A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

16.7K views

DOI:

10.3791/51797

September 10th, 2014

In This Article

Summary

We present a microfluidic-based electrochemical biochip for DNA hybridization detection. Following ssDNA probe functionalization, the specificity, sensitivity, and detection limit are studied with complementary and non-complementary ssDNA targets. Results illustrate the influence of the DNA hybridization events on the electrochemical system, with a detection limit of 3.8 nM.

Abstract

Miniaturization of analytical benchtop procedures into the micro-scale provides significant advantages in regards to reaction time, cost, and integration of pre-processing steps. Utilizing these devices towards the analysis of DNA hybridization events is important because it offers a technology for real time assessment of biomarkers at the point-of-care for various diseases. However, when the device footprint decreases the dominance of various physical phenomena increases. These phenomena influence the fabrication precision and operation reliability of the device. Therefore, there is a great need to accurately fabricate and operate these devices in a reproducible manner in order to improve the overall performance. Here, we describe the protocols and the methods used for the fabrication and the operation of a microfluidic-based electrochemical biochip for accurate analysis of DNA hybridization events. The biochip is composed of two parts: a microfluidic chip with three parallel micro-channels made of polydimethylsiloxane (PDMS), and a 3 x 3 arrayed electrochemical micro-chip. The DNA hybridization events are detected using electrochemical impedance spectroscopy (EIS) analysis. The EIS analysis enables monitoring variations of the properties of the electrochemical system that are dominant at these length scales. With the ability to monitor changes of both charge transfer and diffusional resistance with the biosensor, we demonstrate the selectivity to complementary ssDNA targets, a calculated detection limit of 3.8 nM, and a 13% cross-reactivity with other non-complementary ssDNA following 20 min of incubation. This methodology can improve the performance of miniaturized devices by elucidating on the behavior of diffusion at the micro-scale regime and by enabling the study of DNA hybridization events.

Introduction

Microfluidic lab-on-a-chip (LOC) devices provide numerous advantages in clinical diagnostics, environmental monitoring and biomedical research. These devices utilize microfluidic channels to control fluid flow to regions of the chip where a variety of procedures can take place including reagent mixing, affinity based binding, signal transduction, and cell culturing1-4. Microfluidics provides many advantages over conventional clinical diagnostic tools such as microwell plate readers or electrophoretic gel shift assays. Microfluidic devices require 2 to 3 orders of magnitude (nanoliters as opposed to microliters) fewer reagents to perform similar assays. Also, these devices can increase the speed by which some biological events occur due to the smaller confinement of the species within the channels5,6. Thirdly, sensors can be integrated within microfluidic devices using lithography and etching techniques, which can provide label-free detection. Lastly, these devices are inexpensive to produce and require little work on the part of the technician to operate7-10.

Label-free detection typically is performed using an optical or electrical transducer. Optical devices can present better sensing performance due to lower interference with analytes in the sample. Nevertheless, their performance is compromised in cases where the sample’s background has the same resonating wavelength as the sensor11. There are many advantages to using electrical signals to perform biological and chemical detection in microfluidic systems. The fabrication is inherently less complicated since these sensors typically only require patterned electrodes to operate. In addition, electrical signals can be directly interfaced with most measurement equipment while other signal modalities may require a transducer to convert the signal12-15. Electrical sensors commonly measure changes in impedance16,17, capacitance18, or redox activity19. However, new challenges are presented as these systems are miniaturized. The most important challenges to overcome include: sample preparation and mixing of fluids (due to the low sample volume and Reynolds number), physical and chemical effects (including capillary forces, surface roughness, chemical interactions between construction materials and analytes), low signal-to-noise ratio (produced by the reduced surface area and volume)20-23, and potential interference from electro-active analytes in complex biological samples (e.g., blood and saliva). Further investigation of these effects will result in guidelines for an accurate fabrication and operation of these devices in a reproducible manner that would improve upon their overall performance.

DNA hybridization detection is used extensively to diagnose genetic disorders24,25 and various forms of cancer26. Every year, multiple strains of influenza are identified in patients using results from DNA hybridization techniques27. The influenza virus alone accounts for 36,000 deaths each year in the United States28. Such examples could benefit from a bench-top microfluidic device that can perform the same assay techniques as a plate reader or gel shift assay with low sample volume and at a fraction of the cost without sacrificing sensitivity or specificity. Due to the many advantages of label-free electrochemical sensing, it has been used extensively for detection of DNA hybridization events29,30. A setup where macro-scale electrodes (in the millimeter range) are dipped in beakers with the solution of interest can be used to provide very sensitive data regarding the binding kinetics of single stranded DNA sequences to their matching complementary sequences. Recently, there have been a few advances in incorporating electrochemical sensing in microfluidics for DNA hybridization. Studies have been performed regarding hybridization kinetics31 and integration of sensors for detection15 in microfluidic channels. However, there still exists a need for a rapid high throughput microfluidic device that can analyze DNA hybridization events in parallel without complicated sample preparation steps.

The device presented in this work provides a platform that allows for multiple interactions to be screened in parallel and without complicated sample preparation steps. Our protocol presents how microfluidic-based electrochemical biochips are microfabricated with micro-electromechanical systems (MEMS) technology32,33. We describe the fabrication process of both the microfluidic chip, made of polydimethylsiloxane (PDMS), and the electrochemical chip, comprised of an array of electrodes. The chemical functionalization of the biochip with ssDNA probes is also addressed. Finally, the ability of the biosensor to specifically detect and analyze ssDNA targets is demonstrated. Overall, the microfluidic-based electrochemical biochip is a rapid and high-throughput analysis technique. It can be used to investigate interactions between biological molecules and conducting transducers, and can be utilized in a variety of lab-on-a-chip applications.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Microfabrication of the Microfluidic Chip

  1. Prepare Electrochemical Chip
    1. Pattern Gold Electrodes
      1. Rinse a blank 4’’ silicon wafer (prime grade quality) with acetone, methanol, and isopropanol (“AMI” clean). Rinse the isopropanol from the wafer with deionized water (DI) followed by drying with N2 gun.
      2. Grow a 1 µm thick SiO2 passivation layer with plasma-enhanced chemical vapor deposition (PECVD) tool. Deposit a 200 Å thick layer of chromium followed by a 2,000 Å thick layer of gold with a DC sputtering tool.
      3. Spin “PR1” positive photoresist (spinning parameters: 3,000 rpm, 1,000 rpm/sec, 30 sec) to create uniform film ~1.6 µm thick. Pre-bake the wafer for 1 min at 100 °C on a hot plate.
      4. Expose the wafer with 190 mJ/cm2 at 405 nm wavelength through a photomask. Develop the wafer for 30 sec in 352 developer and rinse the wafer with DI and dry with N2 gun.
      5. Etch the gold with gold etchant for 1.5 min. Etch the chromium with chromium etchant for ~30 sec. Rinse the wafer with DI and dry with N2 gun.
      6. Strip the photoresist with “AMI” clean procedure.
        NOTE: STRONG OXIDIZER AND POTENTIALLY EXPLOSIVE.
      7. Clean the wafer with 4:1 H2SO4:H2O2 mixture (“Piranha” clean) for 1 min. Rinse the wafer with DI and dry with N2 gun.
    2. Pattern Platinum Electrodes
      1. Spin “PR2” positive photoresist (spinning parameters: 3,000 rpm, 1,000 rpm/sec, 30 sec) to create uniform film ~1.4 µm thick. Pre-bake the wafer for 1 min at 100 °C on a hot plate.
      2. Expose the wafer with 30 mJ/cm2 at 405 nm wavelength through a photomask. Bake the wafer for 45 sec at 125 °C on a hot plate. Flood expose the wafer with 1,000 mJ/cm2 at 405 nm wavelength without a photomask. Develop the wafer for 2 min in 6:1 AZ400K developer and rinse the wafer with DI and dry with N2 gun.
      3. Deposit a 400 Å thick layer of titanium followed by a 1,600 Å thick layer of platinum using an E-beam evaporation system.
      4. Lift off photoresist in an ultrasonicated acetone bath for 5 min followed by rinse with acetone and isopropanol. Rinse the wafer with DI and dry with N2 gun.
  2. Prepare Assay Channels
    1. Prepare Mold for Assay Channels
      1. Rinse a blank 4’’ silicon wafer (test grade quality) with “AMI” clean procedure. Rinse the isopropanol from the wafer with DI followed by drying with N2 gun.
      2. Spin “PR3” negative photoresist (2-step spinning parameters: step one - 600 rpm, 120 rpm/sec, 10 sec. Step two – 1,150 rpm, 383 rpm/sec, 27 sec) to create uniform film ~100 µm thick. Pre-bake the wafer on a hot plate (2-step baking parameters: step one – ramp up from room temperature to 65 °C at 300 °C/hr and hold temperature for 10 min. Step 2 – ramp up to 95 °C at 300 °C/hr and hold temperature for 30 min).
      3. Expose the wafer with 2,500 mJ/cm2 at 405 nm wavelength through a photomask. Post-bake the wafer by ramping up to 95 °C at 300 °C/hr and hold temperature for 10 min on a hot plate. Develop the wafer for 10 min in Propylene Glycol Monomethyl Ether Acetate (PGMEA) developer. Rinse the wafer with isopropanol and dry with N2 gun.
    2. Fabricate Assay Channels
      1. Prepare 10:1 polydimethylsiloxane (PDMS) mixture (20 g of elastomer, 2 g of curing agent) and completely degas in a vacuum chamber for 20 min.
      2. Define an enclosure around the mold wafer with aluminum foil and slowly pour the uncured PDMS over the mold.
      3. Bake the mold with the PDMS in a box furnace (2-step baking parameters: step one – 5 min ramp up from room temperature to 80 °C. Step 2 – hold at 80 °C for 17 min).
      4. Peel away the PDMS from the mold and place on aluminum foil. Cut the assay chips with a surgeon knife, define holes with a biopsy punching tool.

2. Assemble the Device

  1. Manually align the PDMS assay channels with the working electrodes on the electrochemical chip. PDMS sticks well to the electrochemical chip, sealing the channels and preventing leakage.
  2. Connect a flexible tubing (OD 0.087’’ and ID 0.015’’) to a plastic elbow or straight connector using a short flexible tube as an adapter (OD 0.1875’’ and ID 0.0625’’). Attach connectors to each of the hole-punched inlets in the device.
  3. Connect a syringe on the other end of the tubing and place the syringe in a syringe pump. Alternately change the set of a syringe, a tube, and a connector according to the required procedure step in section 3 and its corresponding solution.

3. Analyze DNA Hybridization

NOTE: Introduce each solution slowly into the channel at a flow rate of 200 µl/hr until the whole channel is filled.

  1. Functionalize each vertical microchannel with a different ssDNA probe sequence (perform in parallel to the 3 separate vertical microchannels):
    1. Fill each microchannel with a different ssDNA probe incubation solution (10 mM phosphate buffer, 100 mM NaCl, 10 µM tris(2-carboxyethyl)phosphine (TCEP), and 1 µM probe ssDNA), and incubate for 1 hr followed by rinsing the microchannel with PBS.
    2. Fill the microchannel with a solution containing 1 mM of 6-mercapto-1-hexanol (MCH) in a buffer of 10 mM PBS, 100 mM NaCl and 1.395 mM TCEP, and incubate for 1 hr followed by rinsing the microchannel with PBS.
  2. Lift off the PDMS, rotate 90° to a horizontal orientation, and place down to expose separate rows of reaction chambers with each row containing a unique counter and reference electrode (Figure S1).
  3. Fill the microchannels with control measurement solution of 4x concentrated saline-sodium citrate (SSC) buffer, and incubate for 20 min.
  4. Background measurement: Fill the microchannels with 5 mM ferricyanide / 5 mM ferrocyanide in PBS solution and record the impedance values of the electrochemical system for different frequencies (electrochemical impedance spectroscopy; EIS) using a potentiostat connected to the working, counter, and reference electrodes (EIS parameters: frequency range from 1 MHz to 0.1 Hz, 10 frequency data points per decade, 25 mV amplitude, 5 mV polarization versus the reference electrode). Repeat this measurement for each working electrode in the microchannels.
  5. Measure DNA hybridization (perform for each non-complementary and complementary ssDNA target).
    1. Fill the microchannels with target ssDNA measurement solution of 4x concentrated SSC buffer containing 1 µM of the target ssDNA, and incubate for 20 min. Measure the DNA according to step 3.4.

Access restricted. Please log in or start a trial to view this content.

Results

A controllable and accurate manufacturing process for the experimental device is essential in research. It allows researchers to obtain reproducible and high throughput experiments. Here we have demonstrated a high yield, high reproducibility microfabrication process of a microfluidic-based electrochemical biochip (Figure 1). With a low failure rate, few devices have shown bonding issues that lead to solution leakage. In order to validate the electrochemical activity of the biochip, cyclic voltammetry me...

Access restricted. Please log in or start a trial to view this content.

Discussion

Our procedures demonstrate the manufacturing of a microfluidic-based electrochemical biochip and its utilization for DNA hybridization events analysis. Through a high yield controlled microfabrication process we develop a device comprised of microscale channels integrated with an array of electrochemical transducers. We have devised controlled processing parameters for the photolithography procedure of the electrochemical chip and the microfluidic channel mold through an iterative approach. These steps provide guidelines...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

The authors acknowledge the Robert W. Deutsch Foundation, the Defense Threat Reduction Agency (DTRA), and the National Science Foundation Emerging Frontiers in Research and Innovation (EFRI) for financial support. The authors also thank the Maryland Nanocenter and its Fablab for cleanroom facility support.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
4'' Silicon waferUltrasil4-5664Single side polished; P-type; Boron doped; Orientation 1-0-0; Thickness 500 micron; Resistance 10-20 ohm·cm
Shipley 1813 photoresist ("PR1")Microchempositive photoresist
AZ5214 photoresist ("PR2")Hoechst Celansepositive photoresist
SU-8 50 photoresist ("PR3")Microchemnegative photoresist
Gold etchantTranseneTFANo dilution
Chromium etchantTransene1020ACNo dilution
PDMS elastomerDow Corning3097366 1004
PDMS curing agentDow Corning3097358 1004
Biopsy punching toolHealthlinkBP20
Tygon flexible tubingCole Parmer R 36030.015"
Tygon flexible adapterCole Parmer 06417-410.0625"
1 ml syringeBeckton-Dickenson301025
Monobasic potassium phosphateFluka1551139
Potassium phosphate dibasic anhydrousSigmaRES20765-A7
Sodium chlorideSigma-AldrichS7653
tris(2-carboxyethyl)phosphineAldrichC4706
6-mercapto-1-hexanolAldrich451088
20x concentrated saline-sodium citrate bufferSigma93017
Potassium hexacyanoferrate(III)Aldrich455946
Complementary ssDNA #1Integrated DNA Technologies (IDT)100 nmole DNA oligo5’-GGGACGTCCACGGAGCGCTA
TCGGAGCTTT-3’
Target ssDNA #2Integrated DNA Technologies (IDT)100 nmole DNA oligo5’-/5ThioMC6-D/ACGCGTCAGGTCATTGACGA
ATCGATGAGT-3’
Complementary ssDNA #2Integrated DNA Technologies (IDT)100 nmole DNA oligo5’-ACTCATCGATTCGTCAATGA
CCTGACCCGT-3’
Target ssDNA #3Integrated DNA Technologies (IDT)100 nmole DNA oligo5’-/5ThioMC6-D/ACCTAGATCCAGTAGTTAGA
CCCATGATGA-3’
Complementary ssDNA #3Integrated DNA Technologies (IDT)100 nmole DNA oligo5’-TCATCATGGGTCTAACTACT
GGATCTAGGT-3’
Instrument
Plasma Enhanced Chemical Vapor Deposition (PECVD)Oxford InstrumentsPlasmaLab System 100Chamber pressure 1,000 mTorr, Tempreture 200 °C, RF power 20 W, Gasses: a) N2O flow rate 710 sccm; b) a composition of 5% SiH4 and 95% N2 gasses flow rate 170 sccm, SiO2 growth rate 690 Å/min.
DC sputtering unitAJA InternationalATC 1800-VFor Chrome: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 10 nm/min. For Gold: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 36 nm/min.
E-beam evaporation systemDentonCustom-builtFor Titanium: Chamber pressure < 2 x 10-6 Torr, Supplied power to the e-gun 7.5 kW, Filament current 150-200 mA, Evaporation rate 6-10 Å/sec. For Platinum: Chamber pressure < 2 x 10-6 Torr, Supplied power to the e-gun 7.5 kW, Filament current 150-200 mA, Evaporation rate 2-3 Å/sec.
PotentiostatCH Instruments660D
Syringe pumpKD ScientificKDS230

References

  1. Hong, J., Edel, J. B., deMello, A. J. Micro- and nanofluidic systems for high-throughput biological screening. Drug Discov. Today. 14, 134-146 (2009).
  2. Sun, Y., Kwok, Y. C. Polymeric microfluidic system for DNA analysis. Anal. Chim. Acta. 556, 80-96 (2006).
  3. Xu, Y., Yang, X., Wang, E. Review: aptamers in microfluidic chips. Anal. Chim. Acta. 683, 12-20 (2010).
  4. Yang, W., Woolley, A. T. Integrated multiprocess microfluidic systems for automating analysis. J. Lab. Automat. 15, 198-209 (2010).
  5. Gervais, T., Jensen, K. F. Mass transport and surface reactions in microfluidic systems. Chem. Eng. Sci. 61, 1102-1121 (2006).
  6. Song, H., Ismagilov, R. F. Millisecond kinetics on a microfluidic chip using nanoliters of reagents. J. Am. Chem. Soc. 125, 14613-14619 (2003).
  7. Jiang, H., Weng, X. A., Li, D. Q. Microfluidic whole-blood immunoassays. Microfluid. Nanofluid. 10, 941-964 (2011).
  8. Dutse, S. W., Yusof, N. A. Microfluidics-based lab-on-chip systems in DNA-based biosensing: an overview. Sensors. 11, 5754-5768 (2011).
  9. Dittrich, P. S., Manz, A. Lab-on-a-chip: microfluidics in drug discovery. Nat. Rev. Drug Discov. 5, 210-218 (2006).
  10. Craighead, H. Future lab-on-a-chip technologies for interrogating individual molecules. Nature. 442, 387-393 (2006).
  11. Hunt, H. K., Armani, A. M. Label-free biological and chemical sensors. Nanoscale. 2, 1544-1559 (2010).
  12. Dukkipati, V. R., Pang, S. W. Integrated microfluidic system for DNA analysis. IEEE-NANO 2006. Sixth IEEE Conference on Nanotechnology. 1, 162-165 (2006).
  13. Fang, T. H., et al. Real-time PCR microfluidic devices with concurrent electrochemical detection. Biosens. Bioelectron. 24, 2131-2136 (2009).
  14. Pavlovic, E., et al. Microfluidic device architecture for electrochemical patterning and detection of multiple DNA sequences. Langmuir. 24, 1102-1107 (2008).
  15. Xu, X., Zhang, S., Chen, H., Kong, J. Integration of electrochemistry in micro-total analysis systems for biochemical assays: recent developments. Talanta. 80, 8-18 (2009).
  16. Cai, H., Lee, T. M. -H., Hsing, I. M. Label-free protein recognition using an aptamer-based impedance measurement assay. Sensor. Actuat. B-Chem. 114, 433-437 (2006).
  17. Iliescu, C., Poenar, D. P., Carp, M., Loe, F. C. A Microfluidic device for impedance spectroscopy analysis of biological samples. Sensor. Actuat. B-Chem. 123, 168-176 (2007).
  18. Prakash, S. B., Abshire, P. Tracking cancer cell proliferation on a CMOS capacitance sensor chip. Biosens. Bioelectron. 23, 1449-1457 (2008).
  19. Yamaguchi, A., et al. Rapid fabrication of electrochemical enzyme sensor chip using polydimethylsiloxane microfluidic channel. Anal. Chim. Acta. 468, 143-152 (2002).
  20. Beebe, D. J., Mensing, G. A., Walker, G. M. Physics and applications of microfluidics in biology. Annu. Rev. Biomed. Eng. 4, 261-286 (2002).
  21. Mariella, R. Sample preparation: the weak link in microfluidics-based biodetection. Biomed. Microdevices. 10, 777-784 (2008).
  22. Bhushan, B. Springer handbook of nanotechnology. , 3rd ed, Springer. (2010).
  23. Ghallab, Y. H., Badawy, W. Lab-on-a-chip: Techniques, circuits, and biomedical applications. , Artech House. (2010).
  24. Chee, M., et al. Accessing genetic information with high-density DNA arrays. Science. 25, 610-614 (1996).
  25. Ma, K. -S., Zhou, H., Zoval, J., Madou, M. DNA hybridization detection by label free versus impedance amplifying label with impedance spectroscopy. Sensor. Actuat. B-Chem. 114, 58-64 (2006).
  26. Ito, T., Hosokawa, K., Maeda, M. Detection of single-base mismatch at distal end of DNA duplex by electrochemical impedance spectroscopy. Biosens. Bioelectron. 22, 1816-1819 (2007).
  27. Kao, L. T. -H., et al. Multiplexed detection and differentiation of the DNA strains for influenza A (H1N1 2009) using a silicon-based microfluidic system. Biosens. Bioelectron. 26, 2006-2011 (2011).
  28. Li, J., Chen, S., Evans, D. H. Typing and subtyping influenza virus using DNA microarrays and multiplex reverse transcriptase PCR. J. Clin. Microbiol. 39, 696-704 (2001).
  29. Gautier, C., et al. Hybridization-induced interfacial changes detected by non-faradaic impedimetric measurements compared to faradaic approach. J. Electroanal. Chem. 610, 227-233 (2007).
  30. Ma, Y., Jiao, K., Yang, T., Sun, D. Sensitive PAT gene sequence detection by nano-SiO2/p-aminothiophenol self-assembled films DNA electrochemical biosensor based on impedance measurement. Sensor. Actuat. B-Chem. 131, 565-571 (2008).
  31. Kim, J. H. -S., Marafie, A., Jia, X. -Y., Zoval, J. V., Madou, M. J. Characterization of DNA hybridization kinetics in a microfluidic flow channel. Sensor. Actuat. B-Chem. 113, 281-289 (2006).
  32. Dykstra, P. H., Roy, V., Byrd, C., Bentley, W. E., Ghodssi, R. Microfluidic electrochemical sensor array for characterizing protein interactions with various functionalized surfaces. Anal. Chem. 83, 5920-5927 (2011).
  33. Ben-Yoav, H., Dykstra, P. H., Bentley, W. E., Ghodssi, R. A Microfluidic-based electrochemical biochip for label-free diffusion-restricted DNA hybridization analysis. Biosens. Bioelectron. 38, 114-120 (2012).
  34. Wink, T., van Zuilen, S. J., Bult, A., van Bennekom, W. P. Self-assembled monolayers for biosensors. Analyst. 122, 43R-50R (1997).
  35. McEwen, G. D., Chen, F., Zhou, A. Immobilization, hybridization, and oxidation of synthetic DNA on gold surface: Electron transfer investigated by electrochemistry and scanning tunneling microscopy. Anal. Chim. Acta. 643, 26-37 (2009).
  36. Arinaga, K., Rant, U., Tornow, M., Fujita, S., Abstreiter, G., Yokoyama, N. The role of surface charging during the coadsorption of mercaptohexanol to DNA layers on gold: Direct observation of desorption and layer reorientation. Langmuir. 22, 5560-5562 (2006).
  37. Katz, E., Willner, I. Probing biomolecular interactions at conductive and semiconductive surfaces by impedance spectroscopy: Routes to impedimetric immunosensors, DNA-sensors, and enzyme biosensors. Electroanalysis. 15, 913-947 (2003).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Microfluidic Electrochemical BiochipElectrochemical Impedance SpectroscopyPolydimethylsiloxane MicrochannelsGold Electrode FabricationPlatinum Electrode DepositionSingle Stranded DNA ProbesCharge Transfer ResistanceBiosensor Detection LimitPoint-of-Care Diagnostics