A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments

13.7K views

DOI:

10.3791/4182

October 2nd, 2012

In This Article

Summary

A sustainable auto regulating bacterial system for the remediation of oil pollutions was designed using standard interchangeable DNA parts (BioBricks). An engineered E. coli strain was used to degrade alkanes via β-oxidation in toxic aqueous environments. The respective enzymes from different species showed alkane degradation activity. Additionally, an increased tolerance to n-hexane was achieved by introducing genes from alkane-tolerant bacteria.

Abstract

This work puts forward a toolkit that enables the conversion of alkanes by Escherichia coli and presents a proof of principle of its applicability. The toolkit consists of multiple standard interchangeable parts (BioBricks)9 addressing the conversion of alkanes, regulation of gene expression and survival in toxic hydrocarbon-rich environments.

A three-step pathway for alkane degradation was implemented in E. coli to enable the conversion of medium- and long-chain alkanes to their respective alkanols, alkanals and ultimately alkanoic-acids. The latter were metabolized via the native β-oxidation pathway. To facilitate the oxidation of medium-chain alkanes (C5-C13) and cycloalkanes (C5-C8), four genes (alkB2, rubA3, rubA4and rubB) of the alkane hydroxylase system from Gordonia sp. TF68,21 were transformed into E. coli. For the conversion of long-chain alkanes (C15-C36), theladA gene from Geobacillus thermodenitrificans was implemented. For the required further steps of the degradation process, ADH and ALDH (originating from G. thermodenitrificans) were introduced10,11. The activity was measured by resting cell assays. For each oxidative step, enzyme activity was observed.

To optimize the process efficiency, the expression was only induced under low glucose conditions: a substrate-regulated promoter, pCaiF, was used. pCaiF is present in E. coli K12 and regulates the expression of the genes involved in the degradation of non-glucose carbon sources.

The last part of the toolkit - targeting survival - was implemented using solvent tolerance genes, PhPFDα and β, both from Pyrococcus horikoshii OT3. Organic solvents can induce cell stress and decreased survivability by negatively affecting protein folding. As chaperones, PhPFDα and β improve the protein folding process e.g. under the presence of alkanes. The expression of these genes led to an improved hydrocarbon tolerance shown by an increased growth rate (up to 50%) in the presences of 10% n-hexane in the culture medium were observed.

Summarizing, the results indicate that the toolkit enables E. coli to convert and tolerate hydrocarbons in aqueous environments. As such, it represents an initial step towards a sustainable solution for oil-remediation using a synthetic biology approach.

Introduction

Oil pollution is among the most serious causes of environmental contamination, and greatly affects ecosystems, businesses and communities 3. Solutions are for example required to battle the continuous oil pollution originating from the oil sands tailing waters in Alberta, Canada. During the process of oil extraction from oil sands, bitumen, a semi-solid oxidized form of oil, is removed using thermal recovery techniques that consume about 3.1 barrels of water per single barrel of oil 1. Oil contaminated process water, mainly originating from a local river, is stored in tailing ponds after bitumen extraction. A more effective recycling of process water in order to reduce the need for freshwater uptake is needed. To facilitate the bitumen extraction and to ensure that downstream sites meet water quality guidelines for the protection of aquatic ecosystems, process water treatments are rapidly evolving 3.

To treat pollution of organic compounds, bioremediation technologies employing microorganisms are presently encouraged 1. Alkanes are the most abundant family of hydrocarbons in crude oil, containing 5 to 40 carbon atoms per molecule 7, 21. Many bacteria are known to degrade alkanes of various lengths via sequential oxidation of the terminal methyl group forming first alcohols, then aldehydes and finally fatty acids 8. Within this iGEM project several enzymes from different organisms were expressed and characterized, and made available via the BioBrick standard and Registry of Standard Biological Parts.

The well-studied alkane hydroxylase system of Gordonia sp. TF6 facilitates the initial oxidation step of C5-C13 alkanes along with that of C5-C8 cycloalkanes using a minimum of four components: alkB2 (alkane 1-monooxygenase), rubA3, rubA4 (two rubredoxins) and RubB (rubredoxin reductase) 8, 21. Oxidation of long-chain alkanes (ranging from C15 up to C36) is reported to be performed by ladA, a flavoprotein alkane monooxygenase from Geobacillus thermodinitrificans NG-80-2 7, 15, 18, 22. LadA forms a catalytic complex with flavin mononucleotide (FMN) that utilizes atomic oxygen for oxidation. This results in the conversion of alkanes into the corresponding primary alkanol. The alcohols are further oxidized by alcohol and aldehyde dehydrogenases to fatty acids, which readily enter the β-oxidation pathway 7, 21. A zinc-independent alcohol dehydrogenase from the thermophillic bacterium Geobacillus thermoleovorans B23 oxidizes medium-chain alkanols into their respective alkanals, using NAD+ as a cofactor 10. Aldehyde dehydrogenase from the same bacterium is able to catalyze the NAD+-dependent final step in the medium-chain oxidation 11.

In order to reduce induction costs and to maintain optimal proliferation of the bacterial system, the promoter pCaiF from E.coli was characterized. This promoter can regulate expression of the hydrocarbon degradation pathway components, and is regulated by cAMP-Crp levels, which in turn depend on glucose levels 6. At high extracellular glucose concentrations in the environment the cellular cAMP (cyclic Adenosine Mononucleotide Phosphate) level was low through the inhibition of adenylyl cyclase as a side effect of PTS mediated glucose transport. Conversely, during limitation (low glucose concentrations) the cAMP level increased and Crp bound to cAMP forming the complex, cAMP-Crp, which bound pCaiF and activated transcription of the downstream components 6, 14.

Wildtype E. coli can only tolerate moderate concentrations of hydrocarbons. To complete the toolkit, tolerance to hydrocarbons had to be addressed. Several organic solvent-tolerant bacteria are known to survive in water-solvent two-phase systems 12. Molecular components known to increase tolerance are chaperones that facilitate the correct folding of proteins. The prefoldin system from Pyrococcus horikoshii OT3, consisting of the proteins phPFDα and phPFDβ, was shown to increase hydrocarbon-tolerance 17.

The alkane conversion toolkit was constructed following the BioBrick principle, which is documented at the Registry of Standard Biological Parts 9. BioBricks are plasmids containing a specific functional insert that is flanked by 4 predefined restriction sites. The BioBrick inserts can be extended flexibly, allowing the construction of biological systems with new functions.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. BioBrick Assembly

  1. BioBricks from the Registry of Standard Biological parts are provided by iGEM headquarters. To construct a new BioBrick from existing BioBricks, digest the donor BioBrick (up to 1.0 μg) with the enzymes EcoRI and SpeI for positioning the donor part downstream of the acceptor part. Digest with XbaI and PstI for positioning the donor part upstream of the acceptor part. Add a third appropriate restriction enzyme that cuts in the backbone of the donor. Perform the digestions in a total volume of 20-25 ml with the appropriate buffer, according to the supplier (final concentration 1x). Use 5 units/μg DNA for the restriction enzymes.
  2. Digest the acceptor BioBrick with either EcoRI and XbaI or SpeI and PstI.
  3. Incubate the digestions for (at least) one hr at 37 °C. Inactivate the restriction endonucleases by heat, incubation at 80 °C for 10 min and centrifuge shortly.
  4. Ligate the digested BioBrick parts (donor and acceptor) together. Since XbaI and SpeI generate compatible DNA ends, a mixed site is created that cannot be cut with any restriction enzyme resulting in a new 'combined' BioBrick that flanked by the 4 standard restriction sites. In the ligation mixture the final DNA concentration is preferably ~100 ng/μl. Perform the ligation reaction in a total volume of 10-15 ml with the T4 ligation buffer (final concentration 1x) and T4 ligase (1 unit/μg DNA).
  5. Incubate the ligation mixture at 16 °C for at least 3 hr.
  6. Perform transformation reaction with circa half of the ligation mix.
  7. Confirm the BioBrick to be correct with sequencing.
  8. To construct a new BioBrick from synthesized DNA, modify the genes for synthesis for optimal expression in E. coli by means of the JCat website tool (http://www.jcat.de/). Make further modifications in accordance with the requirements of the BioBrick standard. This standardization implies that every BioBrick is composed of a DNA sequence of interest preceded by a prefix and followed by a suffix. The prefix and suffix are sequences that contain predefined restriction sites, that are absent in the remaining plasmid sequence. These standard restriction sites make it possible to interchange and extend the BioBrick inserts flexibly 9. The prefix and suffix have the following sequences:
NameSequenceComment
Prefix5' GAATTCGCGGCCGCTTCTAG3' 
 5' GAATTCGCGGCCGCTTCTAGAG 3'If the following part is a coding sequence or any part that starts with "ATG"
Suffix5' TACTAGTAGCGGCCGCTGCAG 3' 

2. Alkane Conversion Resting Cell Assay, In Vivo

This assay was performed based on the method described by Fujii et al. (2004).

  1. Culture E. coli cells expressing the Alkane Hydroxylase system (BBa_K398014) and cells carrying an empty vector (BBa_J13002) in 5 ml LB medium with appropriate antibiotics overnight.
  2. Transfer 500 μl of the overnight culture into 50 ml of fresh LB (with antibiotic) and incubate until the cell turbidity reached an OD (optical density) of 0.3 at 600 nm.
  3. Centrifuge for 10 min at 4,000 rpm and resuspend the pellet in 5 ml 0.1 M phosphate buffer (pH 7.4).
  4. Centrifuge again for 10 min at 4,000 rpm and resuspend the pellet in 5 ml 0.1 M phosphate buffer now containing E2 salts and 0.66% v/v glycerol (nitrogen-deficient medium).
  5. Measure the cell turbidity (OD600).
  6. Prepare cell-mixture aliquots of 6 ml in 25 ml closed-cap glass flasks and no-cell controls (E2 salts + 0.66% v/v glycerol).
  7. Add 100 nmol of alkane to each flask.
  8. Incubate the mixtures at 37 °C for 24 hr (shorten when higher rates are obtained).
  9. Measure the OD600 after incubation.
  10. Extract the hydrocarbons in the culture media by ethyl acetate and determine hydrocarbon concentration in cell culture by gas chromatography (see protocol 3).
  11. Calculate the degradation per unit of biomass by dividing the total amount of alkane converted by the total biomass present in each flask (convert OD600 to dry weight). Dividing the result by the experimental duration yields the degradation activity per unit biomass per time unit. The average is taken from three individual runs.

3. Alkane Conversion Enzyme Assay, In Vitro

This assay was performed essentially according to the method described by Li et al. (2008).

  1. Culture E. coli cells expressing the ladA gene (BBa_K398017) and cells carrying an empty vector (BBa_J13002) in 50 ml LB medium with appropriate antibiotics overnight.
  2. Transfer 500 μl of the overnight culture into 50 ml of fresh LB (with antibiotic) and incubate until the cell turbidity reached an optical density of 0.6 at 600 nm.
  3. Centrifuge 10 min at 4,000 rpm (4 °C) and resuspend the pellet in 5 ml of 50 mM Tris buffer.
  4. Sonicate (Cell disrupter, LA Biosystems) the cells at 40% duty cycle with an output control of 4, keep the solution on ice for the entire duration.
  5. Centrifuge the resulting mixture for 5 min at 4,000 rpm at 4 °C to remove the cell debris. Transfer the supernatant to a fresh vial.
  6. Determine the total protein concentration of the cell extracts by Bradford assay. Note: Use glass vials to prevent the increase of background and/or loss of protein.
  7. Prepare a 100 ml mixture containing 0.1% v/v alkane and 50 mM Tris-HCl buffer.
  8. Heat the mixture at 100 °C for 5 min. Note: Perform this step only for medium-long chain alkanes with high boiling point. (e.g. C16: 287 °C).
  9. To achieve an optimal solubility of the alkane, sonicate for 1 min while still warm until a homogenous, viscous mixture is obtained.
  10. Add 1mM of NADH, 1 mM FMN, 1 mM MgSO4 and 0.01 v/v Triton X-100.
  11. Prepare 6 ml aliquots in 25 ml closed-cap flasks.
  12. Add adequate amounts of cell extract (depends on Bradford assays, final concentration of 5 mg protein/l). Prepare a no-protein control.
  13. Incubate at 60 °C (for optimal enzymatic activity) for 24 hr.
  14. Extract the hydrocarbons in the culture media by ethyl acetate and determine hydrocarbon concentration in cell culture by gas chromatography (see protocol 3).
  15. Calculate the degradation per unit of biomass by dividing the total amount of alkane converted by total protein added to each flask (by Bradford calibration curve). Further dividing by experiment duration yields the degradation activity per unit of cellular protein per time unit. The average is taken from three individual runs.

4. Ethyl Acetate Hydrocarbon Extraction and Concentration Measurements

  1. Alkanes are extracted from the aqueous solution by adding 2.5 ml ethyl acetate (apolar solvant) to 6 ml experimental solution. An internal standard is added to the solvent at a concentration of 0.1 % (v/v). The standard (e.g. cyclo-decan) varied depending on the expected range of the peaks of interest.
  2. Optional: Add Triton X-100 to the aqueous mixture and centrifuge the samples for 10 min at 4,000 rpm in order to get a proper bi-phasic system.
  3. Vortex the mixture for 5 sec (1,500 rpm) and incubate at room temperature until the two phases separate.
  4. Remove a maximal amount of the organic layer (top) and dry the solvent using anhydrous magnesium sulphate.
  5. Remove MgSO4 by filtration (0.2 μm) and transfer the filtrate into gas chromatograph vials for measurements, or store at -20 °C.
  6. Determine the concentration by gas chromatography using a CP-SIL 5CB column (length = 5 m). Inject 10 μl of sample in split mode (1:10, 230 °C). Set the column gas flow to 1 ml/min (Helium). The following oven temperature program is used:
    RateTemperature [°C]Time [min]
    0507.5
    50901.0
    501102.0
    501302.0
    501452.0
    501602.0
    501702.0
    501852.0
    502102.0
    502502.0
    503202.0
  7. Integrate peaks and correct the concentrations with respect to the internal standard.

5. Alcohol/aldehyde Dehydrogenase Activity Assay

This assay was performed essentially according to the method described by Kato et al. (2010).

  1. Culture E. coli cells expressing the ADH (BBa_K398018) or ALDH (BBa_K398030) gene and cells carrying an empty vector (BBa_J13002) in 50 ml LB medium with appropriate antibiotics overnight.
  2. Transfer 500 μl of the overnight culture into 50 ml of fresh LB (with antibiotic) and incubate until the cell turbidity reached an optical density of 0.6 at 600 nm.
  3. Centrifuge 10 min at 4,000 rpm at 4 °C and resuspend the pellet in 5 ml of 50 mM Tris buffer.
  4. Sonicate the cell solution at 40% duty cycle with an output control of 4 (keep the solution on ice during the sonication).
  5. Centrifuge the resulting mixture for 5 min at 4,000 rpm at 4 °C to remove cell debris.
  6. Determine the total protein concentration of the cell extracts by Bradford assay (Note: use a glass vial to prevent protein binding).
  7. Load a 96 well plate with 180 μl 57 mM glycine buffer containing NAD (final concentration 1 mM, pH 9.5) in each well.
  8. Add 5 μl of the alcohol (aldehyde) to be tested to the wells. Note: Heat long chain alcohols before the start of the assay to have a liquid. For each alcohol (aldehyde) a control without substrate should be added (negative control). In addition, prepare a blank containing a mixture of buffer and the substrate without cell extract.
  9. Preheat the plate of the plate reader (Tecan Magellan v7.0) for 15 min at 37 °C to allow equilibration of the system.
  10. Add adequate amounts of cell extract (depends on Bradford assays, final concentration of 5 mg protein/l). Prepare a no-protein control.
  11. Measure the NADH production using a spectrophotometer at a wavelength of 340 nm every 2-3 min for 1 hr at 37 °C.
  12. Calculate the NADH production rate from the slope of the OD (340 nm). Take into account the light path length and the extinction coefficient of NADH of 6220 M-1cm-1. Divide the NADH production rate by the total amount of protein added to express the activity of the dehydrogenase reaction in the cell extract (U/mg whole cell protein). Calculate the mean and the standard deviation from three independent runs.

6. pCaiF Characterization

  1. Culture E. coli cells expressing the pCaiF-GFP construct (BBa_K398331) and cells carrying the promoter alone (BBa_K398326) overnight in 5 ml LB medium the appropriate antibiotics overnight.
  2. Inoculate 5 ml M9 containing 10 g/l glucose and antibiotics with 50 μl of the overnight culture and grow overnight.
  3. Subculture 50 μl of the overnight outgrowth into 5 ml of fresh M9 with10 g/l and incubate until the cell turbidity reached an optical density of 0.2 at 600 nm.
  4. Load a 96 well plate with 100 μl of fresh M9 medium containing the desired amount of carbon source for testing in each well. Perform triplicate experiments for statistical evaluation and add the respective negative controls (wild-type E. coli K12).
  5. Add 5 μl of the overnight culture to the medium containing wells.
  6. Measure the growth curve (OD600) and GFP fluorescence (485 nm excitation and 520 emission) using a plate reader every 10 min for 18 hr at 37 °C with constant shaking.
  7. Calculate the growth rate and the specific GFP content from the respective measurements and compare to the control. Calculate the mean and the standard deviation of at least three independent experiments.

7. Tolerance Assay

  1. Culture E. coli expressing PhPFDα and β gene (BBa_K398406) overnight in 5 ml LB medium and the appropriate antibiotics. E. coli expressing ladA gene (BBa_K398017) is used as negative control.
  2. Subculture 10 μl of the overnight outgrowth into fresh 5 ml of LB (with antibiotic) and incubate until the cell turbidity reached an optical density of 0.3 to 0.4 at 600 nm.
  3. Dilute the cultures with fresh medium until an OD600 of 0.1 is reached.
  4. Load a 96 well plate with 180 μl M9 medium containing the appropriate antibiotics and the proper final concentration of the toxic compound (e.g. 0, 4, 8, 10% of n-hexane) in triplicate. Because alkane-water mixtures could lead to two-phase systems it is essential to have appropriate controls on the plate (e.g. different strains and the respective blank experiments).
  5. Add 20 μl of the culture (control) into the wells.
  6. Measure the biomass concentration (OD600) using a plate reader every 10 min for 24 hr at 37 °C with constant shaking.
  7. Calculate the growth rates from the respective measurements for the different agent concentrations and compare to the negative control. Calculate the mean and the standard deviation of at least three independent runs.

8. Homolog Interaction Mapping

  1. The application HIM was developed to perform protein queries on a PostgreSQL server running the STRING database (free for academic use) 20. The homologue interaction mapping application identifies interacting proteins in the original host organism using the STRING database. The sequences of the respective interacting genes are used in a BLAST search to find homologous genes in the target organism. Cytoscape 4 is used to visualize the result of the mapping. The HIM software tool can be downloaded at: https://github.com/jcnossen/InteractionHomologMapping.
  2. To perform a mapping, (1) enter the BioBrick ID and the application will automatically download the part sequence data from the Registry of Standard Biological Parts 9, or (2) enter (paste) the sequence data in the application.
  3. Use the STRING Database website to find the STRING protein ID for the entered amino acid sequence.
  4. A protein with high homology is determined using BLAST. Subsequently the application lists each known interacting protein in the source organism and searches for homologs in the host organism (e.g. E. coli).
  5. Export resulting putative interaction list to text or Cytoscape.

Access restricted. Please log in or start a trial to view this content.

Results

Alkane conversion

The activity of the three oxidation steps from the alkane to the respective fatty acid was evaluated using resting cell assays and enzyme activity measurements. The results are presented following the pathway reactions (1) alkane hydroxylase, (2) alcohol dehydrogenase and (3) aldehyde dehydrogenase.
For the first step, different plasmids were constructed for medium and long-chain alkanes. The plasmid BBa_K3...

Access restricted. Please log in or start a trial to view this content.

Discussion

The BioBrick principle is used to construct a chassis for the degradation of alkanes and a proof of principle for the single components of the toolkit was obtained. Several assays are proposed to measure the in vivo and in vitro activity of alkane degrading pathway enzymes. The presented work successfully demonstrates a number of methods that can be used to determine enzyme activities and expression in the host organism E. coli after implementation of suitable BioBricks. Furthermore, it is show...

Access restricted. Please log in or start a trial to view this content.

Disclosures

No conflicts of interest declared.

Acknowledgements

The experiments performed in this video-article were developed for the international Genetically Engineered Machine competition 9.The authors would like to thank iGEM team members Luke Bergwerff, Pieter T.M. van Boheemen, Jelmer Cnossen, Hugo F. Cueto Rojas and Ramon van der Valk for the assistance in the research. We thank Han de Winde, Stefan de Kok and Esengül Yıldırım for helpful discussions and hosting this research. This work was supported by the TU Delft University Department of Biotechnology, The Delft Bioinformatics lab, TU Delft Department of Bionanoscience, Oil Sands Leadership Initiative (OSLI), StuD studentenuitzendbureau, Netherlands Genomics Initiative, Kluyver Centre, Nederlandse Biotechnologische Vereniging (Stichting Biotechnology Nederland), DSM, Geneart, Greiner bio-one and Genencor.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
E. coli K12New England BiolabsC2523H
OctaneFluka74822
HexadecaneFluka52209
octanol-1Fluka95446
dodecanol-1Sigma-Aldrich126799
HexaneSigma-Aldrich296090
NADHSigma-AldrichN4505
FMNSigma-AldrichF2253
MgSO4J.T. Baker Casno7487 889
Triton X-100Sigma-AldrichT8787
T4 ligaseNew England BiolabsM0202L
Gas chromatograph
Cell disrupterLA BiosystemsCD-019
SpectrophotometerAmersham pharmaciaspec 2000
Plate readerTecan Group Ltd.Magellan v7.0
Incubator Innova, 44
BioBrickTM K398014: BBa_J23100-BBa_J61100-alkB2-BBa_J61100-rubA3-BBa_J61100-rubA4- BBa_J61100-rubBDelft University of Technology at the department of Biotechnology or Registry of Standard Biological PartsBBa_K398014Alkane Hydroxylase System
Resistance: Chloramphenicol
BioBrickTM K398027: BBa_R0040-BBa_B0034-ladA Delft University of Technology at the department of Biotechnology or Registry of Standard Biological PartsBBa_K398027ladA Protein Generator
Resistance: Chloramphenicol
BioBrickTM K398018: BBa_J23100-BBa_J61101-ADH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological PartsBBa_K398018ADH generator
Resistance: Chloramphenicol
BioBrickTM K398030: BBa_R0040-BBa_B0034-ALDH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological PartsBBa_K398030ALDH generator
Resistance: Chloramphenicol
BioBrickTM K398326: pCaiF Delft University of Technology at the department of Biotechnology or Registry of Standard Biological PartsBBa_K398326pCaiF promoter
Resistance: Chloramphenicol
BioBrickTM K398331: pCaiF-BBa_B0032-BBa_I13401Delft University of Technology at the department of Biotechnology or Registry of Standard Biological PartsBBa_K398331pCaiF measurement device
Resistance: Chloramphenicol
BioBrickTM K398406: BBa_J23002-BBa_J61107-phPFDα-BBa_J61107- Delft University of Technology at the department of Biotechnology or Registry of Standard Biological PartsBBa_K398406Solvent tolerance cluster
Resistance: Chloramphenicol

References

  1. Allen, E. W. Process water treatment in Canada's oil sands industry: I: Target pollutants and treatment objectives. J. Environ. Eng. Sci. 7, 123-138 (2008).
  2. Alon, U. An Introduction to Systems Biology: Design Principles of Biological Circuits. , CRC Press. (2007).
  3. Center, O. P. Understanding Oil Spills and Oil Spill Response. , (1999).
  4. Cytoscape. An Open Source Platform for Complex Network Analysis and Visualization [Internet]. , Available from: http://www.cytoscape.org (2012).
  5. Non-Invasive Biomass Monitor with Wide Linear Range [Internet]. , Available from: http://www.buglab.com/docs/OnLineODMeasurement.pdf (2012).
  6. Eichler, K., Buchet, A., Lemke, R., Kleber, H. P., Mandrand-Berthelot, M. A. Identification and characterization of the caiF gene encoding a potential transcriptional activator of carnitine metabolism in Escherichia coli. J. Bacteriol. 178, 1248-1257 (1995).
  7. Feng, L., Wang, W., Cheng, J., Ren, Y., Zhao, G., Gao, C., Tang, Y., Liu, X., Han, W., Peng, X., et al. Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir. Proc. Natl. Acad. Sci. U.S.A. 104 (13), 5602-5607 (2007).
  8. Fujii, T., Narikawa, T., Takeda, K., Kato, J. Biotransformation of various alkanes using the Escherichia coli expressing an alkane hydroxylase system from Gordonia sp. TF6. Biosci. Biotechnol. Biochem. 68 (10), 2171-2177 (2004).
  9. iGEM. Registry of Standard Biological Parts [Internet]. , Available from: http://partsregistry.org/Main_Page (2012).
  10. Kato, T., Miyanaga, A., Haruki, M., Imanaka, T., Morikawa, M., Gene Kanaya, S. cloning of an alcohol dehydrogenase from thermophilic alkane-degrading Bacillus thermoleovorans B23. J. Biosci. Bioeng. 91 (1), 100-102 (2001).
  11. Kato, T., Miyanaga, A., Kanaya, S., Morikawa, M. Gene cloning and characterization of an aldehyde dehydrogenase from long-chain alkane-degrading Geobacillus thermoleovorans B23. Extremophiles. 14, 33-39 (2010).
  12. Kieboom, J., De Bont, J. aM. Bacterial Stress Responses. , ASM Press. Washington, D.C. (2000).
  13. Kotte, O., Zaugg, J. B., Heinemann, M. Bacterial adaptation through distributed sensing of metabolic fluxes. Mol Syst Biol. 6, 355(2010).
  14. Kremling, A., Bettenbrock, K., Gilles, E. D. Analysis of global control of Escherichia coli carbohydrate uptake. BMC Syst. Biol. 1, (2007).
  15. Li, L., Liu, X., Yang, W., Xu, F., Wang, W., Feng, L., Bartlam, M., Wang, L., Rao, Z. Crystal structure of long-chain alkane monooxygenase (LadA) in complex with coenzyme FMN: unveiling the long-chain alkane hydroxylase. J. Mol. Biol. 376 (2), 453-465 (2008).
  16. Lin, H. Y., Mathiszik, B., Xu, B., Enfors, S. O., Neubauer, P. Determination of the maximum specific uptake capacities for glucose and oxygen in glucose-limited fed-batch cultivations of Escherichia coli. Biotechnol. Bioeng. 73 (5), 347-357 (2001).
  17. Okochi, M., Kanie, K., Kurimoto, M., Yohda, M., Honda, H. Overexpression of prefoldin from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 endowed Escherichia coli with organic solvent tolerance. Appl. Microbiol. Biotechnol. 79 (3), 443-449 (2008).
  18. Rehm, H. J., Reiff, I. Mechanisms and occurrence of microbial oxidation of long-chain alkanes. Adv. Biochem. Eng. / Biotechnol. 19, 175-215 (1981).
  19. Rojo, F. Degradation of alkanes by bacteria. Environ. Microbiol. 11 (10), 2477-2490 (2009).
  20. STRING 9.0 Known and Predicted Protein-Protein Interactions [Internet]. , Available from: http://string-db.org/newstring_cgi/show_download_page.pl (2012).
  21. Van Beilen, J. B., Panke, S., Lucchini, S., Franchini, A. G., Rothlisberger, M., Witholt, B. Analysis of Pseudomonas putida alkane-degradation gene clusters and flanking insertion sequences: evolution and regulation of the alk genes. Microbiology. 147, 1621-1630 (2001).
  22. Wang, L., Tang, Y., Wang, S., Liu, R. L., Liu, M. Z., Zhang, Y., Liang, F. L., Feng, L. Isolation and characterization of a novel thermophilic Bacillus strain degrading long-chain n-alkanes. Extremophiles. 10 (4), 347-356 (2006).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Alkane DegradationEscherichia coliBioBricks SystemGene Expression RegulationSolvent ToleranceResting Cell AssaysSubstrate Regulated PromoterHydrocarbon ToleranceSynthetic Biology