인간 배아 줄기 세포의 단세포 배양을 이용한 효율적인 신경 분화

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

여기서 제시된 것은 인간 배아 줄기 세포의 단일 세포 배양및 이들의 후속 분화를 신경 전구 세포로 의하기 위한 프로토콜이다. 이 프로토콜은 간단하고 견고하며 확장 가능하며 약물 스크리닝 및 재생 의학 응용 분야에 적합합니다.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Jeon, K., Park, K., Jetten, A. M. Efficient Neural Differentiation using Single-Cell Culture of Human Embryonic Stem Cells. J. Vis. Exp. (155), e60571, doi:10.3791/60571 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

인간 배아 줄기 세포 (hESCs)의 시험관 내 분화는 생물학적 및 분자 수준 모두에서 인간의 발달을 연구하는 능력을 변형시키고 재생 응용 프로그램에 사용하기 위해 세포를 제공했습니다. 콜로니 형 배양을 이용한 hESC 배양에 대한 표준 접근법은 미분화 hESCs 및 배아 체(EB) 및 상이한 세균 층으로의 분화를 위한 로제트 형성을 유지하기 위해 비효율적이고 시간이 많이 소요된다. 여기서 제시된 것은 콜로니형 배양 대신 hESC를 이용한 단일 세포 배양 방법이다. 이 방법을 사용하면 콜로니 형 hESCs에 필적하는 수준에서 hESC 마커의 발현을 포함하여 미분화 hESCs의 특성 특징을 유지 보수 할 수 있습니다. 또한, 이 프로토콜은 1주일 이내에 NPC를 생산하는 단일 세포 형 hCS로부터 신경 전구 세포(NPC) 생성을 위한 효율적인 방법을 제시한다. 이 세포는 몇몇 NPC 마커 유전자를 높게 표현하고 도파민성 신경세포 및 성상세포를 포함하여 각종 신경 세포 모형으로 분화할 수 있습니다. hESCs를 위한 이 단세포 배양 시스템은 이 프로세스의 분자 기계장치, 특정 질병의 연구 및 약 발견 스크린을 조사하는 데 유용할 것입니다.

Introduction

인간 배아 줄기 세포 (hESCs)는 3 개의 1 차적인 세균 층으로 분화하는 잠재력을 가지고, 그 때 각종 다능성 전구 세포 계보로 분화합니다. 이 혈통은 이후에 인체에 있는 모든 세포 모형을 초래합니다. 시험관 내 hESC 배양 시스템은 인간 배아 발달을 연구하는 능력을 변화시켰으며 이러한 과정이 생물학적 및 분자 수준에서 어떻게 조절되는지에 대한 새로운 통찰력을 얻기위한 귀중한 도구로 사용되었습니다. 유사하게, 인간 환자에서 분리된 체세포 를 재프로그래밍해서 생성된 유도된 만능 줄기 세포 (iPSCs)의 연구 결과는 각종 질병에 새로운 통찰력을 제공합니다. 또한, hESCs로부터 유래된 전구 및 분화 세포는 줄기세포 치료 및 약물스크리닝1,2,3,4와관련된 연구에 유용할 수 있다.

hESCs는 광범위한 자기 갱신 능력을 가진 다중 전위 세포인 신경 전구 세포 (NPC)로 분화하도록 유도될 수 있습니다. 이어서, 이들 세포는 뉴런, 성상세포 및 올리고엔드로시트5,6으로분화될 수 있다. NPC는 또한 신경 발달 생물학 및 각종 신경 질병의 시험관 내 연구를 위한 세포 시스템을 제안합니다. 그러나, 현재 의 식민지 형 배양 방법은 HCS와 NPC로의 분화를 수반하며 종종 배아체(EB) 및 로제트 형성5,7,8,9뿐만아니라 공동배양을 수반한다. 이 프로토콜은 더 낮은 생존율 및 자발적인 분화를 전시하고 더 많은 시간 소모적입니다.

여기서 제시된 개선되고 견고한 배양 시스템은 쉽게 확장 가능하고 hESCs10의고밀도 단세포 형 배양을 사용한다. 로키나아제(ROCK) 억제제의 포함은hESC10,11,12,13,14의단일 세포 형 배양 동안 생존 효율을 현저히 향상시킨에 기여했다. 이러한 문화 시스템에서 는 hESCs를 쉽게 유지 관리하고 확장할 수 있습니다. 또한, 이 프로토콜은 고도로 순수한 NPC의 생산을 허용하는 hESCs의 단일 세포 형 배양으로부터 NPC를 생성하는 효율적인 방법을 제시합니다.

요약하자면, hESCs를 이용한 단세포 형 배양 프로토콜은 NPC를 포함한 다양한 계보로 이들 세포의 분화를 연구하는 매력적인 모델을 제공한다. 이 프로토콜은 쉽게 확장 가능하기 때문에 재생 요법 및 약물 스크리닝과 관련된 연구를 위한 세포 생성에 적합합니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. hESC 자격을 갖춘 지하 멤브레인 매트릭스 코팅 플레이트 준비

  1. hESC 자격을 갖춘 지하 멤브레인 매트릭스(재료 표참조)를 적어도 2-3시간 동안 4°C에서 천천히 해동하여 겔형성을 피합니다.
  2. 지하 멤브레인 매트릭스 코팅 플레이트를 준비하려면 차가운 DMEM/F12에서 매트릭스를 2% 최종 농도로 희석하십시오. 잘 혼합하고 희석 매트릭스 용액의 1 mL와 6 웰 플레이트의 각 우물을 코팅합니다.
  3. 지하 멤브레인 매트릭스 코팅 플레이트를 실온(RT)에서 적어도 3시간 또는 4°C에서 밤새 배양한다.
    참고: 지하 멤브레인 매트릭스가 있는 플레이트는 매트릭스 용액을 제거하고 플레이트를 사용하기 전에 1주일 동안 4°C에서 보관할 수 있습니다.

2. 단세포 hESC 배양에 콜로니 형 hESCs의 적응

  1. 지하 막 매트릭스에서 자란 식민지형 H9(WA09) hESCs의 피더 프리 배양액을 통과하기 위해, 웰로부터 배지를 흡인(도1A)9.
  2. DPBS 1mL로 1x를 씻으소서. 웰당 1 mL의 디스파스 용액 (1 U / mL)을 추가하고 20 분 동안 37 °C에서 배양하십시오.
  3. 디스파스를 제거하고, DMEM/F12 2 mL로 세포를 1x 부드럽게 씻고, 배지를 제거하고, 각 접시에 2 mL의 DMEM/F12를 추가합니다.
  4. 콜로니를 부드럽게 위아래로 피펫팅하여 15mL 튜브로 옮겨가십시오.
  5. 펠릿을 370 x g에서 2분 동안 원심분리하고 배지를 흡인한다.
  6. 세포 펠릿을 단일 세포로 해리하려면 2 mL의 세포 분리 용액 (1x 농도, 재료 표참조)을 추가하고 37 °C에서 10 분 동안 배양하십시오.
  7. 370 x g에서 2 분 동안 원심 분리 세포를 제거하고 분리 용액을 제거하십시오.
  8. 신선한 mTeSR1 인간 ESC 배지를 추가하고 상하로 부드럽게 피펫팅하여 세포를 단일 세포로 해리시면 됩니다.
  9. 단일 세포 형 배양에 콜로니 형 hESCs를 적응시키기 위해, 24 시간 동안 10 μM ROCK 억제제가 함유된 mTeSR1의 2 mTeSR1에서 각 웰-코팅된 6개의 웰 플레이트에 약 1.5-2.0 x 10hESCs를 플레이트(도1A).
  10. 24시간 후, HESC 배지를 ROCK 억제제 없이 신선한 mTeSR1로 교체하고 hESC가 3일 동안 단일 세포 유형으로 성장하도록 한다. 매일 매체를 변경합니다.
  11. 4일째에, 배양이 거의 100% 수렴에 도달할 때, 분리 용액에서 세포를 해리한 다음 단계 2.6에 설명된 대로 재플레이트합니다.
    참고: ROCK 억제제는 단세포 형 hESC 배양의 초기 24시간 동안 세포 생존을 향상시킨다.

3. 배아 체 형성 및 세 가지 세균 층으로 분화(그림 2)

  1. EB를 형성하기 위해, 먼저 처음 24시간 동안 10 μM ROCK 억제제와 함께 mTeSR1 배지의 3 mL에서 세포를 재중단한 다음, 37°C 인큐베이터에서 60 mm 낮은 부착 접시로 밤새 배양하여 응집을 허용한다.
  2. 24 시간 후, 작은 EB는 15 mL 튜브로 전송됩니다. EB가 튜브의 바닥에 정착하자 부드럽게 파이펫으로 매체를 제거합니다. EB 배지로 EB를 옮기십시오 (20% 녹아웃 혈청 대체품, 1x 글루타민 보충제 [재료 표참조], 1% NEAA [비필수 아미노산; 재료 표참조], 0.2% β-메르카페탄올)로 옮기고 7일 동안 낮은 부착 접시에서 확장할 수 있습니다. 상기 배지는 상술한 바와 같이 격일로 변경될 수있다(도 2A).
  3. 7일째에는 요리에서 EB를 모아 15mL 튜브로 옮김을 옮김을 넣습니다. 파이펫으로 배지를 부드럽게 제거하고 EB를 지하 멤브레인 매트릭스 코팅 6 웰 플레이트로 옮김을 옮김.
  4. EB 배지에서 12일 동안 EB를 플레이트에 부착하고 배양하도록 허용하고, 그 동안 3개의 세균 층으로 분화한다(도2B). 격일로 매체를 변경합니다.
    참고: 셀을 집계하는 동안 부착이 낮은 접시는 EB 부착을 방지하는 데 도움이 됩니다.

4. 단세포 형 hESCs를 NPC로 의 분화(그림 3)

  1. NPC 분화를 유도하기 위해, 1 mL의 분리 용액 (1x)으로 단세포 형 hCS를 해리하고 37 °C에서 10 분 동안 배양합니다.
  2. 세포를 370 x g에서 2분 동안 원심분리하고 상상으로 분리하여 제거한다. DMEM/F12 1mL를 추가하고 부드러운 파이펫팅으로 셀을 다시 일시 중단합니다.
  3. 10 μM ROCK 억제제함유 mTeSR1의 2 mL에서 2 x 105 세포의 밀도에서 6 개의 웰 플레이트를 지하 막 매트릭스 코팅하였다.
  4. 24시간 후, 배양 배지를 신경 유도 배지(DMEM와 1% B27 에서 비타민 A를 뺀 것)로 1 μM 도르소모르핀과 5 μM SB431542로 보충하였다.
  5. 신경 유도의 처음 4 일 동안 격일로 배지를 변경한 다음 7 일째에 합류에 도달 할 때까지 매일(그림 3B).
    참고: (1) 도르소모르핀은 ALK2,3,6 수용체를 표적으로 하여 BMP 경로를 억제하고 또한 AMPK를 억제한다; SB431542는 ALK5,7을 표적화함으로써 TGFβ/액티빈 경로의 억제제이다. (2) 동일한 프로토콜을 다른 ESC 라인(WA01)으로 테스트하여 WA0916과유사한 결과를 산출했습니다. (3) 우리는 일반적으로 지하 막 매트릭스에 대한 Matrigel을 사용했다; 그러나, 세포는 겔트렉스에서 배양되고 여러 NPC 마커의 발현에 의해 지시된 바와 같이 매우 유사한 결과를 가진 NPC로 분화될 수있다(도 4D,E). 마트릴과 동일한 방식으로 겔트렉스를 처리합니다(섹션 1 참조).

5. NPC 확장 및 냉동 보존

  1. 신경 유도 7일 후, 1 mL의 분리 용액(1x)으로 세포를 해리시키고 37°C에서 10분 동안 배양합니다.
  2. 세포를 370 x g에서 2분 동안 원심분리하고 상상으로 분리하여 제거한다. NPC 팽창 매체 1mL를 추가하고(재료 표참조) 부드러운 파이펫팅으로 셀을 다시 일시 중단합니다.
  3. 플레이트 1 x 105 세포 의 2 mL의 NPC 팽창 배지에 지하 막 매트릭스 코팅 6 웰 플레이트.
  4. 문화가 거의 90 %의 동률에 도달 할 때 통로 NPC는 필요에 따라 여러 번. 처음 3-4대항 동안, 세포 사멸을 방지하기 위해 초기 24시간 동안 10 μM ROCK 억제제추가. 이러한 대구 후, 세포는 ROCK 억제제 없이 배양및 배양될 수 있다. 확장 기간 동안 격일로 미디어를 변경합니다.
  5. 문화가 합의에 도달할 때 NPC를 냉동 보존합니다.
    1. 동결 보존을 위해, 37°C에서 5분 동안 1 mL의 분리 용액(1x)에서 세포를 해리한 다음, 370 x g에서 2분 동안 원심분리 서스펜션을 제거하여 분리 용액을 제거한다.
    2. 1 x 10 6 셀/mL에서 NPC를 해리하고 1 mL aliquots를 극저온에 분배하기 위해 셀 동결 용액(재료 참조)을 추가합니다.
    3. 냉동 용기에 cryovials를 놓고 -80 °C 냉동실에 밤새 보관하십시오.
  6. 액체 질소에 저온 을 저장합니다.

6. 폴리 L-오르니틴 (PLO) 및 라미닌 코팅 플레이트의 준비

  1. PLO/라미닌 코팅 플레이트를 준비하려면 PLO 스톡 용액을 PBS 또는 물로 10 μg/mL의 최종 농도로 희석합니다. 잘 섞어서 6개의 웰 플레이트를 1 mL의 희석된 PLO 용액으로 코팅합니다.
  2. 37°C에서 2시간 이상 또는 4°C에서 하룻밤 동안 배양한다.
  3. PBS로 잘 씻으시다.
  4. 10 μg /mL에서 차가운 PBS 또는 물에 라미닌 스톡 용액을 희석하십시오. 라미닌 용액을 잘 섞는다. PBS를 제거하고 즉시 라미닌 용액의 1 mL로 각 잘 코팅. 플레이트를 4°C로 유지하고 1주일 이내에 사용하십시오. PBS로 세척하고 즉시 배양 매체를 추가합니다.
    참고 : PLO / 라미닌 코팅 플레이트가 마르지 않도록하십시오.

7. hESC 유래 NPC를 도파민성 뉴런으로 분화(그림 6A)

  1. 약 50 %의 밀도로 NPC 팽창 매체에서 PLO / 라미닌 코팅 접시의 플레이트 NPC.
  2. 24시간 후, 배지를 DA1 배지(2 mM 글루타민 보충제, 1x NEAA, 1x B27, 200 ng/mL SHH 및 100 ng/mL FGF8를 함유하는 신경기분저 배지)로 변경하고 격일로 배지를 변경합니다.
  3. 그들은 합류에 도달 할 때 통로 문화. 분리 액(1x)의 1 mL로 세포를 해리하고 37°C에서 10분 동안 배양합니다.
  4. 세포를 370 x g에서 2분 동안 원심분리하고 상상으로 분리하여 제거한다. DA1 배지 1mL를 추가하고 부드러운 파이펫팅으로 셀을 다시 일시 중단합니다.
  5. PLATE 1 x 105 세포를 PLO/라미닌 코팅 6웰 플레이트에 DA1 배지의 2 mL에.
  6. 10일 후, DA2 배지로 변경(2 mM 글루타민 보충제, 1x NEAA, 1x B27, 200 μM 아스코르브산, 20 ng/mL BDNF, 및 20 ng/mL GNDF)을 매일 추가로 20일 동안 배지를 변경한다(그림6A).
    참고: DA2 배지에 매일 신선한 아스코르브산을 첨가하세요. 처음 14 일 안에, 분화한 세포는 90% confluency에 도달할 때 통과되어야 합니다, 그러나 그 후에 더 이상.

8. ESC에서 파생된 NPC를 성상세포로 분화

  1. 약 50 %의 밀도로 NPC 팽창 배지에서 PLO / 라미닌 코팅 플레이트상의 플레이트 신경 전구 세포.
  2. 24시간 후, 배지를 성상 세포 배지(DMEM/F12 배지 1:100 N2, 1:100 B27, 200 ng/mL IGF, 10 ng/mL 액티빈 A, 10 ng/mL 이저린 β-1, 및 8 ng/mL bFGF)로 변경하고 격일로 배지를 변경한다.
  3. 그들은 합류에 도달 할 때 통로 문화. 분리 액(1x)의 1 mL로 세포를 해리하고 37°C에서 10분 동안 배양합니다.
  4. 세포를 370 x g에서 2분 동안 원심분리하고 상상으로 분리하여 제거한다. 성상 세포 배지 1 mL를 추가하고 부드러운 파이펫팅으로 세포를 다시 일시 중단합니다.
  5. PLATE 1 x 105 세포를 PLO/라미닌 코팅 6웰 접시에 성상 세포 배지 2 mL에 놓습니다.
  6. 총 5-6주 동안 분화를 계속할 수있습니다(그림 6B).

9. 면역형광 염색

  1. 각 세포 유형에 대해 전술한 바와 같이 35 mm μ-dish에서 배양 세포. 배지를 흡인하고 접시 당 4 % PFA 용액 의 1 mL을 추가하고 RT에서 20 분 동안 배양하십시오.
  2. PBS로 5분 동안 2x를 씻으소서.
    참고 : 세포가 고정되면 분석 판을 파라 필름으로 밀봉하고 4 °C에서 보관 할 수 있습니다. 고정 후 1 주 이내에 항체로 얼룩을 지습니다.
  3. 접시당 차단 용액(PBS의 염소 또는 당나귀 혈청)을 300 μL 추가하고 RT에서 30-60분 동안 배양합니다.
  4. 5 분 동안 PBS로 접시2x를 씻으소서.
  5. 1차항체(표 1)용액(차단 용액에서 희석)의 300 μL을 넣고 RT에서 1.5시간 또는 4°C에서 밤새 배양합니다.
  6. 10 분 동안 PBS로 2 x를 씻으소서.
  7. 300 μL의 형광-컨쥬게이션 이차항체(표 1)를차단 용액에 넣고 RT에서 1시간 동안 어둠 속에서 배양한다.
  8. PBS로 세포를 2x 10 분 동안 씻으소서.
  9. Hoechst 염색 용액 (PBS에서 1 μM 최종 농도)을 추가하여 핵을 염색합니다. RT에서 5 분 동안 어둠 속에서 세포를 배양하십시오.
  10. 세포를 5분 동안 PBS로 1x 세척한 다음 500 μL의 PBS를 추가합니다. 접시를 어둠 속에서 유지한 다음 공초점 현미경으로 형광을 관찰합니다(그림 2B, 그림 5C, 그림 6A그림 7B).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

여기에 제시된 것은 hESCs의 단일 세포 형 배양및 신경 전구 세포로의 효율적인 분화의 유지 및 확장을 위한 개선된 프로토콜이며, 이는 이어서 다양한 다운스트림 신경 계보로 분화되고, 도파민성 뉴런과 성상 세포를 포함.

대표적인 상 대비 이미지는 단일 세포 형 배양에 대한 콜로니 형 hESCs의 적응 동안 상이한 단계에서 세포 형태를보여준다(도 1A). 단세포 배양 조건을 통해, 적응된 hESCs가 고밀도로 유지될 수 있었고, 그 후 합류에 도달할 때 쉽고 효율적으로 배양할 수 있었다는 것을 알 수있었다(도 1A, B). 이들 세포는 콜로니 형 hESCs의 전형적인 세포 주기 특성(즉, 짧은 G1 상 및 S상에서 세포의 높은 비율)을 유지하였다(도1C,D). 그들은 또한 QRT-PCR 및 면역 염색 분석에 의해 지시된 바와 같이 콜로니 형 hESCs의 것과 유사한 수준에서 ESC 마커(즉, OCT4, TRA 1-81, SOX2 및 NANOG)를 발현하였다(도7, 표 2). 더욱이, 단세포 hESCs는 내배엽(SOX17 발현), 중배엽(SMA 발현) 및 이방인(Tuj-1 발현)(그림 2)의세 가지 생식층 모두로부터 세포를 함유하는 배아체를 형성할 수 있었다는 것을 보여주었다.

다음으로, NPC프로토콜(도 3A)을이용하여 신경 전구 세포로 효율적으로 분화한 단세포 형 hCS가 일반적인 hESC 형태및 NPC 형태(도3B)의외관의 손실에 의해 지시된 바와 같이16. NPC 분화는 시그니처 NPC 마커(즉, SOX1, OTX2, ZIC1 및 OTX1)의 증가된 발현에 의해 지원되었다; 5A, 표 2)면역염색 및 FACS 분석에 의해 확인하였다. 동일한 분석은 또한 세포의 90% 이상이 SOX1, PAX6 및 NCAM 단백질에 대해 양성으로 염색된 것으로나타났다(도 5B,C). 다양한 다운스트림 신경 계보로 분화하는 단일 세포 hESC 유래 NPC의 능력을 조사하기 위해, 이들 세포를 도파민성 뉴런 및 성상세포로 분화시켰습니다. 도 6A, B,단일 세포 hESC 유래 NPC는 도파민성 뉴런 및 성상 세포로 분화할 수 있었으며, 특징적인 형태와 계보 특이적 도파민성 마커의 발현(즉, TH; 도 6A)및 성상 세포 마커(즉, GFAP 및 S100B; 그림 6B).

Figure 1
도 1: 단일 세포 형 배양에 콜로니 형 hESCs의 적응. (A)H9 hESCs의 단세포 배양물의 대표적인 위상 대조 이미지는 2% 지하 멤브레인 매트릭스 코팅 접시에 도금 후 상이한 시간에. 낮음(왼쪽) 및 높음(오른쪽) 배율. 상단 패널 : 식민지 형 hESCs의 대표 이미지. 다른 패널은 단세포 형 hESCs에 적응하는 동안 다른 시간에 배양의 대표적인 이미지를 보여줍니다. 배율 막대 = 200 μm. (b)H9 hESCs의 성장 곡선은 단세포 배양 조건 동안 처음 24시간 동안 10 μM ROCK 억제제와 함께 2% 지하 막 매트릭스 코팅 플레이트에서 모니터링하였다. (C, D) 유세포분석에 의한콜로니형(C)및 단세포형(D) H9 HESCs의 세포주기 분석. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 2
도 2: 적응된 단세포 타입 hESCs를 3개의 세균 층으로 시험관내 분화. (a)hESCs의 단세포 유형에서 유래된 배아체(EB)의 대표적인 상 상 상. 배율 막대 = 100 μm. (b)분화된 hESCs의 면역형광 이미지는 SOX17(내배엽), SMA(중도), 및 투지-1(ectoderm)의 세 가지 상이한 세균 층 마커의 발현을 위해 분석하였다. 핵을 DAPI로 염색시켰다. 배율 막대 = 50 μm. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 3
도 3: 직접 분화에 의해 단일 세포 형 hESCs를 신경 전구 세포로 분화한다. (A)hESCs의 분화 프로토콜을 신경 전구 세포(NPC)로 분화하는 회로도. hESCs를 도금 후 1일 후 도르소모르핀(DMH) 및 SB431542(SB)로 처리하였다. (B)신경 분화 동안 세포 형태학의 대표적인 위상 대조 이미지. 배율 막대 = 200 μm. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 4
도 4: 상이한 지하 멤브레인 매트릭스 제품에 대한 hESC 배양. (A)마트리겔 또는 겔트렉스상에서 배양된 hESCs는 단일 세포 배양과 유사한 NPC로 성장하고 분화하는 능력을 나타내었다. 세포는 네스티인 항체로 염색하였다. 핵을 DAPI로 염색시켰다. 배율 막대 = 50 μm. (B)마트리겔 또는 겔트렉스에서 배양된 hESCs는 네스트인-및 PAX6 양성 세포의 백분율로 나타난 바와 같이 NPC로 분화하는 유사한 가능성을 보였다. 세포는 NPC 분화의 7일째에 유세포측정에 의해 분석되었다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 5
그림 5: NPC 마커의 발현. (a)7일간의 신경 분화 후, NPC 마커 유전자(즉, OTX1, OTX2, SOX1 및 ZIC1)의 발현을 QRT-PCR에 의해 분석하였다. 값은 GAPDH로 정규화되고 hESCs 값(p< 0.05)을 기준으로 계산되었습니다. (b)SOX1-, 네스팅-, SOX2 및 NCAM 양성 세포의 백분율은 NPC 분화7일째에 유세포측정에 의해 결정되었다. (C)7일째 NPC 분화에서, 세포는 SOX1, 네스티인, NCAM, OTX2 및 PAX6에 대한 항체로 염색하였다. 핵을 DAPI로 염색시켰다. 배율 막대 = 100 μm. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 6
도 6: 단일 세포 형 hESCs로부터 유래된 NPC의 도파민성 뉴런 및 성상세포 분화. (A)도파민성 뉴런의 대표적인 위상 대비 이미지(상단 패널). 배율 막대 = 100 μm. 분화 세포는 지시된 바와 같이 도파민성 뉴런 마커 TH(티로신 하이드록실라제)에 대하여 항체로 염색하였다. 핵을 DAPI로 염색시켰다. 배율 막대 = 50 μm. (B)성상 세포의 대표적인 위상 대비 이미지 (상단 패널). 배율 막대 = 100 μm. 분화 세포는 지시된 바와 같이 성상세포 마커 GFAP(신경교 섬유성 산성 단백질) 및 S100-B(S100 칼슘 결합 단백질 B)에 대하여 항체로 염색하였다. 핵을 DAPI로 염색시켰다. 배율 막대 = 50 μm. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 7
그림 7: 단세포 형 hESCs의 특성화. (A)단일 세포 형 배양에 적응된 hESCs는 QRT-PCR에 의한 ESC 마커(즉, OCT4, NANOG 및 SOX2)의 발현을 분석하였다. 값을 GAPDH(p< 0.05)로 정규화하였다. (B)다능 마커 OCT4, TRA-1-81, 및 SSEA-1의 발현을 위해 염색된 hESCs의 면역형광 이미지. 핵을 DAPI로 염색시켰다. 배율 막대 = 50 μm. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

1 차 항체 희석 카탈로그 번호 회사
10월 4일 마우스 1:1000 sc-5279 산타 크루즈
TRA 1-81 마우스 1:500 sc-21706 산타 크루즈
SSEA-1 마우스 1:500 sc-21702 산타 크루즈
삭스1 염소 1:500 AF-3369 R&D
SOX2 토끼 1:1,000 sc-20088 산타 크루즈
Sma 토끼 1:500 ab-5694 아캄 (주)
투즈1 마우스 1:1000 T8578 시그마
네스팅 (동안) 마우스 1:1000 ab-22035 아캄 (주)
OTX2 마우스 1:250 ab-21990 아캄 (주)
hNCAM 마우스 1:200 sc-106 산타 크루즈
hPAX6 마우스 1:250 561664 Bd
마우스 1:500 T1299 시그마
S100b 마우스 1:250 ab4066 아캄 (주)
GFAP 토끼 1:1,000 ab7260 아캄 (주)
이차 항체
안티 마우스 염소 1:1,000 AF 488 또는 647 라이프 테크놀로지스
안티 토끼 염소 1:1,000 AF 488 또는 647 라이프 테크놀로지스

표 1: 면역세포화학 및 FACS 분석에 사용되는 항체.

프라이머 이름 프라이머 시퀀스
10월 4일 F: 가그타트카카카아아그
R: CTAGGTTGCCTCtC
나노 (주) F: GGTTCCAGAACCA가가가가가가
R: 아츠가그트CCCAGTCG
삭스1 F: CCTTAGGTTTCCCCTCTCTTT
R: 카그카트가트트트트CTCTCATT
OTX1 F: 아가트카크GCCGGAGTCT
R: CGTGAATTGGCCACTTT
OTX2 F: TGGAGCACTGTTTGCCAAG
R: 타아카타크GCACCCTCG
ZIC1 F: AACCCCAAAAAGTCGTGCAAC
R: TCCCCCAGAAGCAGATGA
갭DH F: CCCATCATCTTCCAGAG
R: CTTCTCCTGGTGAGACG

표 2: QRT-PCR 분석에 사용되는 프라이머 목록.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

다양한 계보로 hESCs를 분화하고 충분한 수의 분화 세포를 생성하기 위한 확장 가능하고 효율적인 방법은 약물 스크리닝 및 줄기 세포 치료에 중요한 기준입니다. 다양한 단세포 통과 방법이 발표되었으며, 이 때 세포는 생존을 향상시키기 위해 ROCK 억제제 또는 다른 소분자의 존재에서 배양되지만, 이들 배양 방법의 최종 제품은 콜로니 형 hESCs17,18,19,20, 21이다. 이전에 발표된 방법19,20,21,22에부분적으로 기초한 단세포 ESC 프로토콜은 단일 세포 형 hESC 배양을 성공적으로 생성및 유지하고 콜로니 형 hESC 배양을 방지한다. 고밀도 단세포 도금, 다세포 연관성, 단층 성장 및 효율적인 하위 배양을포함한다(도 1). 후자는 hESCs의 단세포 형 배양물의 초기 24시간 동안 ROCK 억제제의 첨가에 의해 달성되었으며, 이는 세포 생존을향상시키고,18,19,20,21. 이 프로토콜은 더 쉽게 확장 가능하고 약물 스크리닝 및 줄기 세포에서 치료 응용을 위해 이러한 세포의 확장을 허용합니다.

또한 단세포형 hESCs는 EB 및 로제트형성(23,24,25)과같은 중간 단계를 사용하지 않고 NPC 혈통(도3)으로효율적으로 분화할 수 있음을 입증하였다. 단세포 형 hESCs로부터의 높은 신경 변환은 ALK 억제제, 도르소모르핀 및 SB43154215,16,26을치료함으로써 BMP/TGFβ/액티빈 신호 전달 경로의 억제를 통해 달성되었다. 이 프로토콜을 통해, 적응된 단세포 형 hESCs는 EB 및 로제트 형성을 필요로 하지 않고 NPC로 효율적으로 분화할 수있다(도 5)또는 도파민성 뉴런 및 성상세포로 분화하도록 유도될 수 있다(도6).

요약하면, hESCs의 단세포 형 배양은 다양한 계보에 다단계 분화를 조절하는 분자 메커니즘을 연구하는 신속하고 효율적인 시스템을 제공한다. 구체적으로, 이 프로토콜은 NPC를 이용하고 성상 세포 및 도파민성 뉴런과 같은 추가 신경 계보로의 후속 분화를 설명했다. 이 프로토콜은 기본 연구, 약물 스크리닝 및 재생 의학 응용 분야에 적합할 수 있는 선조 및 분화 세포의 간단하고 견고하며 확장 가능한 생산을 위한 플랫폼을 제공합니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 이해 상충을 선언하지 않습니다.

Acknowledgments

우리는 FACS 분석에 도움을 준 칼 D. 보트너 박사 (NIEHS)에게 감사드립니다. 이 연구는 국립 환경 보건 과학 연구소의 교내 연구 프로그램, 건강의 국립 연구소, AMJ에 Z01-ES-101585에 의해 지원되었다.

Materials

Name Company Catalog Number Comments
35 mm m-dishes ibidi 81156 Cell culture dish
6-well plates Corning 3516
Accutase Innovative Cell Technologies AT104-500 Cell detachment solution
Activin A R&D system 338-AC-050
Ascorbic Acid Sigma Aldrich A4403
B27 supplement Thermo Fisher 17504044
B27 supplement (-Vit A) Thermo Fisher 12587010
BDNF Applied Biological Materials Z100065
bFGF Peprotech 100-18C
Centrifuge DAMON/ICE 428-6759
CO2 incubator Thermo Fisher 4110
Corning hESC-qulified Matrix (Magrigel) Corning 354277 Basement membrane matrix (used for most of the protocol here)
Cryostor CS 10 Stemcell Technologies 7930 Cell freezing solution
Dispase Stemcell Technologies 7923
DMEM Thermo Fisher 10569-010
DMEM/F12 Thermo Fisher 10565-018
Dorsomorphin Tocris 3093
EGF Peprotech AF-100-16A
Fetal Bovine Serum Fisher Scientific SH3007003HI
FGF8 Applied Biological Materials Z101705
GDNF Applied Biological Materials Z101057
Geltrex matrix Thermo Fisher A1569601 Basement membrane matrix
GlutaMax Thermo Fisher 35050061 Glutamine supplement, 100X
H9 (WA09) human embryonic stem cell line WiCell WA09
Heregulin b-1 Peprotech 100-3
IGF Peprotech 100-11
Knockout DMEM Thermo Fisher 10829018
Knockout Serum Replacement Thermo Fisher 10828028
Laminin Sigma Aldrich L2020
mTeSR1 Stemcell Technologies 85850 hESC culture medium
N2 supplement Thermo Fisher 17502001
NEAA Thermo Fisher 11140050
Neurobasal Thermo Fisher 21103049
Poly-L-ornithine Sigma Aldrich P3655
ROCK inhibitor Tocris 1254
SB431542 Tocris 1614
SHH Applied Biological Materials Z200617
Stemdiff Neural Progenitor medium Stemcell Technologies 5833 NPC expansion medium

DOWNLOAD MATERIALS LIST

References

  1. Thomson, J. A., et al. Embryonic stem cell lines derived from human blastocysts. Science. 282, (5391), 1145-1147 (1998).
  2. Rosler, E. S., et al. Long-term culture of human embryonic stem cells in feeder-free conditions. Developmental Dynamics. 229, (2), 259-274 (2004).
  3. Mallon, B. S., Park, K. Y., Chen, K. G., Hamilton, R. S., McKay, R. D. Toward xeno-free culture of human embryonic stem cells. The International Journal of Biochemistry & Cell Biology. 38, (7), 1063-1075 (2006).
  4. Hoffman, L. M., Carpenter, M. K. Characterization and culture of human embryonic stem cells. Nature Biotechnology. 23, (6), 699-708 (2005).
  5. Yan, Y., et al. Efficient and rapid derivation of primitive neural stem cells and generation of brain subtype neurons from human pluripotent stem cells. Stem Cells Translational Medicine. 2, (11), 862-870 (2013).
  6. Goncalves, J. T., Schafer, S. T., Gage, F. H. Adult Neurogenesis in the Hippocampus: From Stem Cells to Behavior. Cell. 167, (4), 897-914 (2016).
  7. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nature Biotechnology. 25, (6), 681-686 (2007).
  8. International Stem Cell Initiative. Characterization of human embryonic stem cell lines by the International Stem Cell Initiative. Nature Biotechnology. 25, (7), 803-816 (2007).
  9. Hartung, O., Huo, H., Daley, G. Q., Schlaeger, T. M. Clump passaging and expansion of human embryonic and induced pluripotent stem cells on mouse embryonic fibroblast feeder cells. Current Protocols in Stem Cell Biology. 14, (1), Chapter 1 Unit 1C 10 (2010).
  10. Chen, K. G., et al. Non-colony type monolayer culture of human embryonic stem cells. Stem Cell Research. 9, (3), 237-248 (2012).
  11. Chen, G., Hou, Z., Gulbranson, D. R., Thomson, J. A. Actin-myosin contractility is responsible for the reduced viability of dissociated human embryonic stem cells. Cell Stem Cell. 7, (2), 240-248 (2010).
  12. Li, X., Krawetz, R., Liu, S., Meng, G., Rancourt, D. E. ROCK inhibitor improves survival of cryopreserved serum/feeder-free single human embryonic stem cells. Human Reproduction. 24, (3), 580-589 (2009).
  13. Ohgushi, M., et al. Molecular pathway and cell state responsible for dissociation-induced apoptosis in human pluripotent stem cells. Cell Stem Cell. 7, (2), 225-239 (2010).
  14. Pakzad, M., et al. Presence of a ROCK inhibitor in extracellular matrix supports more undifferentiated growth of feeder-free human embryonic and induced pluripotent stem cells upon passaging. Stem Cell Reviews and Reports. 6, (1), 96-107 (2010).
  15. Chambers, S. M., et al. Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling. Nature Biotechnology. 27, (3), 275-280 (2009).
  16. Jeon, K., et al. GLIS3 Transcriptionally Activates WNT Genes to Promote Differentiation of Human Embryonic Stem Cells into Posterior Neural Progenitors. Stem Cells. 37, (2), 202-215 (2019).
  17. Emre, N., et al. The ROCK inhibitor Y-27632 improves recovery of human embryonic stem cells after fluorescence-activated cell sorting with multiple cell surface markers. PLoS ONE. 5, (8), e12148 (2010).
  18. Hanna, J., et al. Human embryonic stem cells with biological and epigenetic characteristics similar to those of mouse ESCs. Proceedings of the National Academy of Sciences of the United States of America. 107, (20), 9222-9227 (2010).
  19. Saha, K., et al. Surface-engineered substrates for improved human pluripotent stem cell culture under fully defined conditions. Proceedings of the National Academy of Sciences of the United States of America. 108, (46), 18714-18719 (2011).
  20. Tsutsui, H., et al. An optimized small molecule inhibitor cocktail supports long-term maintenance of human embryonic stem cells. Nature Communications. 2, 167 (2011).
  21. Xu, Y., et al. Revealing a core signaling regulatory mechanism for pluripotent stem cell survival and self-renewal by small molecules. Proceedings of the National Academy of Sciences of the United States of America. 107, (18), 8129-8134 (2010).
  22. Ungrin, M. D., Joshi, C., Nica, A., Bauwens, C., Zandstra, P. W. Reproducible, ultra high-throughput formation of multicellular organization from single cell suspension-derived human embryonic stem cell aggregates. PLoS ONE. 3, (2), e1565 (2008).
  23. Kim, D. S., et al. Highly pure and expandable PSA-NCAM-positive neural precursors from human ESC and iPSC-derived neural rosettes. PLoS ONE. 7, (7), e39715 (2012).
  24. Sun, Y., Hu, J., Zhou, L., Pollard, S. M., Smith, A. Interplay between FGF2 and BMP controls the self-renewal, dormancy and differentiation of rat neural stem cells. Journal of Cell Science. 124, (Pt 11), 1867-1877 (2011).
  25. Zhou, J. M., Chu, J. X., Chen, X. J. An improved protocol that induces human embryonic stem cells to differentiate into neural cells in vitro. Cell Biology International. 32, (1), 80-85 (2008).
  26. Smith, J. R., et al. Inhibition of Activin/Nodal signaling promotes specification of human embryonic stem cells into neuroectoderm. Developmental Biology. 313, (1), 107-117 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics