A sustainable auto regulating bacterial system for the remediation of oil pollutions was designed using standard interchangeable DNA parts (BioBricks). An engineered E. coli strain was used to degrade alkanes via β-oxidation in toxic aqueous environments. The respective enzymes from different species showed alkane degradation activity. Additionally, an increased tolerance to n-hexane was achieved by introducing genes from alkane-tolerant bacteria.
This work puts forward a toolkit that enables the conversion of alkanes by Escherichia coli and presents a proof of principle of its applicability. The toolkit consists of multiple standard interchangeable parts (BioBricks)9 addressing the conversion of alkanes, regulation of gene expression and survival in toxic hydrocarbon-rich environments.
A three-step pathway for alkane degradation was implemented in E. coli to enable the conversion of medium- and long-chain alkanes to their respective alkanols, alkanals and ultimately alkanoic-acids. The latter were metabolized via the native β-oxidation pathway. To facilitate the oxidation of medium-chain alkanes (C5-C13) and cycloalkanes (C5-C8), four genes (alkB2, rubA3, rubA4and rubB) of the alkane hydroxylase system from Gordonia sp. TF68,21 were transformed into E. coli. For the conversion of long-chain alkanes (C15-C36), theladA gene from Geobacillus thermodenitrificans was implemented. For the required further steps of the degradation process, ADH and ALDH (originating from G. thermodenitrificans) were introduced10,11. The activity was measured by resting cell assays. For each oxidative step, enzyme activity was observed.
To optimize the process efficiency, the expression was only induced under low glucose conditions: a substrate-regulated promoter, pCaiF, was used. pCaiF is present in E. coli K12 and regulates the expression of the genes involved in the degradation of non-glucose carbon sources.
The last part of the toolkit – targeting survival – was implemented using solvent tolerance genes, PhPFDα and β, both from Pyrococcus horikoshii OT3. Organic solvents can induce cell stress and decreased survivability by negatively affecting protein folding. As chaperones, PhPFDα and β improve the protein folding process e.g. under the presence of alkanes. The expression of these genes led to an improved hydrocarbon tolerance shown by an increased growth rate (up to 50%) in the presences of 10% n-hexane in the culture medium were observed.
Summarizing, the results indicate that the toolkit enables E. coli to convert and tolerate hydrocarbons in aqueous environments. As such, it represents an initial step towards a sustainable solution for oil-remediation using a synthetic biology approach.
Oil pollution is among the most serious causes of environmental contamination, and greatly affects ecosystems, businesses and communities 3. Solutions are for example required to battle the continuous oil pollution originating from the oil sands tailing waters in Alberta, Canada. During the process of oil extraction from oil sands, bitumen, a semi-solid oxidized form of oil, is removed using thermal recovery techniques that consume about 3.1 barrels of water per single barrel of oil 1. Oil contaminated process water, mainly originating from a local river, is stored in tailing ponds after bitumen extraction. A more effective recycling of process water in order to reduce the need for freshwater uptake is needed. To facilitate the bitumen extraction and to ensure that downstream sites meet water quality guidelines for the protection of aquatic ecosystems, process water treatments are rapidly evolving 3.
To treat pollution of organic compounds, bioremediation technologies employing microorganisms are presently encouraged 1. Alkanes are the most abundant family of hydrocarbons in crude oil, containing 5 to 40 carbon atoms per molecule 7, 21. Many bacteria are known to degrade alkanes of various lengths via sequential oxidation of the terminal methyl group forming first alcohols, then aldehydes and finally fatty acids 8. Within this iGEM project several enzymes from different organisms were expressed and characterized, and made available via the BioBrick standard and Registry of Standard Biological Parts.
The well-studied alkane hydroxylase system of Gordonia sp. TF6 facilitates the initial oxidation step of C5-C13 alkanes along with that of C5-C8 cycloalkanes using a minimum of four components: alkB2 (alkane 1-monooxygenase), rubA3, rubA4 (two rubredoxins) and RubB (rubredoxin reductase) 8, 21. Oxidation of long-chain alkanes (ranging from C15 up to C36) is reported to be performed by ladA, a flavoprotein alkane monooxygenase from Geobacillus thermodinitrificans NG-80-2 7, 15, 18, 22. LadA forms a catalytic complex with flavin mononucleotide (FMN) that utilizes atomic oxygen for oxidation. This results in the conversion of alkanes into the corresponding primary alkanol. The alcohols are further oxidized by alcohol and aldehyde dehydrogenases to fatty acids, which readily enter the β-oxidation pathway 7, 21. A zinc-independent alcohol dehydrogenase from the thermophillic bacterium Geobacillus thermoleovorans B23 oxidizes medium-chain alkanols into their respective alkanals, using NAD+ as a cofactor 10. Aldehyde dehydrogenase from the same bacterium is able to catalyze the NAD+-dependent final step in the medium-chain oxidation 11.
In order to reduce induction costs and to maintain optimal proliferation of the bacterial system, the promoter pCaiF from E.coli was characterized. This promoter can regulate expression of the hydrocarbon degradation pathway components, and is regulated by cAMP-Crp levels, which in turn depend on glucose levels 6. At high extracellular glucose concentrations in the environment the cellular cAMP (cyclic Adenosine Mononucleotide Phosphate) level was low through the inhibition of adenylyl cyclase as a side effect of PTS mediated glucose transport. Conversely, during limitation (low glucose concentrations) the cAMP level increased and Crp bound to cAMP forming the complex, cAMP-Crp, which bound pCaiF and activated transcription of the downstream components 6, 14.
Wildtype E. coli can only tolerate moderate concentrations of hydrocarbons. To complete the toolkit, tolerance to hydrocarbons had to be addressed. Several organic solvent-tolerant bacteria are known to survive in water-solvent two-phase systems 12. Molecular components known to increase tolerance are chaperones that facilitate the correct folding of proteins. The prefoldin system from Pyrococcus horikoshii OT3, consisting of the proteins phPFDα and phPFDβ, was shown to increase hydrocarbon-tolerance 17.
The alkane conversion toolkit was constructed following the BioBrick principle, which is documented at the Registry of Standard Biological Parts 9. BioBricks are plasmids containing a specific functional insert that is flanked by 4 predefined restriction sites. The BioBrick inserts can be extended flexibly, allowing the construction of biological systems with new functions.
1. BioBrick Assembly
Name | Sequence | Comment |
Prefix | 5′ GAATTCGCGGCCGCTTCTAG3′ | |
5′ GAATTCGCGGCCGCTTCTAGAG 3′ | If the following part is a coding sequence or any part that starts with “ATG” | |
Suffix | 5′ TACTAGTAGCGGCCGCTGCAG 3′ |
2. Alkane Conversion Resting Cell Assay, In Vivo
This assay was performed based on the method described by Fujii et al. (2004).
3. Alkane Conversion Enzyme Assay, In Vitro
This assay was performed essentially according to the method described by Li et al. (2008).
4. Ethyl Acetate Hydrocarbon Extraction and Concentration Measurements
Rate | Temperature [°C] | Time [min] |
0 | 50 | 7.5 |
50 | 90 | 1.0 |
50 | 110 | 2.0 |
50 | 130 | 2.0 |
50 | 145 | 2.0 |
50 | 160 | 2.0 |
50 | 170 | 2.0 |
50 | 185 | 2.0 |
50 | 210 | 2.0 |
50 | 250 | 2.0 |
50 | 320 | 2.0 |
5. Alcohol/aldehyde Dehydrogenase Activity Assay
This assay was performed essentially according to the method described by Kato et al. (2010).
6. pCaiF Characterization
7. Tolerance Assay
8. Homolog Interaction Mapping
Alkane conversion
The activity of the three oxidation steps from the alkane to the respective fatty acid was evaluated using resting cell assays and enzyme activity measurements. The results are presented following the pathway reactions (1) alkane hydroxylase, (2) alcohol dehydrogenase and (3) aldehyde dehydrogenase.
For the first step, different plasmids were constructed for medium and long-chain alkanes. The plasmid BBa_K398014 contains the four genes of the alkane hydroxylase (AH) system for medium chain alkane oxidation: alkB2, rubA3, rubA4 and rubB under the control of a single constitutive promoter (BBa_J23100). As negative control, E. coli K12 with the plasmid BBa_J13002 was used. The activity was measured by an enzyme activity assay using n-octane as short-chain hydrocarbon source. The consumption of alkane, respectively formation of the corresponding alkanol was analyzed using gas chromatography. Based on hydrocarbon consumption, the specific enzymatic activity of the system was determined. For cell extracts from E. coli K12 carrying BBa_K398014 an enzymatic activity of 4.49×10-2 U/mg was obtained (1-octanol production from octane). For the negative control an activity of 0.12×10-2 U/mg was found (Figure 2B).
The ladA gene from Geobacillus thermodenitrificans was synthesized and cloned downstream of the constitutive promoter BBa_J23100 and expressed in E. coli (BBa_K398027). The enzyme activities of cells transformed with recombinant ladA protein or cells containing the vector control were determined in vitro by a resting cell assay using cell extracts and hexadecane as long-chain hydrocarbon substrate. GC-analysis indicated an enzyme activity of 3.33×10-3 U/mg of the E. coli carrying ladA while the activity of the negative control was 0.55×10-3 U/mg (Figure 2B).
The following two oxididation steps were performed using NAD dependent alcohol and aldehylde dehydrogenases (ADH and ALDH genes, BioBricks BBa_K398018, BBa_K398030 respectively). The degradation activity was measured using a resting cell assay with E. coli overexpressing ADH, E. coli overexpressing ALDH and E. coli carrying the vector control (BBa_J13002). For the ADH system, octanol-1 and dodecanol-1 were used as substrates, for the ALDH system octanal and dodecanal. No difference was observed between E. coli transformed with ADH, ALDH plasmids and the control (data not shown). We speculate that the alcohols and aldehydes did not cross the cell membrane in vivo and were therefore not metabolized. The activity of the respective enzyme was also measured in cell extracts (in vitro). Since the alcohol dehydrogenases use NAD as co-factor, the dehydrogenase activity can be determined from the reduction of NAD to NADH 11.
For cell extracts of the E. coli control strain, the activity for dodecanol-1 was measured at 0.58×10-3 U/mg. The recombinant strain, expressing ADH, had an activity of 1.76×10-3 U/mg, which is slightly higher (2-fold) than the wild type activity (Figure 2B). The expression of ALDH increased the dodecanal dehydrogenase activity of E. coli cell extracts 3-fold compared to the control strain, activities of respectively 1.75×10-2 U/mg and 0.52×10-2 U/mg (Figure 2B) were obtained. This suggests that the recombinant strains E. coli carrying ALDH can functionally convert octanal and dodecanal.
Sensing
The aim of the sensing module is to have an optimal use of cellular resources, e.g. only produce the alkane degradation pathway enzymes when required. To characterize and monitor the activity of the pCaiF promoter, GFP was cloned downstream the pCaiF promoter and the fluorescence signal of GFP in time was measured. E. coli cells with pCaiF-GFP and a control construct containing only the promoter were monitored at different glucose concentrations (2 g/l, 5 g/l and 10 g/l) and substrate mixtures containing lauric acid. At lower glucose concentration, the substrate was depleted more rapidly leading to a decreased growth rate, respectively no growth, after about 8 hours. At the same time, an increase in the GFP signal was observed (Figure 3B). Strains grown in high glucose medium did not produce GFP, because nitrogen limitation is reached before carbon limitation (data not shown). These results showed that pCaiF promoter is activated at low glucose levels. The result suggests that the promoter can be used to enable catabolic shifts from glucose to new degradation pathways. To further analyze the pCaiF promoter a mathematical model was derived using the following hypotheses.
Data from several experiments was used to parameterize the model described above (parameter estimation problem). The reproduction of the experimental results is shown in Figure 3. Please note that with the same parameters different experimental conditions (10 g/l glucose, 2g/l glucose, no lauric acid) can be reproduced (Figure 3B). From the model parameters it is concluded that the response of the pCaiF has a ‘sharp’ response especially to the glucose uptake rate, the PTS system activity. Given that the alkane degradation might reduce the cAMP levels, an auto-regulation is obtained. The enzyme is then produced in amounts required to sustain growth, which is also favorable for the purpose of alkane degradation in as much active cells as possible. More simulation results can be found at the following URL:
http://2010.igem.org/Team:TU_Delft#page=Modeling/pcaif-model
Hydrocarbon tolerance
To increase hydrocarbon tolerance, genes from various organisms were cloned into a plasmid and expressed in E. coli. The selection of genes was accompanied by an in silico approach to identify possible unwanted protein-interactions in the host organism. The novel software HIM was applied to search for potential homolog interaction partners of the cloned proteins in the E. coli host. We blasted the solvent tolerance protein, prefoldin from P. horikoshii in HIM (Figure 4A), which resulted in a list of interaction partners (Figure 4B). The proteins depicted in green are E. coli homologs of P. horikoshii proteins that interact with prefoldin (based on interactions described in the STRING database). The proteins depicted in red are interacting proteins in P. horikoshii that do not have a homolog counterpart in E. coli. An interaction with proteins for RNA processing was found in the host and in the target organism, hinting that recombinant prefoldin interacts similarly (Figure 4B).
We constructed a prefoldin BioBrick containing the phPFDα and phPFDβ genes. This solvent tolerance cluster (BBa_K398406) was expressed in E. coli K12. As a control, E. coli expressing BBa_J13002-was used. Experimentally, the prefoldin expressing cells were challenged by growth experiments in the presence of different amounts of n-hexane. The BBa_K398406 BioBrick clearly improved the growth rate under high n-hexane conditions. At 10% n-hexane, the E. coli strain expressing prefoldin showed a 50% growth rate increase compared to the control (Figure 5). Since prefoldin is functional in E. coli, one could argue that this might be a result of interacting with homologue proteins identified in silico, though no proof is available yet (Figure 4B).
Figure 1. The BioBrick assembly method for combining two BioBrick inserts. The donor BioBrick is digested with either EcoRI and SpeI for positioning the donor part downstream of the acceptor part (A) or with XbaI and PstI for positioning the donor part upstream of the acceptor part (B). A third appropriate restriction enzyme is added that cuts the backbone of the donor to improve the success rate of the subsequent ligation reaction. The acceptor BioBrick is digested with either EcoRI and XbaI (A) or SpeI and PstI (B). The BioBrick parts are ligated together forming a BioBrick containing both inserts are again flanked by the 4 standard restriction sites.
Figure 2. A three-step pathway for alkane oxidation was implemented in E. coli. (A) Flow chart of the implemented genes. Four genes (alkB2, rubA3, rubA4 and rubB) of the alkane hydroxylase (AH) system of Gordonia sp. TF6 were used to facilitate the oxidation of the medium chain alkanes to their respective alkanols. The ladA gene from Geobacillus thermodenitrificans was implemented for the conversion of long-chain alkanes. To improve the degradation process for the alcohols or aldehydes, respectively ADH and ALDH genes (alcohol and aldehylde dehydrogenase) were expressed in E. coli. The resulting alkanoic-acids were metabolized via the host’s β-oxidation pathway. (B) Enzyme activities of alkane conversion proteins for medium- and long-chain alkanes. The biotransformation of n-octane was monitored using resting cells assays in E. coli K12 carrying the BBa_K398014 plasmid, the BBa_K398017 plasmid, the BBa_K398018 plasmid, the BBa_K398030 plasmid or control plasmid BBa_J13002. The enzyme activities of ADH and ALDH were tested in cell extracts in vitro by monitoring the reduction of NAD to NADH. Error bars represent the SEM of three independent experiments. Click here to view larger figure.
Figure 3. Mechanism and characterization experiment of the pCaiF promoter. (A) Mechanism of the regulation of the pCaiF promoter by cAMP-Crp levels. When the glucose concentration in the environment is high, cAMP levels are low. During depletion the cAMP level increases and so does the concentration of the complex cAMP-Crp. This complex will bind and activate the pCaiF promoter. (B) The biomass concentration (OD) and the fluorescence signal of E. coli K12 carrying pCaiF-GFP with 2g/l glucose. Click here to view larger figure.
Figure 4. Homolog Interaction Mapping. (A) Schematic view of the HIM application. HIM generates a list of putative interactions of proteins in the host organism. Protein sequences can be entered in HIM and the software searches for the corresponding proteins in the STRING database. The application lists each known interacting protein in the source organism and searches for homologs in the host organism, resulting in a map of putative interactions partners for the cloned gene in the host organism. (B) HIM of the prefoldin protein from P. horikoshii. The proteins depicted in green are E. coli homologs of a P. horikoshii protein that interacts with prefoldin, according to the STRING database. The proteins depicted in red are interacting proteins in P. horikoshii that do not have a homolog in E. coli.
Figure 5. Solvent tolerance. The growth rate (OD600) was measured of E. coli strains with a periodicity of 10 min. E. coli K12 expressing the solvent tolerance cluster (BBa_K398406) was tested by different amounts of n-hexane (0 ,4 ,8, 10%). As a control, E. coli expressing BBa_J13002–ladA was used. Error bars represent the SEM of three independent experiments.
The BioBrick principle is used to construct a chassis for the degradation of alkanes and a proof of principle for the single components of the toolkit was obtained. Several assays are proposed to measure the in vivo and in vitro activity of alkane degrading pathway enzymes. The presented work successfully demonstrates a number of methods that can be used to determine enzyme activities and expression in the host organism E. coli after implementation of suitable BioBricks. Furthermore, it is shown that the BioBrick principle can be used to design an organism that expresses proteins necessary for the degradation of alkanes, provides a regulatory system that produces these enzymes only when necessary and augments the tolerance of the host organism in the presence of hydrocarbons. Once further developed, this chassis could be used for the biological degradation of residual oil, e.g. in oil sands tailing waters, or for the treatment of wastewater from the oil industry.
With regards to the alkane degradation, assays were performed for the characterization of the enzymes involved in the first step of alkane degradation (AH-system and ladA). It was demonstrated that an E. coli strain carrying the AH-system of Gordonia sp. TF6 was able to convert octane in vivo. This finding is in agreement with the results of Fujii et. al. 8, where biotransformation of n-alkanes using E. coli expressing the minimal component genes of the AH-system was achieved. The conversion activity was measured by a comparative study (wildtype vs. mutant) after a given time. For a full characterization, additional studies have to be performed on the activity of the AH-system over time and the kinetics of the system.
For the conversion of long-chain alkanes (C15-C36), the ladA gene from Geobacillus thermodenitrificans was implemented. The enzyme activity was tested in vitro using hexadecane as long-chain hydrocarbon source. This modified E. coli strain showed an increased enzyme activity compared to the control strain, demonstrating the recombinant ladA protein enables the conversion of hexadecane by E. coli. In addition to the property of converting alkanes to alkanols, E. coli strains were developed with an improved degradation process for the alcohols and aldehydes by the implementation of ADH and ALDH genes respectively. The enzyme activity in cell extracts was tested in vitro by measuring the production of NADH from NAD+. The E. coli strain expressing ADH showed a two-fold increase in alcohol dehydrogenase activity compared to the wild type activity. Compared to the control strain, the expression of ALDH protein increased the dodecanal dehydrogenase activity in E. coli cell extracts three-fold. Since these assays clearly demonstrated increased enzyme activity in vitro, it can be speculated that the transformed E. coli strains have elevated levels of activity in vivo as well.
To explore the possibility of host-induced expression (for instance: non-dependence on induction chemicals and low burden during growth), the degradation pathway was expressed under the control of the pCaiF promoter. This promoter activates gene expression when glucose levels are low, e.g. at the end of a batch growth phase. As a proof of principle, this promoter was tested via the production of GFP under difference glucose regimes. It was demonstrated that the pCaiF-GFP transformed E. coli produced more GFP during stationary (glucose-limited) phase than in the exponential phase (high glucose levels). In the presence of a secondary carbon source (e.g. lauric acid), the GFP production rate decreased again due to the catabolism of the secondary carbon-source.
The experiment showed that this promoter can be effectively used to enable catabolic shifts from glucose to new degradation pathways. This enables to rapidly grow a vast amount of organisms in rich medium before the degradation pathway is activated. We propose to use the pCaiF promoter upstream the AlkS transcriptional regulator. In Pseudomonas putida, AlkS recognizes C5-C10 n-alkanes as effectors. Subsequently high levels of AlkS-alkane complex activate the PalkB promoter resulting in the expression of the alkBFGHJKL operon encoding proteins involved in the conversion of n-alkanes to fatty acids 19.
Sensing and conversion of hydrocarbons is not enough for the cell to be viable. At increasing hydrocarbon levels in the environment, the growth of wild type E. coli is inhibited through the presence of hydrocarbons in the membrane and in the cell, which can cause protein misfolding. P. horikoshii prefoldin is a chaperone aiding the correct folding of protein in the presence of alkanes 17. Using HIM, it was predicted that this protein interacts with homolog E. coli chaperone proteins, suggesting that overexpression of prefoldin in E. coli could improve solvent tolerance. With the BioBrick BBa_K398406 (consisting of phPFDα and phPFDβ genes), the survivability of E. coli in the presence of alkanes was improved up to 50%. HIM is a suitable tool to select potential functional homologs.
Considering the toolbox as a whole, it can be concluded that it provides a first step in the construction of a chassis for bioremediation of hydrocarbons in aqueous environments. This represents a small, autonomous, self-replicating and relatively inexpensive method. The results were mainly acquired through enzyme assays and shake flash cultures and thus need to be validated on a larger scale. Further research on this system should focus on the coupling of the different enzymes, which have been shown here to work individually in order to generate the envisioned system for hydrocarbon degradation. Furthermore, addition of alternative pathways for the degradation of other pollutants could as well expand the use of this chassis beyond the bioremediation of hydrocarbons alone to a broader scope of pollutants, and possibly the implementation of product pathways could even utilize this system for the production of valuable chemicals. Our results emphasize the suitability of the BioBricks assembly strategy in synthetic biology to construct new organisms that can deal with oil pollution, and may additionally be useful to develop a wide variety of other applications.
The authors have nothing to disclose.
The experiments performed in this video-article were developed for the international Genetically Engineered Machine competition 9.The authors would like to thank iGEM team members Luke Bergwerff, Pieter T.M. van Boheemen, Jelmer Cnossen, Hugo F. Cueto Rojas and Ramon van der Valk for the assistance in the research. We thank Han de Winde, Stefan de Kok and Esengül Yıldırım for helpful discussions and hosting this research. This work was supported by the TU Delft University Department of Biotechnology, The Delft Bioinformatics lab, TU Delft Department of Bionanoscience, Oil Sands Leadership Initiative (OSLI), StuD studentenuitzendbureau, Netherlands Genomics Initiative, Kluyver Centre, Nederlandse Biotechnologische Vereniging (Stichting Biotechnology Nederland), DSM, Geneart, Greiner bio-one and Genencor.
Name of the reagent | Company | Catalogue number | Comments (optional) |
E. coli K12 | New England Biolabs | C2523H | |
Octane | Fluka | 74822 | |
Hexadecane | Fluka | 52209 | |
octanol-1 | Fluka | 95446 | |
dodecanol-1 | Sigma-Aldrich | 126799 | |
Hexane | Sigma-Aldrich | 296090 | |
NADH | Sigma | N4505 | |
FMN | Sigma | F2253 | |
MgSO4 | J.T. Baker Casno | 7487 889 | |
Triton X-100 | Sigma-Aldrich | T8787 | |
T4 ligase | New England Biolabs | M0202L | |
Gas chromatograph | |||
Cell disrupter | LA Biosystems | CD-019 | |
Spectrophotometer | Amersham pharmacia | spec 2000 | |
Plate reader | Tecan | Magellan v7.0 | |
Incubator | Innova, 44 | ||
BioBrick K398014: BBa_J23100-BBa_J61100-alkB2-BBa_J61100-rubA3-BBa_J61100-rubA4– BBa_J61100-rubB |
Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts | BBa_K398014 | Alkane Hydroxylase System Resistance: Chloramphenicol |
BioBrick K398027: BBa_R0040-BBa_B0034-ladA | Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts | BBa_K398027 | ladA Protein Generator Resistance: Chloramphenicol |
BioBrick K398018: BBa_J23100-BBa_J61101-ADH | Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts | BBa_K398018 | ADH generator Resistance: Chloramphenicol |
BioBrick K398030: BBa_R0040-BBa_B0034-ALDH | Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts | BBa_K398030 | ALDH generator Resistance: Chloramphenicol |
BioBrick K398326: pCaiF | Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts | BBa_K398326 | pCaiF promoter Resistance: Chloramphenicol |
BioBrick K398331: pCaiF-BBa_B0032-BBa_I13401 | Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts | BBa_K398331 | pCaiF measurement device Resistance: Chloramphenicol |
BioBrick K398406: BBa_J23002-BBa_J61107-phPFDα-BBa_J61107- | Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts | BBa_K398406 | Solvent tolerance cluster Resistance: Chloramphenicol |