Effektiv neural differensiering bruker single-Cell kultur av Human embryonale stamceller

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Presentert her er en protokoll for generering av en enkelt cellekultur av menneskelig embryonale stamceller og deres påfølgende differensiering inn nevrale stamceller. Protokollen er enkel, robust, skalerbar, og egnet for narkotika screening og regenererende medisin applikasjoner.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Jeon, K., Park, K., Jetten, A. M. Efficient Neural Differentiation using Single-Cell Culture of Human Embryonic Stem Cells. J. Vis. Exp. (155), e60571, doi:10.3791/60571 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

In vitro differensiering av menneskelige embryonale stamceller (hESCs) har forvandlet evnen til å studere menneskelig utvikling på både biologiske og molekylære nivåer og gitt celler for bruk i regenererende applikasjoner. Standard tilnærminger for hESC kultur bruker koloni type kultur for å opprettholde udifferensierte hESCs og embryoid kropp (EB) og rosett formasjon for differensiering i ulike bakterie lag er ineffektiv og tidkrevende. Presentert her er en enkelt cellekultur metoden bruker hESCs stedet for en koloni-type kultur. Denne metoden tillater vedlikehold av de karakteristiske trekk ved udifferensierte hESCs, inkludert uttrykk for hESC markører på nivåer som kan sammenlignes med koloni type hESCs. I tillegg presenterer protokollen en effektiv metode for neural stamfar celle (NPC) generasjon fra én celle type hESCs som produserer NPCer innen 1 uke. Disse cellene svært uttrykker flere NPC markør gener og kan differensiere til ulike nevrale celletyper, inkludert dopaminerg neurons og astrocytter. Denne single-cellekultur system for hESCs vil være nyttig i å undersøke den molekylære mekanismer av disse prosessene, studier av visse sykdommer, og stoffet funnet skjermer.

Introduction

Human embryonale stamceller (hESCs) har potensial til å differensiere til de tre primære bakterie lag, som deretter differensiere til ulike Multipotent Stamcelle linjene. Disse linjene senere gi opphav til alle celletyper i menneskekroppen. In vitro hESC kultur systemer har forvandlet evnen til å studere menneskets embryoutvikling og har fungert som et verdifullt verktøy for å få ny innsikt i hvordan disse prosessene er regulert på biologiske og molekylære nivåer. Tilsvarende studier av indusert Pluripotent stamceller (iPSCs) generert fra omprogrammering somatiske celler isolert fra menneskelige pasienter gi romanen innsikt i ulike sykdommer. I tillegg kan stamfar og differensiert celler avledet fra hESCs være nyttig for forskning som involverer stilk cellen terapi og Drug screening1,2,3,4.

hESCs kan bli overtalt til å differensiere til nevrale stamceller (NPCer), som er multipotential celler med en omfattende selv-fornyelse kapasitet. Deretter kan disse cellene være differensiert i neurons, astrocytter, og oligodendrocytes5,6. NPCer tilbyr også et mobil system for in vitro studier av neurodevelopmental biologi og ulike nevrologiske sykdommer. Men dagens koloni type kultur metoder som involverer hESCs og deres differensiering i NPCer er ineffektiv og ofte innebære coculture samt embryoid Body (EB) og rosett formasjon5,7,8,9. Disse protokollene viser lavere overlevelses rater og spontan differensiering og er mer tidkrevende.

Presentert her er en forbedret og robust kultur system som er lett skalerbar og bruker høy tetthet enkelt celle type kultur hESCs10. Inkluderingen av Roh-kinase (rock)-hemmer bidro til betydelig forbedret overlevelses effektivitet under enkelt celle type kulturen i hESC10,11,12,13,14. I dette kultur systemet kan hESCs enkelt vedlikeholdes og utvides. I tillegg presenterer protokollen en effektiv metode for å generere NPCer fra enkelt celle type kultur hESCs, som tillater produksjon av svært rene NPCer. hemming av BMP/TGFβ/activin signalering trasé med ALK hemmere effektivt indusere differensiering av enkelt celle type hESCs inn NPCer15,16, som deretter kan bli indusert å differensiere til funksjonell nevrale linjene, som dopaminerg neurons og astrocytter.

I sammendraget, den single-Cell type kultur protokoll ved hjelp hESCs tilbyr en attraktiv modell for å studere differensiering av disse cellene i ulike linjene, inkludert NPCer. Denne protokollen er lett skalerbar og derfor egnet til å generere celler for forskning som involverer regenererende terapi og narkotika screening.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. utarbeidelse av hESC-kvalifisert kjeller membran Matrix-belagt plater

  1. Tine sakte opp den hESC-kvalifiserte matrisen med kjeller membran (se tabell over materialer) ved 4 ° c i minst 2 – 3 timer eller over natten for å unngå dannelse av gel.
  2. Å forberede kjeller membran matrise-belagt plater, fortynne matrise i kaldt DMEM/F12 til en 2% endelig konsentrasjon. Bland godt og pels hver brønn av en 6 brønn plate med 1 mL av fortynnet matrise løsning.
  3. Ruge i kjeller membranen matrise-belagte plater ved romtemperatur (RT) i minst 3 t eller ved 4 ° c over natten.
    Merk: tallerkener med matrise for kjeller membran kan oppbevares ved 4 ° c i 1 uke før Matrix-løsningen fjernes og platene brukes.

2. tilpasning av kolonien type hESCs til Single-Cell hESC kultur

  1. Å passasje materen-frie kulturer av kolonien type H9 (WA09) hESCs vokst på kjeller membran Matrix, aspirer mediet fra brønnene (figur 1A)9.
  2. Vask 1x med 1 mL DPBS. Tilsett 1 mL dispase oppløsning (1 U/mL) per brønn og ruge ved 37 ° c i 20 min.
  3. Fjern dispase, vask cellene 1x forsiktig med 2 mL DMEM/F12, Fjern mediet og tilsett 2 mL DMEM/F12 til hver plate.
  4. Løsne kolonier forsiktig ved å forsiktig pipettering opp og ned og overføre til et 15 mL rør.
  5. Sentrifuger pellets for 2 min ved 370 x g og aspirer mediet.
  6. For å distansere celle pellets i enkeltceller, tilsett 2 mL celle avløsning løsning (1x konsentrasjon, se tabell av materialer) og ruge ved 37 ° c i 10 min.
  7. Sentrifuger celler for 2 min ved 370 x g og fjerne løsgjøring løsning.
  8. Legg frisk mTeSR1 menneskelig ESC medium og distansere cellene i enkeltceller ved milde pipettering opp og ned.
  9. For å tilpasse kolonien type hESCs til en enkelt-celle type kultur, plate ca 1.5-2.0 x 106 hESCs i hver brønn av kjelleren membran matrise-belagt 6 brønn plate i 2 ml mTeSR1 inneholder 10 μM rock inhibitor for 24 h (figur 1a).
  10. Etter 24 h, erstatte hESC medium med frisk mTeSR1 uten ROCK inhibitor og la hESCs å vokse som en enkelt celle type for 3 dager. Endre mediet daglig.
  11. På dag 4, når kulturer nå nesten 100% confluency, distansere celler i avløsning løsning, deretter replate som beskrevet i trinn 2,6.
    Merk: ROCK-hemmer forbedrer celle overlevelse i løpet av de første 24 h av én celle type hESC kultur.

3. Embryoid Body dannelse og differensiering i tre bakterie lag (figur 2)

  1. Hvis du vil danne EBs, må du først resuspend celler i 3 mL mTeSR1 medium med 10 μM ROCK-hemmer i løpet av de første 24 h, deretter ruge over natten i 60 mm lave feste retter i en 37 ° c inkubator for å tillate aggregering.
  2. Etter 24 h, den lille EBs er overført til en 15 mL tube. La EBs bosette seg til bunnen av røret og forsiktig fjerne mediet med en pipette. Overfør EBs til EB-medium (knockout-DMEM supplert med 20% knockout serum erstatning, 1x glutamin supplement [se tabell av materialer], 1% NEAA [ikke-essensielle aminosyrer, se tabell av materialer], og 0,2% β-mercaptoethanol) og tillate dem å ekspandere i lav feste retter i 7 dager. Mediet kan skiftes annenhver dag som beskrevet ovenfor (figur 2A).
  3. På dag 7, samle EBs fra rettene og overføre dem til en 15 mL tube. Forsiktig fjerne mediet med en pipette og overføre EBs til en kjeller membran matrise-belagt 6 brønn plate.
  4. La EBs å feste til platen og ruge for 12 dager i EB medium, der de vil differensiere til tre bakterie lag (figur 2B). Endre mediet annenhver dag.
    Merk: under aggregering av celler, den lave feste parabolen bidrar til å unngå EB vedlegg.

4. differensiering av single-celle type hESCs Into NPCer (Figur 3)

  1. For å indusere NPC differensiering, distansere enkelt celle type hESCs med 1 mL avløsning løsning (1x) og ruge i 10 min ved 37 ° c.
  2. Sentrifuger cellene i 2 min ved 370 x g og fjern løsgjøring løsningen supernatanten. Tilsett 1 mL DMEM/F12 og resuspend celler ved milde pipettering.
  3. Plate celler på en kjeller membran matrise-belagt 6 brønn plate i en tetthet på 2 x 105 celler/brønn i 2 ml mTeSR1 inneholder 10 μM rock inhibitor.
  4. Etter 24 h, erstatte kultur medium med neural induksjon medium (DMEM med 1% B27 minus vitamin A) supplert med 1 μM dorsomorphin og 5 μM SB431542.
  5. Endre mediet annenhver dag i løpet av de første 4 dagene av nevrale induksjon, deretter hver dag til nå samløpet på dag 7 (Figur 3B).
    Merk: (1) Dorsomorphin hemmer BMP veien ved å målrette ALK2, 3, 6 reseptorer og hemmer også AMPK; SB431542 er en hemmer av TGFβ/Activin sti ved å målrette ALK5. (2) den samme protokollen ble testet med en annen ESC linje (WA01), som ga lignende resultater som WA0916. (3) vi har generelt brukt Matrigel for kjelleren membran matrise; Imidlertid kan celler bli kultivert på Geltrex og deretter differensiert i NPCer med svært like resultater som indikert av uttrykk for flere NPC markører (Figur 4D, E). Håndter Geltrex på samme måte som Matrigel (se avsnitt 1).

5. NPC ekspansjon og kryonisk bevaring

  1. Etter 7 dager med neural induksjon, distansere celler med 1 mL avløsning løsning (1x) og ruge i 10 min ved 37 ° c.
  2. Sentrifuger cellene i 2 min ved 370 x g og fjern løsgjøring løsningen supernatanten. Tilsett 1 mL NPC ekspansjons medium (se tabell over materialer) og resuspend celler ved milde pipettering.
  3. Plate 1 x 105 celler i 2 ml av NPC ekspansjon medium på kjeller membran matrise-belagt 6 brønn plater.
  4. Passage NPCer flere ganger, etter behov, når kulturer nå nesten 90% confluency. I løpet av de første 3 – 4 skriftstedene, tilsett 10 μM ROCK-hemmer i løpet av de første 24 h for å hindre celle død. Etter disse passasjer, celler kan være passert og kultivert uten ROCK inhibitor. Endre mediet annenhver dag under utvidelsen.
  5. Lagre nedfryste NPCer når kulturer nå confluency.
    1. For kryonisk bevaring, distansere celler i 1 mL avløsning løsning (1x) i 5 min ved 37 ° c, deretter sentrifuger suspensjon for 2 min ved 370 x g for å fjerne avløsning løsning.
    2. Legg til løsning for celle frysing (se tabell over materialer) for å dissosiert NPCer ved 1 x 106 celler/mL og fordele 1 ml alikvoter til cryovials.
    3. Plasser cryovials i fryse beholder og oppbevar dem over natten i en-80 ° c fryser.
  6. Oppbevar cryovials i det flytende nitrogen.

6. utarbeidelse av Poly-L-Ornithine (PLO) og Laminin belagte plater

  1. For å klargjøre PLO/laminin-belagte plater, fortynne PLO Stock-løsningen i PBS eller vann til en endelig konsentrasjon på 10 μg/mL. Bland godt og lag hver brønn av en 6 brønn plate med 1 mL fortynnet PLO-løsning.
  2. Ruge i minst 2 timer ved 37 ° c eller over natten ved 4 ° c.
  3. Vask hver brønn med PBS.
  4. Fortynne laminin lagerløsning i kald PBS eller vann ved 10 μg/mL. Bland laminin løsningen godt. Fjern PBS og lag umiddelbart hver brønn med 1 mL av den laminin løsningen. Oppbevar platene ved 4 ° c og bruk innen 1 uke. Vask med PBS og umiddelbart legge kultur medium.
    Merk: ikke la PLO/laminin-belagte plater tørke ut.

7. differensiering av hESC-avledet NPCer Into Dopaminerg neurons (figur 6A)

  1. Plate NPCer i PLO/laminin-belagte retter i NPC ekspansjon medium i en tetthet på ca 50%.
  2. Etter 24 h, endre medium til DA1 medium (neurobasal medium inneholdende 2 mM glutamin supplement, 1x NEAA, 1x B27, 200 ng/mL HYSJ, og 100 ng/mL FGF8) og endre mediet annenhver dag.
  3. Passage kulturer når de når confluency. Distansere celler med 1 mL avløsning løsning (1x) og ruge i 10 min ved 37 ° c.
  4. Sentrifuger cellene i 2 min ved 370 x g og fjern løsgjøring løsningen supernatanten. Tilsett 1 mL DA1 medium og resuspend cellene ved milde pipettering.
  5. Plate 1 x 105 celler i 2 ml DA1 medium på PLO/laminin-belagt 6 brønn plater.
  6. Etter 10 dager, bytte til DA2 medium (neurobasal medium inneholdende 2 mM glutamin supplement, 1x NEAA, 1x B27, 200 μM askorbinsyre, 20 ng/mL BDNF, og 20 ng/mL GNDF) og endre medium annenhver dag for ytterligere 20 dager (figur 6A).
    Merk: Legg frisk askorbinsyre daglig til DA2 medium. I løpet av de første 14 dagene bør differensiert celler sendes når de når 90% confluency, men ikke lenger etter det.

8. differensiering av ESC-avledet NPCer i astrocytter

  1. Plate nevrale stamceller på PLO/laminin-belagt plater i NPC ekspansjon medium i en tetthet på ca 50%.
  2. Etter 24 h, endre medium til astrocytt medium (DMEM/F12 medium inkludert 1:100 N2, 1:100 B27, 200 ng/mL IGF, 10 ng/mL activin A, 10 ng/mL heregulin β-1, og 8 ng/mL bFGF) og endre mediet annenhver dag.
  3. Passage kulturer når de når confluency. Distansere celler med 1 mL avløsning løsning (1x) og ruge i 10 min ved 37 ° c.
  4. Sentrifuger cellene i 2 min ved 370 x g og fjern løsgjøring løsningen supernatanten. Tilsett 1 mL astrocytt medium og resuspend cellene ved milde pipettering.
  5. Plate 1 x 105 celler i 2 ml astrocytt medium på PLO/laminin-belagt 6 godt retter.
  6. Tillat differensiering å fortsette i totalt 5-6 uker (figur 6B).

9. Immunofluorescence farging

  1. Kultur celler i 35 mm μ-retter som beskrevet ovenfor for hver celle type. Aspirer mediet og tilsett 1 mL 4% PFA oppløsning per fat og ruge i 20 min ved RT.
  2. Vask 2x i 5 minutter med PBS.
    Merk: når cellene er festet, kan analyse platene tettes med parafilm og oppbevares ved 4 ° c. Stain med et antistoff innen 1 uke etter fiksering.
  3. Tilsett 300 μL av blokkerings løsning (geit eller esel serum i PBS) per tallerken og ruge ved RT i 30 – 60 min.
  4. Vask parabolen 2x med PBS i 5 min.
  5. Tilsett 300 μL av primær antistoff (tabell 1) løsning (fortynnet i blokkerings løsning) og RUGE ved RT for 1,5 t eller over natten ved 4 ° c.
  6. Vask 2x med PBS i 10 min.
  7. Tilsett 300 μL av fluorescerende-bøyd sekundært antistoff (tabell 1) i blokkerings løsning og ruge i mørket i 1 time ved RT.
  8. Vask cellene 2x i 10 minutter med PBS.
  9. Legg til Hoechst farge løsning (1 μM endelig konsentrasjon i PBS) for å flekk kjerner. Ruge cellene i mørket i 5 min ved RT.
  10. Vask celler 1x med PBS i 5 minutter og legg deretter til 500 μL av PBS. Hold retter i mørket, deretter observere fluorescens med et konfokalmikroskopi mikroskop (figur 2B, figur 5C, figur 6a, og figur 7B).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Presentert her er en forbedret protokoll for vedlikehold og utvidelse av enkelt celle type kultur hESCs og deres effektive differensiering inn nevrale stamceller, som senere skiller ut i ulike nedstrøms neural linjene, inkludert dopaminerg neurons og astrocytter.

Representative fase kontrast bilder viser celle morfologi ved ulike trinn under tilpasningen av kolonien type hESCs til enkelt celle type kultur (figur 1A). Gjennom enkelt celle kulturen tilstand, ble det funnet at de tilpassede hESCs var i stand til å bli opprettholdt ved høy tetthet, deretter enkelt og effektivt subcultured når nå confluency (figur 1A, B). Disse cellene beholdt celle syklus egenskaper (dvs. en kort G1 fase og høy andel av celler i S fase) typisk for kolonien type hESCs (figur 1C, D). De har også uttrykt ESC markører (dvs. OCT4, TRA 1-81, SOX2 og NANOG) på nivåer sammenlignbare med de av kolonien type hESCs som indikert av QRT-PCR og immunostaining analyse (figur 7, tabell 2). Videre ble det vist at single-celle hESCs var i stand til å danne embryoid organer som inneholder celler fra alle tre bakterie lag: endoderm (SOX17 uttrykk), mesoderm (SMA uttrykk) og ektoderm (tuj-1 uttrykk) (figur 2).

Deretter ble det demonstrert at single-Cell type hESCs effektivt differensiert i nevrale stamceller ved hjelp av en NPC protokoll (Figur 3A), som indikert av tapet av typiske hESC MORFOLOGI og utseende av NPC morfologi (Figur 3B)16. NPC differensiering ble støttet av den økte uttrykk for signaturen NPC markører (dvs. SOX1, OTX2, ZIC1, og OTX1; Figur 5A, tabell 2) og bekreftet av immunostaining og FACS analyse. Den samme analysen viste også at mer enn 90% av cellene farget positivt for SOX1, PAX6, og NCAM protein (figur 5B, C). For å undersøke evnen til Single-Cell hESC-avledet NPCer å differensiere til ulike nedstrøms nevrale linjene, differensiering av disse cellene i dopaminerg neurons og astrocytter ble undersøkt. Som vist i figur 6A, B, Single-celle hESC-avledet NPCer var i stand til å differensiere til dopaminerg neurons og astrocytter, som indikert av utseendet av karakteristiske morfologier og uttrykk for avstamning-spesifikke dopaminerg MARKØRER (dvs. th; Figur 6A) og astrocytt MARKØRER (dvs. GFAP og S100B; Figur 6B).

Figure 1
Figur 1: tilpasning av kolonien type hESCs til enkelt celle type kultur. (A) representative fase kontrast bilder av én cellekulturer av H9 hESCs på ulike tidspunkter etter plating på 2% kjeller membran matrise-belagte retter. Lav (venstre) og høy (høyre) forstørrelse. Top panel: representative bilde av kolonien type hESCs. Andre paneler viser representative bilder av kulturer på forskjellige tidspunkter under tilpasningen til enkelt celle type hESCs. Scale bar = 200 μm. (B) vekst kurver av H9 hESCs ble overvåket i 2% kjeller membran Matrix-belagt plater med 10 μM rock inhibitor for første 24 h under enkelt cellekultur tilstand. (C, D) Celle syklus analyse av koloni type (C) og enkelt celle type (D) H9 hESCs ved flyt flowcytometri. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: in vitro differensiering av tilpasset enkelt celle type hESCs i tre bakterie lag. (A) representative fase bilder av embryonale organer (EB) avledet fra enkelt celle type hESCs. Scale bar = 100 μm. (B) Immunofluorescent bilder av differensiert hESCs analysert for uttrykk for de tre forskjellige bakterie lag MARKØRER: SOX17 (endoderm), sma (mesoderm), og tuj-1 (ektoderm). Kjerner ble farget med DAPI. Scale bar = 50 μm. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: differensiering av enkelt celle type hESCs i nevrale stamceller ved direkte differensiering. (A) skjematisk av differensiering protokollen av hESCs i nevrale stamceller (NPCer). hESCs ble behandlet med dorsomorphin (DMH) og SB431542 (SB) 1 dag etter plating. (B) representative fase kontrast bilder av celle morfologi under neural differensiering. Scale bar = 200 μm. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4: hESC kultur på ulike kjeller membran matrise produkter. (A) hESCs kultivert på Matrigel eller Geltrex utstilt en evne til å vokse og differensiere til NPCer som var lik den eneste celle-kulturen. Celler ble farget med et NESTIN-antistoff. Kjerner ble farget med DAPI. Scale bar = 50 μm. (B) hESCs kultivert på Matrigel eller Geltrex viste liknende potensial til å differensiere til NPCer som indikert av prosentandelen av NESTIN-og PAX6-positive celler. Celler ble analysert av Flow flowcytometri på dag 7 av NPC differensiering. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 5
Figur 5: uttrykk for NPC markører. (A) etter 7 dager med nevrale differensiering, uttrykk for NPC markør gener (dvs. OTX1, OTX2, SOX1, og ZIC1) ble ANALYSERT av QRT-PCR. Verdier ble normalisert til GAPDH og beregnet i forhold til verdiene av hESCs (p < 0,05). (B) prosentandelen av SOX1-, NESTIN-, SOX2-, og NCAM-positive celler ble bestemt av Flow flowcytometri på dag 7 av NPC differensiering. (C) på dag 7 NPC differensiering, celler ble farget med antistoffer mot NEURAL markører SOX1, NESTIN, NCAM, OTX2, og PAX6. Kjerner ble farget med DAPI. Scale bar = 100 μm. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 6
Figur 6: dopaminerg Nevron og astrocytt differensiering av NPCer avledet fra enkelt celle type hESCs. (A) representative fase kontrast bilde av dopaminerg neurons (toppanelet). Scale bar = 100 μm. Differensiert celler ble farget med antistoffer mot dopaminerg Nevron markør TH (tyrosin hydroksylase) som indikert. Kjerner ble farget med DAPI. Scale bar = 50 μm. (B) representativt fase kontrast bilde av astrocytter (øvre panel). Scale bar = 100 μm. Differensiert celler ble farget med antistoffer mot astrocytt markør GFAP (gliacellene fibrillary surt protein) og S100-B (S100 kalsium bindende protein B), som indikert. Kjerner ble farget med DAPI. Scale bar = 50 μm. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 7
Figur 7: karakterisering av enkelt celle type hESCs. (A) hESCs tilpasset enkelt celle type kultur ble analysert for uttrykk for ESC-markører (dvs. OCT4, NANOG og SOX2) av QRT-PCR. Verdiene ble normalisert til GAPDH (p < 0,05). (B) Immunofluorescent bilder av hESCs beiset for uttrykket av PLURIPOTENCY markører OCT4, TRA-1-81, og SSEA-1. Kjerner ble farget med DAPI. Scale bar = 50 μm. Vennligst klikk her for å se en større versjon av dette tallet.

Primære antistoffer Arter Fortynning Katalognummer Selskapet
OCT4 Musen 1:1000 SC-5279 Santa Cruz
TRA 1-81 Musen 1:500 SC-21706 Santa Cruz
SSEA-1 Musen 1:500 SC-21702 Santa Cruz
SOX1 Geit 1:500 AF-3369 R & D
SOX2 Kanin 1:1000 SC-20088 Santa Cruz
Sma Kanin 1:500 AB-5694 Abcam
Tuj1 Musen 1:1000 T8578 Sigma
NESTIN Musen 1:1000 AB-22035 Abcam
OTX2 Musen 1:250 AB-21990 Abcam
hNCAM Musen 1:200 SC-106 Santa Cruz
hPAX6 Musen 1:250 561664 Bd
Th Musen 1:500 T1299 Sigma
S100b Musen 1:250 ab4066 Abcam
GFAP Kanin 1:1000 ab7260 Abcam
Sekundære antistoffer
Anti-mus Geit 1:1000 AF 488 eller 647 Livet Technologies
Anti-kanin Geit 1:1000 AF 488 eller 647 Livet Technologies

Tabell 1: antistoffer som brukes i immuncytokjemi og FACS-analyse.

Primer navn Primer sekvens
OCT4 F: GGAAGGTATTCAGCCAAACG
R: CTCCAGGTTGCCTCTCACTC
NANOG F: GGTTCCAGAACCAGAGAATGA
R: ATTGGAAGGTTCCCAGTCG
SOX1 F: CCTTAGGTTTCCCCTCGCTTT
R: CAGGCTGAATTCGGTTCTCATT
OTX1 F: AAGATCAACCTGCCGGAGTCT
R: CGTGAATTGGCCACTGCTTT
OTX2 F: TGGAAGCACTGTTTGCCAAG
R: TAAACCATACCTGCACCCTCG
ZIC1 F: AACCCCAAAAAGTCGTGCAAC
R: TCCTCCCAGAAGCAGATGTGA
GAPDH F: CCCATCACCATCTTCCAGGAG
R: CTTCTCCATGGTGGTGAAGACG

Tabell 2: liste over primere som brukes i QRT-PCR analyse.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Skalerbare og effektive metoder for differensiering av hESCs i ulike linjene og generering av tilstrekkelig antall differensiert celler er viktige kriterier for narkotika screening og stilk cellen terapi. Ulike single-celle passerer metoder har blitt publisert, der cellene er kultivert i nærvær av rock inhibitor eller andre små molekyler for å forbedre overlevelse, men de endelige produktene av disse kultur metoder er koloni type hESCs17,18,19,20,21. Den single-Cell ESC-protokollen, som er delvis basert på tidligere publiserte metoder19,20,21,22, genererer vellykket og vedlikeholder enkelt celle-type hESC kulturer og hindrer koloni type hESC kultur. Det inkluderer høy tetthet enkelt celle plating, flercellede forening, monolag vekst, og effektiv under kultur (figur 1). Sistnevnte ble oppnådd ved tilsetning av rock inhibitor under den første 24 h av single-Cell type kultur hESCs, som forbedrer celle overlevelse17,18,19,20,21. Denne protokollen er lettere skalerbar og tillater utvidelse av disse cellene for terapeutiske programmer i narkotika screening og stilk cellen.

Det er videre demonstrert at single-Cell type hESCs effektivt kan differensiere til NPC avstamning (Figur 3) uten bruk av en mellomliggende scene, for eksempel Eb og rosett formasjon23,24,25. Høy nevrale konvertering fra enkelt celle type hESCs ble oppnådd gjennom hemming av BMP/TGFβ/activin signalering trasé ved behandling med ALK hemmere, dorsomorphin, og SB43154215,16,26. Med denne protokollen, tilpasset enkelt celle type hESCs kan effektivt differensiere til NPCer uten behov for EB og rosett formasjon (figur 5) og eller bli overtalt til å differensiere til dopaminerg neurons og astrocytter (figur 6).

Oppsummert enkelt celle type kultur hESCs gir et raskt og effektivt system for å studere molekylære mekanismer som regulerer flertrinns differensiering til ulike linjene. Nærmere bestemt benyttet denne protokollen NPCer og beskrev deres påfølgende differensiering i ytterligere nevrale linjene, slik som astrocytter og dopaminerg neurons. Protokollen gir en plattform for enkel, robust og skalerbar produksjon av Stam og differensiert celler som kan være egnet for grunnleggende studier, narkotika screening, og anvendelser i regenererende medisin.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer ingen interessekonflikter.

Acknowledgments

Vi takker Dr. Carl D. Bortner (NIEHS) for hans hjelp med FACS analyse. Denne forskningen ble støttet av intramural Research program ved National Institute of Environmental Health Sciences, National Institutes of Health, Z01-ES-101585 til AMJ.

Materials

Name Company Catalog Number Comments
35 mm m-dishes ibidi 81156 Cell culture dish
6-well plates Corning 3516
Accutase Innovative Cell Technologies AT104-500 Cell detachment solution
Activin A R&D system 338-AC-050
Ascorbic Acid Sigma Aldrich A4403
B27 supplement Thermo Fisher 17504044
B27 supplement (-Vit A) Thermo Fisher 12587010
BDNF Applied Biological Materials Z100065
bFGF Peprotech 100-18C
Centrifuge DAMON/ICE 428-6759
CO2 incubator Thermo Fisher 4110
Corning hESC-qulified Matrix (Magrigel) Corning 354277 Basement membrane matrix (used for most of the protocol here)
Cryostor CS 10 Stemcell Technologies 7930 Cell freezing solution
Dispase Stemcell Technologies 7923
DMEM Thermo Fisher 10569-010
DMEM/F12 Thermo Fisher 10565-018
Dorsomorphin Tocris 3093
EGF Peprotech AF-100-16A
Fetal Bovine Serum Fisher Scientific SH3007003HI
FGF8 Applied Biological Materials Z101705
GDNF Applied Biological Materials Z101057
Geltrex matrix Thermo Fisher A1569601 Basement membrane matrix
GlutaMax Thermo Fisher 35050061 Glutamine supplement, 100X
H9 (WA09) human embryonic stem cell line WiCell WA09
Heregulin b-1 Peprotech 100-3
IGF Peprotech 100-11
Knockout DMEM Thermo Fisher 10829018
Knockout Serum Replacement Thermo Fisher 10828028
Laminin Sigma Aldrich L2020
mTeSR1 Stemcell Technologies 85850 hESC culture medium
N2 supplement Thermo Fisher 17502001
NEAA Thermo Fisher 11140050
Neurobasal Thermo Fisher 21103049
Poly-L-ornithine Sigma Aldrich P3655
ROCK inhibitor Tocris 1254
SB431542 Tocris 1614
SHH Applied Biological Materials Z200617
Stemdiff Neural Progenitor medium Stemcell Technologies 5833 NPC expansion medium

DOWNLOAD MATERIALS LIST

References

  1. Thomson, J. A., et al. Embryonic stem cell lines derived from human blastocysts. Science. 282, (5391), 1145-1147 (1998).
  2. Rosler, E. S., et al. Long-term culture of human embryonic stem cells in feeder-free conditions. Developmental Dynamics. 229, (2), 259-274 (2004).
  3. Mallon, B. S., Park, K. Y., Chen, K. G., Hamilton, R. S., McKay, R. D. Toward xeno-free culture of human embryonic stem cells. The International Journal of Biochemistry & Cell Biology. 38, (7), 1063-1075 (2006).
  4. Hoffman, L. M., Carpenter, M. K. Characterization and culture of human embryonic stem cells. Nature Biotechnology. 23, (6), 699-708 (2005).
  5. Yan, Y., et al. Efficient and rapid derivation of primitive neural stem cells and generation of brain subtype neurons from human pluripotent stem cells. Stem Cells Translational Medicine. 2, (11), 862-870 (2013).
  6. Goncalves, J. T., Schafer, S. T., Gage, F. H. Adult Neurogenesis in the Hippocampus: From Stem Cells to Behavior. Cell. 167, (4), 897-914 (2016).
  7. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nature Biotechnology. 25, (6), 681-686 (2007).
  8. International Stem Cell Initiative. Characterization of human embryonic stem cell lines by the International Stem Cell Initiative. Nature Biotechnology. 25, (7), 803-816 (2007).
  9. Hartung, O., Huo, H., Daley, G. Q., Schlaeger, T. M. Clump passaging and expansion of human embryonic and induced pluripotent stem cells on mouse embryonic fibroblast feeder cells. Current Protocols in Stem Cell Biology. 14, (1), Chapter 1 Unit 1C 10 (2010).
  10. Chen, K. G., et al. Non-colony type monolayer culture of human embryonic stem cells. Stem Cell Research. 9, (3), 237-248 (2012).
  11. Chen, G., Hou, Z., Gulbranson, D. R., Thomson, J. A. Actin-myosin contractility is responsible for the reduced viability of dissociated human embryonic stem cells. Cell Stem Cell. 7, (2), 240-248 (2010).
  12. Li, X., Krawetz, R., Liu, S., Meng, G., Rancourt, D. E. ROCK inhibitor improves survival of cryopreserved serum/feeder-free single human embryonic stem cells. Human Reproduction. 24, (3), 580-589 (2009).
  13. Ohgushi, M., et al. Molecular pathway and cell state responsible for dissociation-induced apoptosis in human pluripotent stem cells. Cell Stem Cell. 7, (2), 225-239 (2010).
  14. Pakzad, M., et al. Presence of a ROCK inhibitor in extracellular matrix supports more undifferentiated growth of feeder-free human embryonic and induced pluripotent stem cells upon passaging. Stem Cell Reviews and Reports. 6, (1), 96-107 (2010).
  15. Chambers, S. M., et al. Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling. Nature Biotechnology. 27, (3), 275-280 (2009).
  16. Jeon, K., et al. GLIS3 Transcriptionally Activates WNT Genes to Promote Differentiation of Human Embryonic Stem Cells into Posterior Neural Progenitors. Stem Cells. 37, (2), 202-215 (2019).
  17. Emre, N., et al. The ROCK inhibitor Y-27632 improves recovery of human embryonic stem cells after fluorescence-activated cell sorting with multiple cell surface markers. PLoS ONE. 5, (8), e12148 (2010).
  18. Hanna, J., et al. Human embryonic stem cells with biological and epigenetic characteristics similar to those of mouse ESCs. Proceedings of the National Academy of Sciences of the United States of America. 107, (20), 9222-9227 (2010).
  19. Saha, K., et al. Surface-engineered substrates for improved human pluripotent stem cell culture under fully defined conditions. Proceedings of the National Academy of Sciences of the United States of America. 108, (46), 18714-18719 (2011).
  20. Tsutsui, H., et al. An optimized small molecule inhibitor cocktail supports long-term maintenance of human embryonic stem cells. Nature Communications. 2, 167 (2011).
  21. Xu, Y., et al. Revealing a core signaling regulatory mechanism for pluripotent stem cell survival and self-renewal by small molecules. Proceedings of the National Academy of Sciences of the United States of America. 107, (18), 8129-8134 (2010).
  22. Ungrin, M. D., Joshi, C., Nica, A., Bauwens, C., Zandstra, P. W. Reproducible, ultra high-throughput formation of multicellular organization from single cell suspension-derived human embryonic stem cell aggregates. PLoS ONE. 3, (2), e1565 (2008).
  23. Kim, D. S., et al. Highly pure and expandable PSA-NCAM-positive neural precursors from human ESC and iPSC-derived neural rosettes. PLoS ONE. 7, (7), e39715 (2012).
  24. Sun, Y., Hu, J., Zhou, L., Pollard, S. M., Smith, A. Interplay between FGF2 and BMP controls the self-renewal, dormancy and differentiation of rat neural stem cells. Journal of Cell Science. 124, (Pt 11), 1867-1877 (2011).
  25. Zhou, J. M., Chu, J. X., Chen, X. J. An improved protocol that induces human embryonic stem cells to differentiate into neural cells in vitro. Cell Biology International. 32, (1), 80-85 (2008).
  26. Smith, J. R., et al. Inhibition of Activin/Nodal signaling promotes specification of human embryonic stem cells into neuroectoderm. Developmental Biology. 313, (1), 107-117 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics