A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

Summary

We present a microfluidic-based electrochemical biochip for DNA hybridization detection. Following ssDNA probe functionalization, the specificity, sensitivity, and detection limit are studied with complementary and non-complementary ssDNA targets. Results illustrate the influence of the DNA hybridization events on the electrochemical system, with a detection limit of 3.8 nM.

Abstract

Miniaturization of analytical benchtop procedures into the micro-scale provides significant advantages in regards to reaction time, cost, and integration of pre-processing steps. Utilizing these devices towards the analysis of DNA hybridization events is important because it offers a technology for real time assessment of biomarkers at the point-of-care for various diseases. However, when the device footprint decreases the dominance of various physical phenomena increases. These phenomena influence the fabrication precision and operation reliability of the device. Therefore, there is a great need to accurately fabricate and operate these devices in a reproducible manner in order to improve the overall performance. Here, we describe the protocols and the methods used for the fabrication and the operation of a microfluidic-based electrochemical biochip for accurate analysis of DNA hybridization events. The biochip is composed of two parts: a microfluidic chip with three parallel micro-channels made of polydimethylsiloxane (PDMS), and a 3 x 3 arrayed electrochemical micro-chip. The DNA hybridization events are detected using electrochemical impedance spectroscopy (EIS) analysis. The EIS analysis enables monitoring variations of the properties of the electrochemical system that are dominant at these length scales. With the ability to monitor changes of both charge transfer and diffusional resistance with the biosensor, we demonstrate the selectivity to complementary ssDNA targets, a calculated detection limit of 3.8 nM, and a 13% cross-reactivity with other non-complementary ssDNA following 20 min of incubation. This methodology can improve the performance of miniaturized devices by elucidating on the behavior of diffusion at the micro-scale regime and by enabling the study of DNA hybridization events.

Introduction

Microfluidic lab-on-a-chip (LOC) devices provide numerous advantages in clinical diagnostics, environmental monitoring and biomedical research. These devices utilize microfluidic channels to control fluid flow to regions of the chip where a variety of procedures can take place including reagent mixing, affinity based binding, signal transduction, and cell culturing^1-4. Microfluidics provides many advantages over conventional clinical diagnostic tools such as microwell plate readers or electrophoretic gel shift assays. Microfluidic devices require 2 to 3 orders of magnitude (nanoliters as opposed to microliters) fewer reagents to perform similar assays. Also....

Protocol

1. Microfabrication of the Microfluidic Chip

1. Prepare Electrochemical Chip
   1. Pattern Gold Electrodes
      1. Rinse a blank 4’’ silicon wafer (prime grade quality) with acetone, methanol, and isopropanol (“AMI” clean). Rinse the isopropanol from the wafer with deionized water (DI) followed by drying with N₂ gun.
      2. Grow a 1 µm thick SiO₂ passivation layer with plasma-enhanced chemical vapor deposition (PECVD) tool. Deposit a 200 Å thick layer of chromium followed by a 2,000 Å thick layer of gold with a DC sputtering tool.
      3. Spin “PR1” positive photores....

Results

A controllable and accurate manufacturing process for the experimental device is essential in research. It allows researchers to obtain reproducible and high throughput experiments. Here we have demonstrated a high yield, high reproducibility microfabrication process of a microfluidic-based electrochemical biochip (Figure 1). With a low failure rate, few devices have shown bonding issues that lead to solution leakage. In order to validate the electrochemical activity of the biochip, cyclic voltammetry me.......

Discussion

Our procedures demonstrate the manufacturing of a microfluidic-based electrochemical biochip and its utilization for DNA hybridization events analysis. Through a high yield controlled microfabrication process we develop a device comprised of microscale channels integrated with an array of electrochemical transducers. We have devised controlled processing parameters for the photolithography procedure of the electrochemical chip and the microfluidic channel mold through an iterative approach. These steps provide guidelines.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
4'' Silicon wafer	Ultrasil	4-5664	Single side polished; P-type; Boron doped; Orientation 1-0-0; Thickness 500 micron; Resistance 10-20 ohm·cm
Shipley 1813 photoresist ("PR1")	Microchem		positive photoresist
AZ5214 photoresist ("PR2")	Hoechst Celanse		positive photoresist
SU-8 50 photoresist ("PR3")	Microchem		negative photoresist
Gold etchant	Transene	TFA	No dilution
Chromium etchant	Transene	1020AC	No dilution
PDMS elastomer	Dow Corning	3097366 1004
PDMS curing agent	Dow Corning	3097358 1004
Biopsy punching tool	Healthlink	BP20
Tygon flexible tubing	Cole Parmer	R 3603	0.015"
Tygon flexible adapter	Cole Parmer	06417-41	0.0625"
1 ml syringe	Beckton-Dickenson	301025
Monobasic potassium phosphate	Fluka	1551139
Potassium phosphate dibasic anhydrous	Sigma	RES20765-A7
Sodium chloride	Sigma-Aldrich	S7653
tris(2-carboxyethyl)phosphine	Aldrich	C4706
6-mercapto-1-hexanol	Aldrich	451088
20x concentrated saline-sodium citrate buffer	Sigma	93017
Potassium hexacyanoferrate(III)	Aldrich	455946
Complementary ssDNA #1	Integrated DNA Technologies (IDT)	100 nmole DNA oligo	5’-GGGACGTCCACGGAGCGCTA TCGGAGCTTT-3’
Target ssDNA #2	Integrated DNA Technologies (IDT)	100 nmole DNA oligo	5’-/5ThioMC6-D/ACGCGTCAGGTCATTGACGA ATCGATGAGT-3’
Complementary ssDNA #2	Integrated DNA Technologies (IDT)	100 nmole DNA oligo	5’-ACTCATCGATTCGTCAATGA CCTGACCCGT-3’
Target ssDNA #3	Integrated DNA Technologies (IDT)	100 nmole DNA oligo	5’-/5ThioMC6-D/ACCTAGATCCAGTAGTTAGA CCCATGATGA-3’
Complementary ssDNA #3	Integrated DNA Technologies (IDT)	100 nmole DNA oligo	5’-TCATCATGGGTCTAACTACT GGATCTAGGT-3’
Instrument
Plasma Enhanced Chemical Vapor Deposition (PECVD)	Oxford Instruments	PlasmaLab System 100	Chamber pressure 1,000 mTorr, Tempreture 200 °C, RF power 20 W, Gasses: a) N2O flow rate 710 sccm; b) a composition of 5% SiH4 and 95% N2 gasses flow rate 170 sccm, SiO2 growth rate 690 Å/min.
DC sputtering unit	AJA International	ATC 1800-V	For Chrome: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 10 nm/min. For Gold: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 36 nm/min.
E-beam evaporation system	Denton	Custom-built	For Titanium: Chamber pressure < 2 x 10-6 Torr, Supplied power to the e-gun 7.5 kW, Filament current 150-200 mA, Evaporation rate 6-10 Å/sec. For Platinum: Chamber pressure < 2 x 10-6 Torr, Supplied power to the e-gun 7.5 kW, Filament current 150-200 mA, Evaporation rate 2-3 Å/sec.
Potentiostat	CH Instruments	660D
Syringe pump	KD Scientific	KDS230