי של פרוטוקול הבידול של hESCs לתוך תאים מחולל קדמון (npcs). hESCs טופלו על ידי דורסומיתום (DMH) ו SB431542 (SB) 1 יום לאחר ציפוי. (ב) תמונת הניגוד של שלב הייצוג של מורפולוגיה של התא במהלך בידול עצבי. סרגל קנה מידה = 200 μm. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 4
איור 4: תרבות hESC על מוצרים שונים מטריצות קרום ממברנה. (א) hESCs תרבותי על מטריצות או Geltrex הציגו יכולת לגדול ולהבדיל לתוך npcs שהיה דומה לתרבות התא היחיד. תאים היו מוכתמים בנוגדן NESTIN. גרעינים היו מוכתמים DAPI. סרגל קנה מידה = 50 μm. (ב) hESCs תרבותי על מטריצות או Geltrex הראה פוטנציאל דומה כדי להבדיל npcs כפי שצוין על ידי אחוז התאים nestin-ו-PAX6-חיוביים. תאים נותחו על ידי הזרמת cy, ביום 7 של NPC בידול. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 5
איור 5: ביטוי של סמנים NPC. (א) לאחר 7 ימים של בידול עצבי, ביטוי של הגנים הסמן NPC (כלומר, OTX1, OTX2, SOX1, ו ZIC1) נותח על ידי רביעיית-PCR. הערכים הנורמו לבין הערך המחושב והמחושבים ביחס לערכים של hESCs (p < 0.05). (ב) אחוז SOX1-, nestin-, SOX2-, ו ncam-חיוביים התאים נקבע על ידי הזרמת cy try ביום 7 של NPC בידול. (ג) ביום 7 NPC בידול, תאים היו מוכתמים בנוגדנים נגד סמנים עצביים SOX1, NESTIN, NCAM, OTX2, ו PAX6. גרעינים היו מוכתמים DAPI. סרגל קנה מידה = 100 μm. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 6
איור 6: תא העצב הדוגיים והבידול אסטרוציט של npcs נגזר מסוג תא יחיד hESCs. (א) הדמות הייצוגית הניגודיות של הנוירונים הדוגיים (הפאנלהעליון). סרגל קנה מידה = 100 μm. תאים הבדיל היו מוכתמים בנוגדנים נגד תא העצב הדואמנרגיים ה (טירולי הידרוקסילאז) כפי שמצוין. גרעינים היו מוכתמים DAPI. סרגל קנה מידה = 50 μm. (ב) תמונת הניגודיות של שלב המייצג של האסטרוציטים (הפאנל העליון). סרגל קנה מידה = 100 μm. תאים הבדיל היו מוכתם בנוגדנים נגד הסמן האסטרוציט GFAP (בחלבון חומצי glibrillary) ו-S100-B (S100 חלבון מחייב סידן B), כפי שמצוין. גרעינים היו מוכתמים DAPI. סרגל קנה מידה = 50 μm. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 7
איור 7: אפיון תא בודד סוג hESCs. (א) hESCs המותאם לתרבות סוג תא יחיד נותחו עבור הביטוי של סמני ESC (כלומר, OCT4, ננוg ו-SOX2) מאת רביעיית-PCR. הערכים הנורמו ל-שדרוג (p < 0.05). (ב) מhESCs ויטראז ביטוי לביטוי של סמני העוצמה OCT4, TRA-1-81 ו-ssea-1. גרעינים היו מוכתמים DAPI. סרגל קנה מידה = 50 μm. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

נוגדנים ראשוניים ינים דילול מספר קטלוגי חברה
OCT4 עכבר 1:1000 sc-5279 סנטה קרוז
טרה 1-81 עכבר 1:500 sc-21706 סנטה קרוז
SSEA-1 עכבר 1:500 sc-21702 סנטה קרוז
SOX1 עז 1:500 AF-3369 ר & ד
SOX2 ארנב 1:1000 sc-20088 סנטה קרוז
SMA ארנב 1:500 ab-5694 מיכל שהרבני
Tuj1 עכבר 1:1000 T8578 סיגמא
מיכל בנסטין עכבר 1:1000 ab-22035 מיכל שהרבני
OTX2 עכבר 1:250 ab-21990 מיכל שהרבני
מיכל שלמה עכבר 1:200 sc-106 סנטה קרוז
hPAX6 עכבר 1:250 561664 BD
תאנון עכבר 1:500 T1299 סיגמא
S100b עכבר 1:250 ab4066 מיכל שהרבני
מיכל הגופי ארנב 1:1000 ab7260 מיכל שהרבני
נוגדנים משניים
אנטי-עכבר עז 1:1000 AF 488 או 647 טכנולוגיות חיים
אנטי ארנב עז 1:1000 AF 488 או 647 טכנולוגיות חיים

שולחן 1: נוגדנים המשמשים בניתוח כימיה חיסונית ו-FACS.

שם תחל תחל
OCT4 משחק החלקה
R: מדריך כיצד לעשות
ננו-ג'י שאלה: המנון בלבד
מלון: לתקוף
SOX1 F: CCTTAGGTTTCCCCTCGCTTT
R: מדריך מחקר
OTX1 F: AAGATCTT
מדריך כמוסות מרקט
OTX2 F: TGGAAGCACTGכמוסות CCAAG
ר: TAAACCATACCTGCACCCTCG
ZIC1 F: AACCCCAAAAAGTCGTGCAAC
ר: TCCTCCCAGAAGCAGATGTGA
למעלה מדריך כלשהו
מדריך כיצד לשחק

שולחן 2: השימוש בתחל בניתוח-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

שיטות מדרגי ויעיל עבור הבידול של hESCs לתוך ליננים שונים והדור של מספר מספיק של תאים הבדיל הם קריטריונים חשובים לסינון סמים וטיפול בתאי גזע. שונים של תא יחיד שיטות העברת פורסמו, שבו התאים הם מתורבתים בנוכחות של מעכב סלע או מולקולות קטנות אחרות כדי לשפר את ההישרדות, אבל המוצרים הסופיים של שיטות אלה התרבות הם סוג המושבה hESCs17,18,19,20,21. פרוטוקול תא בודד לESC, אשר מבוסס באופן חלקי על שיטות שפורסמו בעבר19,20,21,22, בהצלחה מייצר ושומר על מסוג תא בודד של התרבות hesc ומונע מסוג המושבה האמנות hesc. הוא כולל בצפיפות גבוהה הציפוי תא יחיד, האגודה הרב-תאיים, צמיחה מונאולייר, ותת-תרבות יעילה (איור 1). האחרון הושג על ידי תוספת של סלע מעכבי במהלך הראשוני 24 h של התרבות סוג תא יחיד של hESCs, אשר משפר את הישרדות התאים17,18,19,20,21. פרוטוקול זה מדרגי יותר בקלות ומאפשר הרחבה של תאים אלה עבור יישומים טיפוליים בהקרנה ובתאי גזע.

זה עוד הוכיח כי תא בודד סוג hESCs יכול ביעילות להבדיל השושלת NPC (איור 3) ללא שימוש בשלב ביניים, כגון EB ו-היווצרות רוזט23,24,25. המרה עצבית גבוהה מסוג תא בודד hESCs הושגה באמצעות עיכוב של BMP/TGFβ/פעילות משעולים איתות על ידי טיפול במעכבי המעכבי, dorsomיתום, ו SB43154215,16,26. עם פרוטוקול זה, התאים בודד סוג תא hESCs יכול להבדיל ביעילות npcs ללא צורך EB ו היווצרות שושנת העין (איור 5) ו או להיות המושרה להבדיל לתוך נוירונים הדוגיים ו אסטרוציטים (איור 6).

לסיכום, תרבות סוג תא יחיד של hESCs מספק מערכת מהירה ויעילה כדי ללמוד את המנגנונים המולקולריים המסדירים בידול מרובה צעדים לתוך שונות ליננים. באופן ספציפי, פרוטוקול זה מנוצל NPCs ותיאר הבידול הבאים שלהם לתוך שונות עצביים נוספים, כגון אסטרוציטים ונוירונים דואמנרגיים. הפרוטוקול מספק פלטפורמה לייצור פשוט, חסון ומדרגי של מחולל קדמון ותאים הבדיל שיכולים להתאים למחקרים בסיסיים, הקרנת סמים ויישומים ברפואת משובי.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים אינם מצהירים על ניגודי אינטרסים.

Acknowledgments

אנו מודים לד ר קארל ד. בורטנר על עזרתו בניתוח ה-FACS. מחקר זה נתמך על ידי תוכנית מחקר הפנים של המכון הלאומי למדעי הסביבה, המוסדות הלאומיים לבריאות, Z01-ES-101585 ל AMJ.

Materials

Name Company Catalog Number Comments
35 mm m-dishes ibidi 81156 Cell culture dish
6-well plates Corning 3516
Accutase Innovative Cell Technologies AT104-500 Cell detachment solution
Activin A R&D system 338-AC-050
Ascorbic Acid Sigma Aldrich A4403
B27 supplement Thermo Fisher 17504044
B27 supplement (-Vit A) Thermo Fisher 12587010
BDNF Applied Biological Materials Z100065
bFGF Peprotech 100-18C
Centrifuge DAMON/ICE 428-6759
CO2 incubator Thermo Fisher 4110
Corning hESC-qulified Matrix (Magrigel) Corning 354277 Basement membrane matrix (used for most of the protocol here)
Cryostor CS 10 Stemcell Technologies 7930 Cell freezing solution
Dispase Stemcell Technologies 7923
DMEM Thermo Fisher 10569-010
DMEM/F12 Thermo Fisher 10565-018
Dorsomorphin Tocris 3093
EGF Peprotech AF-100-16A
Fetal Bovine Serum Fisher Scientific SH3007003HI
FGF8 Applied Biological Materials Z101705
GDNF Applied Biological Materials Z101057
Geltrex matrix Thermo Fisher A1569601 Basement membrane matrix
GlutaMax Thermo Fisher 35050061 Glutamine supplement, 100X
H9 (WA09) human embryonic stem cell line WiCell WA09
Heregulin b-1 Peprotech 100-3
IGF Peprotech 100-11
Knockout DMEM Thermo Fisher 10829018
Knockout Serum Replacement Thermo Fisher 10828028
Laminin Sigma Aldrich L2020
mTeSR1 Stemcell Technologies 85850 hESC culture medium
N2 supplement Thermo Fisher 17502001
NEAA Thermo Fisher 11140050
Neurobasal Thermo Fisher 21103049
Poly-L-ornithine Sigma Aldrich P3655
ROCK inhibitor Tocris 1254
SB431542 Tocris 1614
SHH Applied Biological Materials Z200617
Stemdiff Neural Progenitor medium Stemcell Technologies 5833 NPC expansion medium

DOWNLOAD MATERIALS LIST

References

  1. Thomson, J. A., et al. Embryonic stem cell lines derived from human blastocysts. Science. 282, (5391), 1145-1147 (1998).
  2. Rosler, E. S., et al. Long-term culture of human embryonic stem cells in feeder-free conditions. Developmental Dynamics. 229, (2), 259-274 (2004).
  3. Mallon, B. S., Park, K. Y., Chen, K. G., Hamilton, R. S., McKay, R. D. Toward xeno-free culture of human embryonic stem cells. The International Journal of Biochemistry & Cell Biology. 38, (7), 1063-1075 (2006).
  4. Hoffman, L. M., Carpenter, M. K. Characterization and culture of human embryonic stem cells. Nature Biotechnology. 23, (6), 699-708 (2005).
  5. Yan, Y., et al. Efficient and rapid derivation of primitive neural stem cells and generation of brain subtype neurons from human pluripotent stem cells. Stem Cells Translational Medicine. 2, (11), 862-870 (2013).
  6. Goncalves, J. T., Schafer, S. T., Gage, F. H. Adult Neurogenesis in the Hippocampus: From Stem Cells to Behavior. Cell. 167, (4), 897-914 (2016).
  7. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nature Biotechnology. 25, (6), 681-686 (2007).
  8. International Stem Cell Initiative. Characterization of human embryonic stem cell lines by the International Stem Cell Initiative. Nature Biotechnology. 25, (7), 803-816 (2007).
  9. Hartung, O., Huo, H., Daley, G. Q., Schlaeger, T. M. Clump passaging and expansion of human embryonic and induced pluripotent stem cells on mouse embryonic fibroblast feeder cells. Current Protocols in Stem Cell Biology. 14, (1), Chapter 1 Unit 1C 10 (2010).
  10. Chen, K. G., et al. Non-colony type monolayer culture of human embryonic stem cells. Stem Cell Research. 9, (3), 237-248 (2012).
  11. Chen, G., Hou, Z., Gulbranson, D. R., Thomson, J. A. Actin-myosin contractility is responsible for the reduced viability of dissociated human embryonic stem cells. Cell Stem Cell. 7, (2), 240-248 (2010).
  12. Li, X., Krawetz, R., Liu, S., Meng, G., Rancourt, D. E. ROCK inhibitor improves survival of cryopreserved serum/feeder-free single human embryonic stem cells. Human Reproduction. 24, (3), 580-589 (2009).
  13. Ohgushi, M., et al. Molecular pathway and cell state responsible for dissociation-induced apoptosis in human pluripotent stem cells. Cell Stem Cell. 7, (2), 225-239 (2010).
  14. Pakzad, M., et al. Presence of a ROCK inhibitor in extracellular matrix supports more undifferentiated growth of feeder-free human embryonic and induced pluripotent stem cells upon passaging. Stem Cell Reviews and Reports. 6, (1), 96-107 (2010).
  15. Chambers, S. M., et al. Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling. Nature Biotechnology. 27, (3), 275-280 (2009).
  16. Jeon, K., et al. GLIS3 Transcriptionally Activates WNT Genes to Promote Differentiation of Human Embryonic Stem Cells into Posterior Neural Progenitors. Stem Cells. 37, (2), 202-215 (2019).
  17. Emre, N., et al. The ROCK inhibitor Y-27632 improves recovery of human embryonic stem cells after fluorescence-activated cell sorting with multiple cell surface markers. PLoS ONE. 5, (8), e12148 (2010).
  18. Hanna, J., et al. Human embryonic stem cells with biological and epigenetic characteristics similar to those of mouse ESCs. Proceedings of the National Academy of Sciences of the United States of America. 107, (20), 9222-9227 (2010).
  19. Saha, K., et al. Surface-engineered substrates for improved human pluripotent stem cell culture under fully defined conditions. Proceedings of the National Academy of Sciences of the United States of America. 108, (46), 18714-18719 (2011).
  20. Tsutsui, H., et al. An optimized small molecule inhibitor cocktail supports long-term maintenance of human embryonic stem cells. Nature Communications. 2, 167 (2011).
  21. Xu, Y., et al. Revealing a core signaling regulatory mechanism for pluripotent stem cell survival and self-renewal by small molecules. Proceedings of the National Academy of Sciences of the United States of America. 107, (18), 8129-8134 (2010).
  22. Ungrin, M. D., Joshi, C., Nica, A., Bauwens, C., Zandstra, P. W. Reproducible, ultra high-throughput formation of multicellular organization from single cell suspension-derived human embryonic stem cell aggregates. PLoS ONE. 3, (2), e1565 (2008).
  23. Kim, D. S., et al. Highly pure and expandable PSA-NCAM-positive neural precursors from human ESC and iPSC-derived neural rosettes. PLoS ONE. 7, (7), e39715 (2012).
  24. Sun, Y., Hu, J., Zhou, L., Pollard, S. M., Smith, A. Interplay between FGF2 and BMP controls the self-renewal, dormancy and differentiation of rat neural stem cells. Journal of Cell Science. 124, (Pt 11), 1867-1877 (2011).
  25. Zhou, J. M., Chu, J. X., Chen, X. J. An improved protocol that induces human embryonic stem cells to differentiate into neural cells in vitro. Cell Biology International. 32, (1), 80-85 (2008).
  26. Smith, J. R., et al. Inhibition of Activin/Nodal signaling promotes specification of human embryonic stem cells into neuroectoderm. Developmental Biology. 313, (1), 107-117 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics