Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Linear Amplificazione Mediata PCR - Localizzazione di Genetica Elementi e caratterizzazione di Unknown Aggirare DNA

Published: June 25, 2014 doi: 10.3791/51543

Summary

Linear-amplificazione mediata (LAM)-PCR è un metodo sviluppato per identificare le posizioni esatte di integrare vettori virali nel genoma. La tecnica si è evoluta per essere il metodo superiore per studiare la dinamica clonali nei pazienti di terapia genica, biosicurezza delle tecnologie innovative vettore, la diversità delle cellule T, modelli di cellule staminali del cancro, ecc

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Linear-amplificazione mediata PCR (LAM-PCR) permette di identificare e caratterizzare Sconosciuto DNA fiancheggiante adiacente DNA nota di qualsiasi origine. Più specificamente, LAM-PCR è stato sviluppato per localizzare siti di integrazione vettore virale (IS) all'interno del genoma ospite 1,2. Elementi genetici come retrovirus o trasposoni integrando il loro genoma nel genoma dell'ospite in un (semi-) modo casuale 3-6. In molti casi è determinante conoscere esattamente la posizione in cui questi vettori integrati. LAM-PCR ha dimostrato di essere superiore a tecniche alternative come la legatura mediata PCR 7 e le sue varianti o inversa PCR 8. La sensibilità e la robustezza di questo metodo nasce dalla preamplificazione iniziale delle giunzioni vettore genoma e selezione magnetica dei prodotti della PCR amplificati. Come i metodi alternativi citati, LAM-PCR si basa sull'utilizzo di enzimi di restrizione, presentare una deviazione in capacità di recupero IS 9-11. Così,solo un sottoinsieme del repertorio IS (il integrome) può essere rilevata in una reazione. Questa polarizzazione è minimizzato dall'analisi parallela di un dato campione utilizzando combinazioni ottimali di enzimi di restrizione 9. Recentemente, una variante della tecnologia definito non limitativo LAM-PCR (nrLAM-PCR) è stato sviluppato che aggira l'uso di enzimi di restrizione e permette imparziale analisi dell'intero genoma di un campione in una singola reazione 9,12.

In passato, LAM-PCR è stato utilizzato per identificare il retrovirale causale dà luogo alla leucemia in alcuni pazienti in sperimentazioni cliniche di terapia genica 13-15. Da allora, LAM-PCR è stato adattato per identificare IS da altri vettori di integrazione (vettori lentivirali, trasposoni) e anche per identificare i modelli di integrazione delle passivamente integrazione di vettori come vettori adeno-associati (AAV) o vettori lentivirali integrasi-difettoso (IDLV) 16 -21. Applicazioni della LAM-PCR sono molto diffusa: tradizionalely, la tecnica è ampiamente utilizzata per studiare la composizione clonale delle cellule geneticamente modificate in pazienti che hanno subito la terapia genica o per valutare la biosicurezza dei sistemi vettore nuovi disfacendo il loro comportamento integrazione 15,16,22-24. Recentemente, LAM-PCR ha permesso determinare la specificità e l'attività off-target di nucleasi firmati da un IDLV saggio di cattura 25.

Inoltre, LAM-PCR permette di seguire facilmente il destino di una cellula transdotte nel tempo in un organismo. Questo permette di identificare proto-oncogeni e geni oncosoppressori e studiare ematopoiesi o staminali cancerose biologia cellulare 26-28. Ultimo ma non meno importante, LAM-PCR è stato adattato per studiare diversità recettore delle cellule T nell'uomo e 29 (dati non pubblicati).

La potenza intrinseca della tecnologia è rafforzata collegando il metodo di tecnologie di sequenziamento profonde che permettono caratterizzare milioni di Sconosciuto accompagnamento DNA a singolo nucleotide reSolution nei genomi interi. Nel seguente protocollo, si descrive passo per passo l'amplificazione e l'identificazione di accompagnamento DNA sconosciuto esemplare di identificare vettori lentivirali IS. Gli oligonucleotidi utilizzati nel protocollo sono elencati nella Tabella 1. Estratto il DNA o cDNA di qualsiasi sorgente possono essere usati come stampo di DNA per LAM-PCR e nrLAM-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Preparazione dei linker Cassette (LC)

  1. Mescolare 40 ml di LC1 oligonucleotide (Tabella 1), 40 ml di LC2 oligonucleotide (Tabella 1, con l'enzima di restrizione adeguato sbalzo), 110 ml di Tris-HCl (100 mM, pH 7,5), e 10 microlitri 250 mM MgCl 2.
  2. Incubare a 95 ° C per 5 min e lasciare che la reazione raffreddare lentamente a temperatura ambiente. Aggiungere 300 ml H 2 O e concentrare dsLinker-DNA su un filtro centrifugazione. Aggiungere 80 ml ​​H 2 O per l'eluato e aliquote di 10 ml di cassette linker pronti a 0.2 provette per PCR.

2. Preamplificazione del vettore Genoma giunzioni

  1. Per ogni campione da analizzare preparare un 50 microlitri di reazione PCR.
    1. Determinare la concentrazione dei campioni di DNA. Dispensare x ml (1-1,000 ng per LAM/100-1, 000 ng per nrLAM) di DNA in una provetta da 0,2 ml PCR. Volume di DNA deve essere uguale in ciascun campione e nel RNAge da 0,5 a 25 pl.
    2. Preparare PCR master mix, come descritto nella tabella 2 Mix (50 - x). Microlitri della master mix con ciascun campione di DNA in 0,2 ml provette PCR.
  2. Preamplificare vettore giunzioni genomiche utilizzando condizioni di PCR esemplificati nella Tabella 2. Dopo il completamento della PCR aggiungono 0,5 microlitri Taq Polymerase a ciascuna provetta PCR e rieseguire programma PCR. I prodotti di PCR possono essere conservati a 4 ° C per 4 giorni o lungo termine a -20 ° C.

3. Separazione magnetica della PCR prodotto

  1. Preparazione di Magnetic Beads
    1. Pipettare 20 ml (200 mg) di streptavidina rivestite con perline magnetiche in una provetta da 1,5 ml ed esporre per 1 min sul separatore particella magnetica (MPS) a temperatura ambiente. Scartare il surnatante.
    2. Rimuovere il tubo da MPS e risospendere sfere magnetiche in 40 microlitri PSB / 0,1% di BSA (pH 7.5). Esporre a MPS per 1 minuto e scartare il surnatante. Ripetere questa operazione una sola volta.
    3. Wash Perle with 20 ml di soluzione 3 M LiCl (3 M LiCl, 10 mM Tris-HCl, 1 mM EDTA) esporre a MPS per 1 minuto e scartare il surnatante. Risospendere le sfere in 50 ml di soluzione 6 M LiCl (6 M LiCl, 10 mM Tris-HCl, 1 mM EDTA).
  2. Mescolare intero reazione di PCR dal punto 2.2 con 50 ml di sfere magnetiche preparate. Incubare su un agitatore orizzontale (300 rpm) per almeno 2 ore a temperatura ambiente. Questo passaggio consente legame di biotinilato prodotto di PCR di streptavidina perle rivestite (complessi DNA-Bead). DNA complesso tallone può essere incubata nel shaker notte o conservato a 4 ° C per 4 giorni.
  3. Esporre complesso DNA-Bead di MPS per 1 minuto a temperatura ambiente, rimuovere il surnatante e risospendere complesso DNA-Bead in 100 ml H 2 O. Procedere immediatamente con la fase 4 per LAM o il punto 5 per nrLAM.

4. LAM-Procedure

  1. DNA a doppio filamento (dsDNA) Sintesi (solo LAM)
    1. Esporre complesso DNA-Bead dal punto 3.3 a MPS per 1 min e dissurnatante carta. Aggiungere 8.25 ml di H 2 O, 1 ml di buffer 10x hexanucleotide, 0,25 dNTP microlitri (10 mm) e 0,5 microlitri (2 U) Klenow polimerasi. Incubare a 37 ° C per 1 ora.
    2. Aggiungere 90 ml di H 2 O e esporre a MPS per 1 min. Gettare il surnatante e risospendere complesso DNA-Bead in 100 ml H 2 O.
  2. Limitazione Digest
    1. Esporre complesso DNA-Bead di MPS per 1 minuto e scartare il surnatante. Aggiungere 8,5 ml H 2 O, 1 microlitri tampone 10x restrizione enzimatica e 0,5 ml di enzima di restrizione e incubare la reazione per 1 ora. Ripetere passo 4.1.2.
      NOTA: Incubare la reazione alla temperatura raccomandata dal produttore dell'enzima di restrizione. Assicurarsi che non vi è alcun sito di restrizione presenti all'interno oa valle del sito di legame di primer utilizzati per preamplificazione nel DNA di interesse. Per la scelta di opportune combinazioni di enzimi di restrizione / enzimi di restrizione riferimento a 9.
  3. Legatura dei ds Linker (LK)
    1. Esporre complesso DNA-Bead di MPS per 1 minuto e scartare il surnatante. Aggiungere 5 ml H 2 O, 1 ml di buffer 10x FastLink, 1 ml ATP (10 mm), 2 microlitri Linker cassetta dal punto 1.2, e 1 ml veloce-Link DNA Ligase (2 U / mL). Incubare a temperatura ambiente per 5 min. Ripetere passo 4.1.2.
  4. Denaturazione delle sintetizzato dsDNA
    1. Esporre complesso DNA-Bead di MPS per 1 minuto e scartare il surnatante. Complesso Risospendere DNA-Bead in 5 ml di 0,1 N NaOH. Incubare 5 minuti a temperatura ambiente su un agitatore orizzontale camera.
    2. Esporre complesso DNA-Bead di MPS per 1 min e raccogliere preamplificato svincolo vettore genoma contenente surnatante in una nuova provetta da 1,5 ml. Procedere immediatamente con la fase 6 o conservare il surnatante a -20 ° C.

5. NrLAM-Procedure

  1. Legatura di un singolo filamento linker (SSLC) (nrLAM solo)
    1. Esporre complesso DNA-Bead dal punto 3.3 a MPSper 1 min e scartare il surnatante. Aggiungere 6,5 microlitri H 2 O, 1 ml CircLigase 10X Reaction Buffer, 0,5 microlitri MnCl 2 (50 mm), 0,5 microlitri ATP (1 mm), 1 ml ssLinker oligonucleotide e 0,5 microlitri CircLigase (100 U / mL). Incubare a 60 ° C per 1 ora.
    2. Aggiungere 90 ml di H 2 O e esporre a MPS per 1 min. Gettare il surnatante e lavare complesso DNA-Bead in 100 ml H 2 O. Ancora una volta esporre a MPS per 1 min, il surnatante scarti e risospendere complesso DNA-Bead in 10 microlitri H 2 O.

6. Esponenziale Amplificazione I

  1. Per ogni campione da analizzare preparare un 50 microlitri di reazione PCR.
    1. Pipettare 2 Template microlitri di DNA (dal punto 4.4.2 (LAM) o 5.1.2 (nrLAM)) in una provetta da 0,2 ml PCR.
    2. Preparare PCR master mix come descritto nella Tabella 3. Aggiungere 48 ml di master mix per ogni campione dal punto 6.1.1 e amplificare vettoriali genoma giunzioni mediante PCR conditions esemplificati nella Tabella 3. prodotti di PCR possono essere conservati a 4 ° C per 4 giorni o lungo termine a -20 ° C.

7. Separazione magnetica della PCR prodotto

  1. Preparare sfere magnetiche come esemplificato nei passaggi 3.1.1 - 3.1.3. Risospendere le sfere in 20 microlitri (per LAM) o 50 ml (per nrLAM) del 6 soluzione M LiCl (6 M LiCl, 10 mM Tris-HCl, 1 mM EDTA). Mescolare 20 microlitri (LAM) o 50 microlitri (nrLAM) della reazione PCR dal punto 6.1.2 con perline magnetiche preparate (punto 7.1) e incubare su un agitatore orizzontale (300 rpm) per 2 ore a temperatura ambiente. DNA complesso tallone può essere incubata nel shaker notte o conservato a 4 ° C per 4 giorni.
  2. Esporre complesso DNA-Bead di MPS per 1 min, rimuovere il surnatante e risospendere complesso DNA-Bead in 100 ml H 2 O. Esporre complesso DNA-Bead di MPS per 1 minuto e scartare il surnatante.
  3. Risospendere complesso DNA-Bead in 20 microlitri (LAM) o 5 microlitri (nrLAM) 0,1 N NaOH. Incubate per 10 minuti a temperatura ambiente su un agitatore orizzontale camera, esporre a MPS per 1 minuto e raccogliere amplificato DNA contenente surnatante in una nuova provetta da 1,5 ml. Procedere immediatamente con la fase 8.1 o conservare il surnatante a -20 ° C.

8. Esponenziale Amplificazione II

  1. Per ogni campione da analizzare preparare un 50 microlitri di reazione PCR.
    1. Pipettare 2 Template microlitri DNA (dal punto 7.3) in una provetta da 0,2 ml PCR.
    2. Preparare PCR master mix come descritto nella Tabella 4. Aggiungere 48 ml di master mix per ogni campione dal punto 8.1.1 e amplificare vettoriali genoma giunzioni da condizioni di PCR esemplificati nella Tabella 4. Prodotti di PCR possono essere conservati a 4 ° C per un massimo di 4 giorni o lungo termine a -20 ° C.
  2. Per visualizzare (nr) LAM-PCR prodotti, carico 10 microlitri del prodotto di PCR dal punto 8.1.2 su un gel di agarosio al 2%. Se le strisce sono visibili, analizzare 10 ml di prodotto LAM-PCR su gel ad alta risoluzione. ATTENZIONE: Ethidium bromuro è mutageno. Lavorare con molta attenzione e indossare sempre guanti appropriati.

9. Preparazione High-throughput sequencing

  1. Purificazione di (nr) prodotti LAM-PCR
    1. Mescolare 40 microlitri PCR-prodotto dal punto 8.1.2 con 44 ml di temperatura ambiente AMPure XP sfere magnetiche. Incubare 5 min a temperatura ambiente e esporre a MPS per ulteriori 2 min.
    2. Gettare il surnatante e lavare due volte con 200 microlitri 70% EtOH sulle MPS.
    3. Gettare il surnatante e risospendere complesso DNA-Bead in 30 microlitri H 2 O. Incubare 1 min e trasferimento surnatante in fiala 0,2 ml. Determinare la concentrazione di DNA purificato.
  2. Fusionprimer PCR per aggiungere il sequenziamento di adattatori specifici.
    1. Per ogni campione da analizzare preparare un 50 microlitri di reazione PCR.
    2. Pipettare x microlitri (40 ng) di DNA in una provetta da 0,2 ml PCR. Volume di DNA deve essere uguale in ciascun campione e nella gamma da 0,5 a 25 pl.
    3. Preparare PCR master mix, come descritto nella tabella 5 Aggiungi (50 - x). Microlitri di Master Mix per ogni campione dal punto 9.2.2 e di introdurre adattatori Sequencing a (nr) LAM-PCR prodotti da condizioni di PCR esemplificati nella Tabella 5 prodotti di PCR. possono essere conservati a 4 ° C per un massimo di 4 giorni o lungo termine a -20 ° C.
    4. Per visualizzare Fusionprimer-PCR prodotti carico 10 ml di prodotto di PCR a partire dal punto 9.2.3 su un gel di agarosio al 2%. Purificare rimanente prodotto di PCR come descritto ai punti 9.1.1 - 9.1.3. Analizzare 1 ml di prodotto di PCR purificato dal passo 9.4 su un dispositivo per elettroforesi ad alta risoluzione automatizzata quantificare accuratamente concentrazione e frammento dimensioni dei prodotti Fusionprimer-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

LAM-PCR si traduce in amplificazione del vettore genoma giunzioni con una dimensione frammento definito per ogni incrocio. La dimensione dei singoli frammenti di PCR dipende dalla distanza tra la posizione del DNA noto nel genoma e il sito di riconoscimento dell'enzima di restrizione più vicino. Questo permette di visualizzare la diversità delle giunzioni amplificate in campioni analizzati mediante elettroforesi su gel, per es., Se sono presenti sul gel unico singolo (monoclonali), vari (oligoclonali), o più bande (policlonali). I risultati di LAM-PCR sono meglio visti da gel per elettroforesi ad alta risoluzione (Figura 2A), ma possono anche essere visualizzati su gel di agarosio 2% (Figura 2B). nrLAM-PCR si traduce in frammenti di PCR di lunghezza varia per ogni singolo incrocio. Campioni così monoclonali, oligoclonali o policlonali appaiono come uno striscio mediante elettroforesi e non possono essere distinte visivamente. Visualizzando il prodotto nrLAM-PCR su gel di agarosio 2% è sufficiente a determinare sucprocesso del protocollo (Figura 2C). Dopo il sequenziamento del DNA genomico recuperato può essere allineato al rispettivo genoma ospite per identificare le posizioni esatte della posizione del vettore (Figura 3A). Annotazione del genoma permette di analizzare il repertorio è per i diversi servizi specifici vettori, come la preferenza per l'integrazione nel gene codificante regioni (Figura 3B) o vicino a siti di inizio della trascrizione (Figura 3C).

Figura 1
Figura 1. Schema Schema di LAM-PCR e nrLAM-PCR. A) Entrambi i metodi iniziano con un preamplificazione iniziale del vettore giunzioni genoma utilizzando primer biotinilati ibridarsi vicino alla fine della sequenza di DNA nota (la ripetizione terminale lunga qui (LTR) di un vettore retrovirale). Risultati di preamplificazione in biotinilatossDNA di formato differente per giunzioni vettore genoma uguali o differenti. Biotinilato ssDNA viene catturato sulle particelle magnetiche. B) Per LAM PCR, fasi di reazione enzimatiche composti di sintesi dsDNA, digestione di restrizione e ligazione di un DNA linker noto generare prodotti di varie dimensioni con sequenze note su entrambe le estremità del prodotto. A causa di restrizione polimorfismo di lunghezza ogni incrocio amplificato ha una lunghezza caratteristica. Dopo denaturazione del prodotto LAM-PCR è amplificato mediante nested PCR con linker e vettoriale primer specifici. C) Per nrLAM una sequenza linker ssDNA è direttamente ligato al fine sconosciuta della preamplificato ssDNA da A) permettendo amplificazione esponenziale mediante nested PCR con linker e vettore primer specifici. Questa cifra è stata modificata da 2,12. cliccate qui per vedere una versione più grande di questa figura. >

Figura 2
Figura 2. Risultati rappresentativi di LAM-PCR e nrLAM-PCR. A, B) analisi LAM-PCR di DNA isolato da sangue periferico di pazienti trattati con la terapia genica. Il numero di bande sul gel corrisponde al numero di è presente nel campione. Gel ad alta risoluzione (B) sono più adatti per visualizzarne la clonalità dei campioni analizzati al 2% gel di agarosio (A). C) Analisi nrLAM-PCR di vettori lentivirali cloni di cellule singole o cellule trasdotte rinfusa. Indipendentemente dal numero di siti di inserzione amplificati uno striscio è visto sul gel dopo elettroforesi. M, 100 bp scala; MC, monoclonale; OC, oligoclonale; PC, policlonale. Questa cifra è stata modificata da 2,9.

es/ftp_upload/51543/51543fig3highres.jpg "width =" 500 "/>
Figura 3. Esempi rappresentativi per l'IS analisi LAM-PCR e successivo sequenziamento high-throughput. IS distribuzione in due pazienti da gammaretroviral (blu) o lentivirali (verde) sperimentazioni di terapia genica clinica. Dopo il sequenziamento e la mappatura dei prodotti LAM-PCR al rispettivo genoma è possibile valutare ad esempio:.. A) a livello di genoma distribuzione di IS B) Differenza in base alla preferenza per l'inserimento in regioni codificanti del gene tra gammaretroviral e vettori lentivirali e C) preferenza per l'inserimento vicino a siti di inizio della trascrizione. Cliccare qui per vedere una versione più grande di questa figura.

Scopo Nome Sequenza (5'-3 ')
LK-universale LC1 GACCCGGGAGATCTGAATTCAGTGGCACAG
CAGTTAGG
LK-AATT LC2 (AATT) AATTCCTAACTGCTGTGCCACTGAATTCA
GATC
LK-CG LC2 (CG) CGCCTAACTGCTGTGCCACTGAATTCAGATC
LK-TA LC2 (TA) TACCTAACTGCTGTGCCACTGAAATCAGATC
LK-nrLAM-PCR SSLC (P) CCTAACTGCTGTGCCACTGAATTCAGATC
TCCCGGGTddC
Preamplificazione LTR-I (3'-direzione) (B) AGTAGTGTGTGCCCGTCTGT
LTR-I (5'-direzione) (B) TTAGCCAGAGAGCTCCCAGG
Esponenziale l'amplificazione I LTR-II (3'-direzione) (B) GTGTGACTCTGGTAACTAGAG
LTR-II (5'-direzione) (B) GATCTGGTCTAACCAGAGAG
LC-I GACCCGGGAGATCTGAATTC
Amplificazione esponenziale II LTR-III (3'-direzione) GATCCCTCAGACCCTTTTAGTC
LTR-III (5'-direzione) CCCAGTACAAGCAAAAAGCAG
LC-II GATCTGAATTCAGTGGCACAG

Tabella 1. Oligonucleotidi per-LAM e nrLAM-PCR per amplificare lentivirale IS. SSLC è fosforilata al 5'-end (P) e presenta 3 'didesoxycytidin (DDC) per evitare multimerizzazione del SSLC durante legatura. In generale, (nr) primer LAM-PCR dovrebbero consistere di 18-25 nucleotidi e non dovrebbero allineare genoma dell'ospite. Primer per preamplificazione devono essere posizionati il ​​più vicino possibile (≤ 120 bp) al 5 'o 3' del vettore. Due primer aggiuntivi per esponenziale PCR I e II devono essere poste tra il primerutilizzato per preamplificazione e la fine di vettore. Primer per la preamplificazione ed esponenziale PCR ho bisogno di essere 5'-fosforilata (P).

Reagente Volume (ml) Concentrazione Parametri PCR Temperatura Tempo
H2O 43 - x Denaturazione iniziale 95 ° C 5 min
Buffer 5 10 x Denaturazione 95 ° C 45 sec
dNTP 1 10 mM (LAM); 0,5 micron (nrLAM) Ricottura 60 ° C 45 sec 2 x 50 Cicli
LTR-I 0.5 0.17 micron Allungamento 72 ° C 60 sec (LAM); 10 sec (nrLAM)
TaqPolymerase 0.5 2,5 U / mL Finale Allungamento 72 ° C 5 min (solo LAM)

Tabella 2. PCR-Presupposti per la preamplificazione del vettore giunzioni genoma (step 2). Colonne 1-3 mostrano i reagenti PCR utilizzati per l'amplificazione di un campione di DNA singolo. Colonne 4-6 esemplificano il programma PCR per preamplificare vettoriali genoma giunzioni.

Reagente Volume (ml) Concentrazione Parametri PCR Temperatura Tempo
H 2 O 40.5 Denaturazione iniziale 95 ° C 5 min
Buffer 5 10 x Denaturazione 95 ° C 45 sec
dNTP 1 </ Td> 10 mM Ricottura 60 ° C 45 sec 35 Cicli
LTR-II 0.5 16,7 micron Allungamento 72 ° C 60 sec (LAM); 5 sec (nrLAM)
LC-I 0.5 16,7 micron Finale Allungamento 72 ° C 5 min (solo LAM)
Taq polimerasi 0.5 2,5 U / mL

Tabella 3. PCR Condizioni per l'amplificazione esponenziale I (fase 6). Colonne 1-3 mostrano i reagenti PCR utilizzati per l'amplificazione esponenziale di un singolo campione di DNA. Colonne 4-6 esemplificano il programma PCR utilizzato per amplificare esponenzialmente un campione dopo la legatura di sequenza linker.

</ Tbody>
Reagente Volume (ml) Concentrazione Parametri PCR Temperatura Tempo
H 2 O 40.5 Denaturazione iniziale 95 ° C 5 min
Buffer 5 10 x Denaturazione 95 ° C 45 sec
dNTP 1 10 mM Ricottura 60 ° C 45 sec 35 Cicli
LTR-III 0.5 16,7 micron Allungamento 72 ° C 60 sec (LAM); 5 sec (nrLAM)
LC-II 0.5 16,7 micron Finale Allungamento 72 ° C 5 min
Taq polimerasi 0.5 2,5 U / mL

Tabella 4. PCR Condizioni per l'amplificazione esponenziale I (passo 8). Colonne 1-3 mostrano i reagenti PCR nested utilizzati per l'amplificazione esponenziale di un singolo campione. Colonne 4-6 esemplificano il programma di PCR utilizzato per nested amplificazione esponenziale del vettore genoma giunzioni da un campione.

Reagente Volume (ml) Concentrazione Parametri PCR Temperatura Tempo
H 2 O 42.5 - x Denaturazione iniziale 95 ° C 2 min
Buffer 5 10 x Denaturazione 95 ° C 45 sec
dNTP 1 10 mM Ricottura 58 ° C 45 sec 12 Cicli
Fusionprimer A 0.5 10 pM Allungamento 72 ° C 60 sec
Fusionprimer B 0.5 10 pM Finale Allungamento 72 ° C 5 min
Taq polimerasi 0.5 2,5 U / mL

Tabella 5. PCR-Condizioni per Fusionprimer-PCR (punto 9.2). Colonne 1-3 mostrano i reagenti della PCR utilizzati per l'introduzione di adattatori di sequenziamento a (nr) LAM-PCR prodotti. Colonne 4-6 esemplificano il programma PCR utilizzato per Fusionprimer-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

La tecnica LAM-PCR permette di identificare sconosciuti sequenze di DNA che fiancheggiano una regione del DNA noto. A causa della elevata sensibilità risultante dalla preamplificazione delle giunzioni con primers specifici ibridazione nella sequenza di DNA nota, è possibile amplificare e rilevare anche giunzioni rare fino al livello di singola cellula. Contrario, in una situazione policlonale LAM-PCR è in grado di amplificare migliaia di differenti giunzioni in una singola reazione.

Tuttavia, a causa dell'uso di enzimi di restrizione solo subfraction del integrome può essere analizzato da LAM-PCR per la presenza di giunzioni con ogni particolare enzima di restrizione. Pertanto, l'analisi ripetuta dello stesso campione con differenti enzimi è raccomandato 9. Se non ampliconi LAM-PCR sono presenti sul gel, molto probabilmente la distanza tra la posizione del frammento di DNA noto e il sito di riconoscimento più vicino dell'enzima di restrizione scelto è troppo grande per provocare prodotti LAM-PCR9. In questo caso altri enzimi dovrebbero essere usati per amplificare la giunzione.

nrLAM è indipendente l'uso di enzimi di restrizione e rappresenta un metodo di grande valore per caratterizzare globalmente sequenze fiancheggianti una sequenza di DNA nota dunque. Omettendo digestione di restrizione dai risultati di protocollo nella perdita di specifico polimorfismo della lunghezza del frammento di restrizione caratterizzare ogni incrocio amplificato. Invece ogni incrocio amplificato è rappresentato da prodotti di PCR di varie dimensioni con conseguente striscio sul gel dopo elettroforesi, indipendente dalla diversità delle giunzioni amplificate.

Prodotti Sia-LAM e nrLAM-PCR sono perfettamente adatti per valle high-throughput sequencing. High-throughput sequenziamento del (n) i prodotti LAM-PCR e la mappatura delle sequenze crude recuperati alla corrispondente genoma permette di caratterizzare sconosciuto accompagnamento DNA o identificare la localizzazione esatta delle giunzioni vettore-genoma 30.Con l'introduzione di sequenze di codici a barre nei fusionprimers diverse centinaia di prodotti-LAM e nrLAM-PCR possono essere sequenziati in una corsa di sequenziamento 30.

Grazie alla elevata sensibilità, LAM-PCR è incline alla contaminazione se eseguito distrattamente. Così, un ambiente PCR-grade e particolare attenzione a pulire la gestione del protocollo è della massima importanza per amplificare con successo l'ignoto accompagnamento DNA senza contaminare i campioni. Pertanto, non trasdotte compreso DNA genomico e un controllo acqua per ogni reazione PCR come controlli negativi nel protocollo LAM-PCR è fortemente raccomandato. Se i campioni di controllo indicano che la contaminazione incrociata verificato durante il protocollo, i prodotti da ogni punto di pausa possono essere usate per ripetere parti del protocollo. Quando le bande sono ancora presenti, si consiglia di eliminare tutti i reagenti (ad es., Primer, dNTP, polimerasi, ecc) e ripetendo la (nr) Protocollo LAM-PCR con le nuove aliquote.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Taq DNA Polymerase Genaxxon Bioscience GmbH M3001.5000 Alternative Taq Polymerases may be used
PCR Buffer Qiagen 201203 Use of this buffer is recommended
dNTP-Mixture Genaxxon Bioscience GmbH M3015.4020 or any other dNTPs
Oligonucleotides (Primers) MWG Biotech HPLC purified
Dynabeads M-280 Streptavidin  Invitrogen 11206D
PBS Gibco 14190-086 0.1% wt/vol BSA
6 M LiCl Roth 3739.1 10 mM Tris-HCl (pH 7.5)/1 mM EDTA
Tris-HCl, pH 7.5 USB Corporation  22637 or any other supplier
EDTA Applichem A1103,0250 or any other supplier
Klenow Polymerase Roche Diagnostics 10104523001
Hexanucleotide mixture Roche Diagnostics 11277081001
Restriction endonuclease NEB or any other supplier
Fast-Link DNA ligation kit Epicentre Biotechnologies LK11025
CircLigase ssDNA Ligase Kit Epicentre Biotechnologies CL4111K
NaOH Sigma-Aldrich 72068 or any other supplier
Agarose LE Roche Diagnostics 11685660001 or any other supplier
TBE buffer Amresco 0658 or any other supplier
Ethidium bromide Applichem A2273,0005 Ethidium bromide is mutagenic
100 bp DNA Ladder Invitrogen 15628-050 or any other DNA ladder
20 mM NaCl Sigma-Aldrich 71393-1L or any other supplier
Magna-Sep Magnetic Particle Separator  Life Technologies K158501 for use with 1.5 ml Tubes
Magna-Sep Magnetic Particle Separator Life Technologies K158696 for use with 96-well plates
Amicon Ultra-0.5, Ultracel-30 membrane Millipore UFC503096
PerfectBlue Gelsystem Midi S PeqLab 40-1515 or other electrophoresis system 
TProfessional 96 Biometra 050-551 or other Thermocycler for 96-well plates
Orbital shaker KS 260 basic IKA 2980200 or other horizontal shaker
PCR softtubes 0.2 ml Biozym Scientific GmbH 711082 or other 0.2 ml PCR tubes
1.5 ml tubes Eppendorf 12682 or other 1.5 ml tubes
Gel documentation system PeqLab or any other gel documentation system
Nanodrop ND-1000 spectrophotometer Thermo Scientific ND-1000
Spreadex EL1200 precast gel Elchrom Scientific 3497
Submerged gel electrophoresis apparatus SEA 2000  Elchrom Scientific 2001E
2100 Electrophoresis Bioanalyzer Agilent Technologies G2939AA

DOWNLOAD MATERIALS LIST

References

  1. Schmidt, M., et al. Detection and direct genomic sequencing of multiple rare unknown flanking DNA in highly complex samples. Hum Gene Ther. 12, 743-749 (2001).
  2. Schmidt, M., et al. High-resolution insertion-site analysis by linear amplification-mediated PCR (LAM-PCR). Nat Methods. 4, 1051-1057 (2007).
  3. Schroeder, A. R., et al. HIV-1 integration in the human genome favors active genes and local hotspots. Cell. 110, 521-529 (2002).
  4. Wu, X., Li, Y., Crise, B., Burgess, S. M. Transcription start regions in the human genome are favored targets for MLV integration. Science. 300, 1749-1751 (2003).
  5. Vigdal, T. J., Kaufman, C. D., Izsvak, Z., Voytas, D. F., Ivics, Z. Common physical properties of DNA affecting target site selection of sleeping beauty and other Tc1/mariner transposable elements. J Mol Biol. 323, 441-452 (2002).
  6. Lewinski, M. K., et al. Retroviral DNA integration: viral and cellular determinants of target-site selection. PLoS Pathog. 2, (2006).
  7. Mueller, P. R., Wold, B. In vivo footprinting of a muscle specific enhancer by ligation mediated PCR. Science. 246, 780-786 (1989).
  8. Silver, J., Keerikatte, V. Novel use of polymerase chain reaction to amplify cellular DNA adjacent to an integrated provirus. Journal of virology. 63, 1924-1928 (1989).
  9. Gabriel, R., et al. Comprehensive genomic access to vector integration in clinical gene therapy. Nature medicine. 15, 1431-1436 (2009).
  10. Harkey, M. A., et al. Multiarm high-throughput integration site detection: limitations of LAM-PCR technology and optimization for clonal analysis. Stem Cells Dev. 16, 381-392 (2007).
  11. Wang, G. P., et al. DNA bar coding and pyrosequencing to analyze adverse events in therapeutic gene transfer. Nucleic acids research. 36, (2008).
  12. Paruzynski, A., et al. Genome-wide high-throughput integrome analyses by nrLAM-PCR and next-generation sequencing. Nat. Protocols. 5, 1379-1395 (2010).
  13. Hacein-Bey-Abina, S., et al. Insertional oncogenesis in 4 patients after retrovirus-mediated gene therapy of SCID-X1. J Clin Invest. 3132-3142 (2008).
  14. Hacein-Bey-Abina, S., et al. LMO2-associated clonal T cell proliferation in two patients after gene therapy for SCID-X1. Science. 302, 415-419 (2003).
  15. Howe, S. J., et al. Insertional mutagenesis combined with acquired somatic mutations causes leukemogenesis following gene therapy of SCID-X1 patients. J Clin Invest. 118, 3143-3150 (2008).
  16. Cartier, N., et al. Hematopoietic stem cell gene therapy with a lentiviral vector in X-linked adrenoleukodystrophy. Science. 326, 818-823 (2009).
  17. Matrai, J., et al. Hepatocyte-targeted expression by integrase-defective lentiviral vectors induces antigen-specific tolerance in mice with low genotoxic risk. Hepatology. 53, 1696-1707 (2011).
  18. Penaud-Budloo, M., et al. Adeno-associated virus vector genomes persist as episomal chromatin in primate muscle. Journal of virology. 82, 7875-7885 (2008).
  19. Kaeppel, C., et al. A largely random AAV integration profile after LPLD gene therapy. Nature medicine. 19, 889-891 (2013).
  20. Voigt, K., et al. Retargeting sleeping beauty transposon insertions by engineered zinc finger DNA-binding domains. Mol Ther. 20, 1852-1862 (2012).
  21. Yanez-Munoz, R. J., et al. Effective gene therapy with nonintegrating lentiviral vectors. Nature medicine. 12, 348-353 (2006).
  22. Boztug, K., et al. Stem-Cell Gene Therapy for the Wiskott-Aldrich Syndrome. N Engl J Med. 363, 1918-1927 (2010).
  23. Deichmann, A., et al. Vector integration is nonrandom and clustered and influences the fate of lymphopoiesis in SCID-X1 gene therapy. J Clin Invest. 117, 2225-2232 (2007).
  24. Schwarzwaelder, K., et al. Gammaretrovirus-mediated correction of SCID-X1 is associated with skewed vector integration site distribution in vivo. J Clin Invest. 117, 2241-2249 (2007).
  25. Gabriel, R., et al. An unbiased genome-wide analysis of zinc-finger nuclease specificity. Nat Biotechnol. 29, 816-823 (2011).
  26. Dieter, S. M., et al. Distinct types of tumor-initiating cells form human colon cancer tumors and metastases. Cell Stem Cell. 9, 357-365 (2011).
  27. Montini, E., et al. Hematopoietic stem cell gene transfer in a tumor-prone mouse model uncovers low genotoxicity of lentiviral vector integration. Nature biotechnology. 24, 687-696 (2006).
  28. Zavidij, O., et al. Stable long-term blood formation by stem cells in murine steady-state hematopoiesis. Stem Cells. 30, 1961-1970 (2012).
  29. Martins, V. C., et al. Thymus-autonomous T cell development in the absence of progenitor import. J Exp Med. 209, 1409-1417 (2012).
  30. Arens, A., et al. Bioinformatic clonality analysis of next-generation sequencing-derived viral vector integration sites. Hum Gene Ther Methods. 23, 111-118 (2012).
Linear Amplificazione Mediata PCR - Localizzazione di Genetica Elementi e caratterizzazione di Unknown Aggirare DNA
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Gabriel, R., Kutschera, I., Bartholomae, C. C., von Kalle, C., Schmidt, M. Linear Amplification Mediated PCR – Localization of Genetic Elements and Characterization of Unknown Flanking DNA. J. Vis. Exp. (88), e51543, doi:10.3791/51543 (2014).More

Gabriel, R., Kutschera, I., Bartholomae, C. C., von Kalle, C., Schmidt, M. Linear Amplification Mediated PCR – Localization of Genetic Elements and Characterization of Unknown Flanking DNA. J. Vis. Exp. (88), e51543, doi:10.3791/51543 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter