Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Immunofluoreszenz-Analyse von endogener und exogener Zentromer-Proteine ​​kinetochore

Published: March 3, 2016 doi: 10.3791/53732

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

"Zentromere" wurden klassisch definiert als Regionen unterdrückter meiotischen Rekombination in der Genetik und später als primäre Einschnürung der mitotischen Chromosomen erkannt, die während der Mitose eine wesentliche Rolle bei der genauen Chromosomensegregation spielt. "Kinetochore" wurden als die Mehrschichtstrukturen beschrieben, die an der Oberfläche des Zentromeren an Mikrotubuli binden, wie durch Elektronenmikroskopie ergab; "Kinetochore" wurden später als die hochmolekularen Komplex definiert, die am Zentromer von mitotischen Chromosomen lokalisiert. Trotz einer dramatischen Divergenz der Zentromer-DNA-Sequenzen unter den Wirbeltieren, kinetochore Struktur und Zusammensetzung sind hoch konserviert. Eine dynamische Wechselwirkung zwischen Mikrotubuli und dem Spindel kinetochore für treue Segregation der Chromosomen während der Mitose erforderlich ist, und Defekte in Zentromer-kinetochore Funktion führen zu Aneuploidie und damit Krebs.

Das Zentromer in den meisten Eukaryotenhat keine DNA-Sequenz definiert, wird aber von großen Arrays (0,3-5 Mb) repetitiver DNA alphoid bestehend aus 171-bp α-Satelliten-DNA zusammengesetzt ist. Außer in Bäckerhefe wird Zentromer Identität nicht von der DNA - Sequenz erreicht , sondern durch die Anwesenheit eines speziellen Nukleosomen, die die Histon - H3 - Variante CENH3 (Zentromer - Protein A [CENP-A] in Menschen) enthält. 5 CENP-A Nukleosomen lokalisieren zu der Innenplatte von Säugetier Kinetochore 7 und binden sich an das 171-bp - α-Satelliten - DNA. Aktive Romeren erfordern CENP-A-haltigen Nukleosomen die Rekrutierung eines konstitutiven Zentromer-assoziierten Netzwerk (CCAN) und die kinetochore Proteine ​​zu richten, die zusammen die Befestigung der Chromosomen auf die mitotische Spindel und nachfolgenden Zyklus Progression durch den Spindel-Checkpoint zu regulieren.

In Anbetracht der obigen Beweis, CENP-A wurde vorgeschlagen , die epigenetische Markierung der Zentromer zu 8; jedoch ist der Prozess, mit dem CENP-A i inkorporiertnto Zentromer-DNA und die Faktoren für diese Integration verantwortlich sind noch nicht gut charakterisiert. Eine kurze Zentromer-Targeting - Domäne (CATD) in der Histon liegt Region CENP-A falten, und Ersatz des entsprechenden Bereichs von H3 mit dem CATD reicht aus, um direkten H3 an den Zentromer. 9 Mehrere Studien legten nahe , funktionelle Rolle für die post-translationale Modifikation (PTM) von CENP-A - 12-16; jedoch haben die molekularen Mechanismen dieser PTMs von CENP-A in der Einstellung zum Zentromeren noch nicht aufgeklärt. Wir bereits berichtet , dass CUL4A-RBX1-COPS8 E3 - Ligase - Aktivität für CENP-A K124 Ubiquitinierung und Lokalisierung von CENP-A bis Romeren erforderlich ist. 17

Die Entdeckung und Charakterisierung von kinetochore Proteine ​​, um neue Erkenntnisse in Bezug auf die Chromosomensegregation geführt. 18 Mehr als 100 kinetochore Komponenten in Zellen von Wirbeltieren durch verschiedene Ansätze identifiziert worden. 19,20 Ein unterStehen wie Kinetochore montieren und Funktion kommt auch von der Charakterisierung der zellulären Funktionen jedes Zentromer-Kinetochor - Proteinen und Protein-Protein - Netzwerk innerhalb von Zellen. 19 Direkte Visualisierung und fortschrittliche Bildgebungsverfahren in der Fluoreszenzmikroskopie liefern bemerkenswerte Auflösung von Zentromer-Kinetochor Komponenten und ermöglichen direkte Beobachtung der spezifischen molekularen Komponenten der Zentromer und Kinetochore. Darüber hinaus Methoden der indirekten Immunfluoreszenz (IIF) Färbung spezifische Antikörper verwenden, sind von entscheidender Bedeutung für diese Beobachtungen. Doch trotz zahlreicher Berichte über IIF - Protokolle, einige im Detail Probleme spezifischer Zentromer-Kinetochor Proteine ​​diskutiert. 1-4 So entwickeln und Berichtsmethoden IIF - Färbung und einer quantitativen IIF - Assay spezifisch jedes Zentromer-Kinetochor Protein analysieren ist extrem wichtig. In IIF Färbung sollte man mit dem Färbungsprotokoll gehen Verlust des Proteins von Interesse zu vermeiden oderder Rest der Zelle. Jedoch zerstört Fixierung Antigenstellen gelegentlich und verschiedenen Antikörper-Antigen - Kombinationen arbeiten schlecht mit einem Fixiermittel, aber sehr gut mit einer anderen, 21 und die Wahl des Fixierungs hängt weitgehend von der Protein (e) von Interesse. Aus diesem Grund sind verschiedene Fixiermittel Methoden entscheidend in IIF-Färbung von Zentromer-Kinetochor-Proteinen.

Hier optimierte Verfahren der indirekten Immunofluoreszenz (IIF) -Färbung und einem Assay Lokalisation von endogenem Zentromer-kinetochore Proteine ​​zu adressieren, einschließlich CENP-A und FLAG-markiertem exogenem CENP-A-Proteine, und die Quantifizierung dieser Proteine ​​in menschlichen Zellen entwickelt wurden. Diese Verfahren können zur Analyse der Zentromer-kinetochore Proteine ​​in anderen Spezies verwendet werden.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Zellkultur und Transfektion

  1. Setzen Sie ein Deckglas (22 mm x 22 mm) in einer 6-Well Polystyrolplatte. Optional Mantel ein Deckglas mit Poly-L-Lysin, 0,1% w / v, in Wasser (siehe Liste der Materialien / Ausrüstung) die Schritte folgenden mitotischen Zellen auf dem Deckglas zu halten unten:
    Hinweis: Optimale Bedingungen müssen für jede Zelllinie und Anwendung bestimmt werden.
    1. Aseptisch Mantel Kulturoberfläche mit Poly-L-Lysin, 0,1% w / v, in Wasser (0,4 ml / Vertiefung einer 6-Well-Polystyrol-Platte). Schaukeln sanft sogar Beschichtung der Kulturoberfläche zu gewährleisten.
    2. Nach 5 min Lösung durch Absaugen entfernen und gründlich Oberfläche gründlich mit steriler Gewebekultur-Wasser.
    3. Trocken mindestens 2 Stunden vor der Zellen und das Medium eingeführt wird.
  2. Seed HeLa - Zellen 17 oder HeLa Tet-Off Zellen 17,22 auf einem Deckglas (22 mm x 22 mm) stecken in einer 6-Well Polystyrolplatte. Überprüfen Sie, dass die Zelldichte 5,4 x 10 5 pro Vertiefung ist. Kulturzellenin High-glucose DMEM mit 10% FBS und 1% Penicillin-Streptomycin.
    Hinweis: Für optimale Ergebnisse bestimmen empirisch die Zelldichte in der Aussaat zu verwenden.
  3. Inkubieren der Zellen bei 37 ° C in einer Atmosphäre von 5% CO 2 für 18 Stunden.
    Hinweis: Im Fall von HeLa Tet-Off - Zellen, die Transkription des exogenen Gens ist in der Abwesenheit des Induktors (dh Tetracyclin / Doxycyclin) daher Kulturzellen ohne Tetracyclin / Doxycyclin und transfizieren transient mit dem pTRM4 Überexpressionsvektor (Tabelle 2 ), dessen Transkription durch die TRE-Promotor reguliert wird (siehe unten).
  4. Achtzehn Stunden nach dem Aussäen transfizierbaren Zellen wie folgt:
    1. Machen Lösung A durch Mischen von 1,5 ul siRNA Oligo (20 uM geglüht Lager; Tabelle 1) und / oder 2,0 ug Plasmid (Tabelle 2) in 50 ul reduziert Serum - Medium (siehe Liste der Materialien / Ausrüstung) und Inkubation bei RT für 5 min .
      Hinweis: In dieser AnalyseCA-UTR siRNAs (eine Mischung aus 5 'und 3' UTR siRNA; Tabelle 1) wurden in den Protokollen für den Einsatz cotransfiziert 3 und 4 (siehe Diskussion).
    2. Machen Lösung B um 0,75 ul Transfektionsreagenz Mischen I (siehe Liste der Materialien / Geräte) in 50 & mgr; l Serum Medium reduziert, und Inkubation für 5 min bei RT.
      Hinweis: Ein optionaler Schritt ist die Zugabe von 1,0 ul Transfektionsreagenz II (siehe Liste der Materialien / Ausrüstung).
    3. Mischen Sie die Lösungen A und B zusammen, und Inkubation bei RT für 15 min.
    4. Waschen Sie einmal die kultivierten Zellen mit PBS, und fügen Sie dann 500 & mgr; l reduziert Serummedium zu jeder Vertiefung der 6-Well Polystyrolplatte. Fügen Sie die Mischung der Lösungen A und B (dh RNA und / oder DNA-Lipid - Komplex) direkt an jedem der einzelnen gut.
      Hinweis: Die Endkonzentration beträgt 3,3 ug / ml (Plasmid); 50 nM (siRNA).
    5. Inkubieren der Zellen bei 37 ° C in einer Atmosphäre von 5% CO 2 für 4,5 Std. Ändern Sie den mittleren bis hohen Glucose DMEM with 10% FBS und 1% Penicillin-Streptomycin.
    6. Inkubieren der Zellen bei 37 ° C in einer Atmosphäre von 5% CO 2 für 48-72 h nach der Transfektion.
      Hinweis: Für optimale Ergebnisse muss die Inkubationszeit für das Zellwachstum vor der Fixierung empirisch bestimmt werden, und Proteinabbau und / oder Expression muss durch Western-Blot-Analyse bestätigt werden (siehe Protokoll 6).
    7. Wenn mitotischen Zellanalyse von Interesse ist, fügen Paclitaxel (10 nM) an kultivierten Zellen 24 Stunden vor der Fixierung, oder fügen Sie TN16 (0,5 uM) auf die kultivierten Zellen 2,5 Stunden vor der Fixierung.

2. Zell Fixierung und Immunfluoreszenzanfärbung zu erkennen Endogene Zentromer-Kinetochor Proteine ​​(Paraformaldehyd Fixierung)

  1. Herstellung von Fixiermittel, Puffer und Reagenzien.
    1. Frisch herstellen 50 ml 4% Paraformaldehydlösung in PBS, pH-Wert 7,4.
      1. In 40 ml 1 × PBS in einem Becherglas auf einer Rührplatte in einer belüfteten Haube. Hitze während stirring auf ca. 60 ° C. 2 g Paraformaldehyd Pulver zum erhitzten PBS.
      2. Langsam erhöhen den pH-Wert durch Zugabe von 1 ml 1 N NaOH insgesamt, da das Pulver nicht sofort löst.
        Anmerkung: Die Lösung nach der Zugabe von NaOH löscht.
      3. Sobald Paraformaldehyd gelöst hat, kühlen und filtriert die Lösung.
      4. Den pH-Wert mit 1 N HCl auf pH 7,4, und das Volumen der Lösung mit 1 × PBS auf 50 ml.
        Hinweis: Aliquots der Lösung kann eingefroren oder bei 2-8 ° C so lange wie 1 Woche gelagert werden. Die Lösung sollte bei 4 ° C eiskaltem oder gelagert werden, bis sie verwendet werden soll.
    2. Vorbereitung 50 ml Puffer KB1, die aus 10 mM Tris-HCl besteht, pH 7,5; 150 mM NaCl; 0,5% BSA; und 0,5% Triton X-100.
      Hinweis: BSA sollte frisch zugegeben werden.
      Hinweis: Die Puffer KB Serie basieren auf Puffer KB in früheren Berichten beschrieben 1,2,4.
    3. Vorbereitung 50 ml Puffer KB2, der aus 10 mM Tris-HCl besteht,pH 7,5; 150 mM NaCl; und 0,5% BSA.
      Hinweis: BSA sollte frisch zugegeben werden.
    4. Vorbereitung 1 ml Puffer, enthaltend KB3 DAPI (50 ng / ml).
    5. Herstellung von 100 ml der Befestigungsmittel, das von 1 mg / ml p-Phenylendiamin besteht; 10% PBS und 90% Glycerin.
      1. Der pH-Wert von 1 × PBS auf 9,8 mit 1 N NaOH, p-Phenylendiamin in der Lösung aufzulösen, und dann Glycerin hinzufügen.
      2. Speicher 1 ml Aliquots bei -80 ° C. Vor Licht schützen.
  2. Entfernen Sie das Kulturmedium durch Absaugen bei 48-72 Stunden nach der Transfektion (siehe Protokoll 1) für die Zellfixierung. Rinse Zellen einmal mit PBS. Gelten PBS zu der Seite der Kulturvertiefungen Störung der Oberfläche der Zellen zu vermeiden.
    Hinweis: Der optimale Zeitpunkt für Zellfixierung empirisch bestimmt werden müssen.
  3. Fixieren Sie die Zellen in 4% Paraformaldehyd in PBS für 30 min bei 4 ° C. Spülen Sie die Zellen zweimal mit Puffer KB2 ausreichend Rest 4% Paraformaldehyd zu entfernen.
  4. PermeabiLIZE die Proben in Puffer KB1 für 30 min bei RT. Spülen Sie die Zellen einmal mit Puffer KB2, und fügen Sie Puffer KB2 für 5 min bei RT, um zusätzliche Blockstellen der unspezifischen Bindung.
    Hinweis: Puffer KB1 auch wesentlich zur Blockierung beiträgt.
  5. Entfernen Sie ein Deckglas (22 mm x 22 mm) aus einer 6-Well Polystyrolplatte mit einer Pinzette. Unter Verwendung einer hydrophoben Barriere Stift (siehe Liste der Materialien / Equipment), eine hellgrüne Quadrat oder Kreis ziehen um jedes Deckglas Probe eine hydrophobe Barriere zu bilden. Sie nicht zu nahe berühren oder mit dem hydrophoben Barriere Stift an die Zellen zu bekommen. Legen Sie das Deckglas in neuen 6-Well Polystyrolplatte.
  6. Verdünnen Sie einen primären Antikörper gegen Zentromer oder kinetochore Protein (Verdünnungsverhältnis von 1: 100 bis 1: 200, siehe auch Liste der Materialien / Equipment) und entweder eine anti-CENP-B-Antikörper (Verdünnungsverhältnis von 1: 400) oder eine anti- Zentromer-Antikörper (ACA) (Verdünnungsverhältnis von 1: 2000) als Zentromer Standortmarkierung in Puffer KB2.
    Hinweis: Für optimale Ergebnisse die endgültige Konzention des primären Antikörpers in dieser Lösung muß empirisch ermittelt werden.
  7. Anwenden eines ausreichenden Menge (ca. 30 & mgr; l) des verdünnten primären Antikörpers mit der Zellprobe einzutauchen. Inkubieren der Zellprobe für 1 h bei 37 ° C. Spülen Sie die Zellen 3 mal mit Puffer KB2.
  8. Unter Verwendung von Puffer KB2, verdünnter einen Fluorophor-konjugierten Sekundärantikörper (Verdünnungsverhältnis von 1: 100 bis 1: 200) gegen jeden primären Antikörper.
    Anmerkung: Für optimale Ergebnisse sollte die Endkonzentration des sekundären Antikörpers in dieser Lösung empirisch bestimmt werden.
  9. Tragen Sie eine ausreichende Menge (ein Minus von ca. 30 & mgr; l auf dem Deckglas) des verdünnten sekundären Antikörper , der die Zellprobe einzutauchen. Inkubieren der Zellprobe für 1 h bei 37 ° C. Spülen Sie die Zellen 5-mal mit Puffer KB2 während eines Zeitraums von 30 min (fünf 6 min Wäschen).
    Anmerkung: Für optimale Ergebnisse (dh für einen minimalen Verlust von Zellen), muß die optimale Waschbedingung empirica bestimmt werdenlly.
  10. Anwenden eines ausreichenden Volumen an Puffer, enthaltend KB3 DAPI (50 ng / ml) der Zellprobe einzutauchen. Inkubieren der Zellprobe für 5 min bei RT. Spülen Sie die Zellen 1-2 mal mit Puffer KB2.
  11. Montieren Sie das Deckglas, das die Zellprobe auf den Mikro Folie enthält.
    1. Geben Sie einen Tropfen des Mediums in der Mitte des Mikroschienenführung.
    2. Entfernen Sie Flüssigkeit aus der Zellprobe und mit den Händen oder einer Zange, positionieren Sie die Probe in der Mitte des Mikrorutsche. Vermeiden Sie Luftblasen.
    3. Überschüssiges Montagemedium mit einem Papiertuch.

3. Zellfixierung und Immunfluoreszenzfärbung von C-terminalen FLAG-markierten CENP-A Proteine ​​(Acetone Fixation)

  1. Vorbereitung
    1. Bereiten Sie eiskaltem 75% Aceton.
    2. Frisch herstellen 50 ml PBS (pH 7,4), 0,5% Magermilch und 0,5% BSA enthält.
    3. Frisch herstellen 50 ml PBS (pH 7,4), 0,1% Magermilch und 0,1% BSA enthält.
    4. Vorbereitung 1 ml PBS (pH 7,4), enthaltend DAPI (50-100 ng / ml).
    5. Bereiten Sie 100 ml Eindeckmediums wie in 2.1.5 beschrieben.
  2. Entfernen Sie das Kulturmedium durch Absaugen bei 48-72 Stunden nach der Transfektion (siehe Protokoll 1) für die Zellfixierung. Rinse Zellen einmal mit PBS. Gelten PBS zu der Seite der Kulturvertiefung zu vermeiden, dass die Oberfläche der Zellen zu stören.
    Hinweis: Der optimale Zeitpunkt für Zellfixierung empirisch bestimmt werden müssen.
  3. Befestigen Sie die Zellen in eiskaltem 75% Aceton, und Inkubation der Zellen für 10 Minuten bei -20 ° C. Trockene Zellen auf dem Deckglas in einem Abzug für 30-60 min bei RT.
    Hinweis: Für optimale Ergebnisse benötigt, um die Länge der Zeit, für die Fixierung und Zelltrocknung muss empirisch ermittelt werden.
  4. Unter Verwendung der hydrophoben Barriere Stift (siehe Liste der Materialien / Equipment), eine hellgrüne Quadrat oder Kreis ziehen um jedes Deckglas Probe eine hydrophobe Barriere zu bilden. Sie nicht zu nahe berühren oder mit dem hydrophoben Barriere Stift an die Zellen zu bekommen.
  5. Block nonspecPBS, enthaltend 0,5% Magermilch und 0,5% BSA für 5 min bei RT ific Bindungsstellen auf den Zellen durch Zugabe von.
  6. Verwendung von PBS, das 0,1% Magermilch und 0,1% BSA enthält, verdünnt ein Anti-Flag-Antikörper (1: 1.000 Verdünnungsverhältnis) und entweder ein Anti-CENP-B-Antikörper (Verdünnungsverhältnis von 1: 200) oder ACA (1: 2.000 Verdünnungsverhältnis ) als Zentromer Standortmarkierung.
    Anmerkung: Für optimale Ergebnisse sollte die Endkonzentration des primären Antikörpers in dieser Lösung empirisch bestimmt werden.
  7. Anwenden eines ausreichenden Menge (ca. 30 & mgr; l) des verdünnten primären Antikörpers mit der Zellprobe einzutauchen. Inkubieren der Zellprobe für 1 h bei 37 ° C. Spülen Sie die Zellen 5-mal mit dem Blockierungspuffer während eines Zeitraums von 30 min.
    Anmerkung: Die Zellen können mit PBS gespült werden. Für optimale Ergebnisse (dh zu vermeiden Verlust von Zellen), muß die optimalen Waschbedingungen empirisch ermittelt werden.
  8. Verdünnte einen Fluorophor-konjugierten Sekundärantikörper (Verdünnungsverhältnis von 1: 100 bis 1: 200) gegendie jeweils primären Antikörper in PBS, das 0,1% Magermilch und 0,1% BSA enthält.
    Anmerkung: Für optimale Ergebnisse sollte die Endkonzentration des sekundären Antikörpers in dieser Lösung empirisch bestimmt werden.
  9. Anwenden eines ausreichenden Menge (ca. 30 & mgr; l) des verdünnten sekundären Antikörpers der Zellprobe einzutauchen. Inkubieren der Zellprobe für 1 h bei 37 ° C. Spülen Sie die Zellen 2 mal mit PBS 0,1% Magermilch und 0,1% BSA enthält.
    Hinweis: PBS allein kann auch verwendet werden, um die Zellen zu waschen.
  10. Anwenden eines ausreichenden Volumen PBS, enthaltend DAPI (50-100 ng / ml) der Zellprobe einzutauchen. Inkubieren der Zellprobe für 5 min bei RT. Spülen Sie die Zellen 1-2 mal mit PBS.
  11. Montieren Sie das Deckglas der Zellprobe auf den Mikroschieber enthält, wie in 2.11 beschrieben.

4. Zellfixierung und Immunfluoreszenzfärbung von N-terminalen Flag-markiertes CENP-A Proteine ​​(Methanol Fixation)

  1. Vorbereitung
    1. Bereiten Sie eiskaltem Methanol.
    2. Bereiten TBS (pH 7,4), enthaltend 4% Ziegenserum.
    3. Vorbereitung 1 ml TBS (pH 7,4), enthaltend DAPI (50-100 ng / ml).
    4. Bereiten Sie 100 ml Eindeckmediums wie in 2.1.5 beschrieben.
  2. Entfernen Sie das Kulturmedium durch Absaugen bei 48-72 Stunden nach der Transfektion (siehe Protokoll 1) für die Zellfixierung. Rinse Zellen einmal mit TBS. Gelten TBS zu der Seite der Kulturvertiefungen Störung der Oberfläche von Zellen zu vermeiden.
    Hinweis: Der optimale Zeitpunkt für Zellfixierung empirisch bestimmt werden müssen.
  3. Befestigen Sie die Zellen in eiskaltem Methanol, und Inkubation der Zellen für 6 min bei -20 ° C. Spülen Sie die Zellen zweimal mit TBS ausreichend restliches Methanol zu entfernen.
  4. Unter Verwendung einer hydrophoben Barriere Stift (siehe Liste der Materialien / Equipment), eine hellgrüne Quadrat oder Kreis zu zeichnen eine hydrophobe Barriere um jedes Deckglas Probe zu schaffen. Sie nicht zu nahe berühren oder mit dem hydrophoben Barriere Stift an die Zellen zu bekommen.
  5. Blockieren unspezifischer Bindungsstellen auf der cells durch Zugabe von TBS, die 4% Ziegenserum. Inkubieren für 10 min bei RT.
  6. Verdünnte eine Anti-Flag-Antikörper (1: 1000 Verdünnung) und entweder ein Anti-CENP-B-Antikörper (Verdünnungsverhältnis von 1: 200) oder ACA (1: 2.000 Verdünnungsverhältnis) als Zentromer Positionsmarkierung in TBS, enthaltend 4% Ziegenserum .
    Anmerkung: Für optimale Ergebnisse sollte die Endkonzentration des primären Antikörpers in dieser Lösung empirisch bestimmt werden.
  7. Anwenden eines ausreichenden Menge (ca. 30 & mgr; l) des verdünnten primären Antikörpers mit der Zellprobe einzutauchen. Inkubieren der Zellprobe für 1 h bei 37 ° C. Spülen Sie die Zellen 5-mal mit dem Blockierungspuffer während eines Zeitraums von 30 min. Für optimale Ergebnisse (dh der minimale Verlust von Zellen), muß die optimale Waschbedingungen empirisch ermittelt werden.
  8. Verdünnte einen Fluorophor-konjugierten Sekundärantikörper (Verdünnungsverhältnis von 1: 100 bis 1: 200) gegen jeden primären Antikörper in TBS, enthaltend 4% Ziegenserum.
    Hinweis: Für optimale Ergebnisse die final Konzentration des sekundären Antikörpers in dieser Lösung muß empirisch ermittelt werden.
  9. Anwenden eines ausreichenden Menge (ca. 30 & mgr; l) des verdünnten sekundären Antikörpers der Zellprobe einzutauchen. Inkubieren der Zellprobe für 1 h bei 37 ° C. Spülen Sie die Zellen 3-mal mit dem Blockierungspuffer.
  10. Tragen Sie eine ausreichende Menge an TBS mit DAPI (50-100 ng / ml) der Zellprobe einzutauchen. Inkubieren der Zellprobe für 5 min bei RT. Spülen Sie die Zellen 1-2 mal mit TBS.
  11. Montieren Sie das Deckglas, das die Zellprobe auf den Mikro Folie enthält, wie in 2.11 beschrieben.

5. Immunofluoreszenz Bildbeobachtung, Akquisition, Quantifizierung und Analyse

  1. Beobachten der Zellprobe durch ein motorisiertes Fluoreszenzmikroskop, ausgerüstet mit einem 63X und 100X-Ölimmersionsobjektiv, eine externe kompakte Lichtquelle und einer digitalen CCD-Kamera.
  2. Nehmen Sie die Bildaufnahme und -verarbeitung, einschließlich Entfaltungs, mit Hilfe von SoftwareA oder Softwares B1 und B2 (siehe Liste der Materialien / Ausrüstung). Bitte sehen Ergänzenden Code-Dateien (5.2.1) für alle Befehle in Software A. Für alle Befehle in Softwares B1 und B2 verwendet, siehe (5.2.2) in Ergänzenden Code-Dateien.
  3. Verwenden eines zuvor 23-25 ​​beschriebenen Methode Signale Zentromer-kinetochore Proteine ​​zu quantifizieren (zB verbleibenden Signale von CENP-A am Zentromer) mit den folgenden geringfügigen Änderungen:
    1. Wählen Sie Bereich der Zentromer-Kinetochor Proteine ​​und die der Hintergrund wie folgt:
      1. Mitotischen Zelle: (Zentromer-Kinetochor Region) Wählen Sie einen Bereich überlappend mit Chromosomen mit DAPI gefärbt; (Hintergrundbereich) und die Fläche außerhalb Chromosomen , aber innerhalb der identischen einzelnen Zelle (dh cytosolische Region).
      2. Interphase Zelle: (Zentromer-Kinetochor Region) Wählen Sie einen Bereich überlappend mit Chromatin mit DAPI gefärbt; (Hintergrundbereich) und die Fläche außerhalb Chromatin, aber innerhalb der identischen Einzelzelle (<em> dh Cytosol - Region).
        Hinweis: Siehe auch Ergänzenden Code-Dateien (5.2.1.4.3) oder (5.2.2.6.4) für Bereichsauswahl mit Software A oder Software B2 sind.
    2. Quantifizieren den Prozentsatz der verbleibenden Signale an den Zentromeren unter Verwendung Software A oder B. Für diese Aufgabe verwenden Sie die folgende Formel:
      Verbleibende Signale von Zentromer-Kinetochor Protein am Zentromer-Kinetochor
      Equation1
      wobei s die Signalhelligkeit des ausgewählten Bereichs ist, die von ACA oder CENP-B - Färbung bestätigt wird; b ist das Hintergrundsignal Helligkeit; r Probe die Referenz ACA oder CENP-B - Signale für siRNA (s) behandelten Zellen; und r - Abfrage ist die Referenz ACA oder CENP-B - Signale für Luc siRNA-transfizierten Zellen.
      Hinweis: In dieser Analyse CENP-B-Signale wurden als Referenzsignale für CUL4A verwendet und RBX1 wie in früheren Berichten beschrieben.
    3. Verwenden Sie eine Excel-Datei für diese Berechnung nach dem Kopieren und Einfügen der Rohdaten aus der Signalquantifizierungssoftware oben beschrieben. Siehe auch Ergänzenden Code-Dateien: (5.2.1.4) und (5.2.2.6) für weitere Einzelheiten. Ein Beispiel der Berechnung ist in Tabelle 3 gezeigt.
  4. Analysieren Sie mindestens 20 Zellen Variation in Färbung und Bildaufnahme für jede Messebene zu beseitigen. verwenden Optional "gemittelte Wert" der verbleibenden Zentromer-Kinetochor Signale für jede Zelle analysiert diese Werte unter den verschiedenen Zentromer-Kinetochor Proteine ​​zu vergleichen.

6. Western Blot-Analyse von Gesamtprotein

  1. Resuspendieren der Zellen in denaturierenden Puffer A (20 mM Tris-HCl, pH 7,4; 50 mM NaCl; 0,5% Nonidet P-40, 0,5% Desoxycholat, 0,5% SDS, 1 mM EDTA, und vollständig EDTA-freie Proteaseinhibitorcocktail), 26 unterliegt die Suspension einer Ultraschallbehandlung und Gefrier-Auftau - Verfahren, und messenProtein-Konzentrationen wie folgt:
    1. Für die Beschallung Verfahren werden 50 ul Puffer A zu den aus zwei Vertiefungen einer 6-Well-Polystyrol-Platte bei 48-72 Stunden nach der Transfektion gesammelt Zellen (siehe Protokoll 1). Betreiben Sie ein Beschallungsgerät mit Disruptor Horn und microtip (siehe Liste der Materialien / Ausrüstung) für insgesamt 15 Sekunden intermittierenden Pulsdauer (Tastverhältnis 50%) pro Probe.
    2. Für Frost-Tau-Prozess, Gefrierzellen mit flüssigem Stickstoff und Auftauen Zellen bei RT.
    3. Messen Proteinkonzentrationen unter Verwendung eines kommerziellen Protein-Assay-Reagenz I oder II (siehe Liste der Materialien / Ausrüstung).
      Anmerkung: Die Lysate werden entweder mit I-Reagenz mit einem Verhältnis von 1:10 bei der Messung der Proteinkonzentrationen verdünnt oder II. Bei dieser Verdünnung zeigt die SDS in Puffer A wenig oder gar keine Störungen bei dieser Messung.
  2. Mischen Sie das Lysat enthält 20 bis 30 & mgr; g Gesamtprotein mit 2 × oder 4 × SDS-PAGE - Ladepuffer. 27 Boil die Proben5 min und laden sie dann auf einem 12,0% -15,0% SDS-Polyacrylamid-Gel für die Elektrophorese denaturieren.
  3. Übertragen die aufgetrennten Proteine ​​durch SDS-PAGE auf eine PVDF - Membran durch eine Western - Blotting - Verfahren unter Verwendung zuvor beschrieben. 17,24,27-31
    1. Blockieren die unspezifischen Bindungsstellen auf der Membran mit 5% fettfreier Milch in PBS 1 ×, und dann Inkubieren der Membran mit Lösungen von verdünnten Primärantikörper für 1 h bei RT. Siehe Liste der Materialien / Ausrüstung für detaillierte Informationen (zB Verdünnungsverhältnis) eines jeden primären Antikörper.
    2. Nach dem Waschen der Membran 3-4 mal (jeweils 3 bis 5 min Inkubation mit Schütteln) mit PBS-T-Puffer (1 × PBS und 0,1% Tween-20), Inkubieren der Membran in einem Gemisch von im nahen Infrarot (IR) Fluoreszenzfarbstoff-konjugierten sekundären Antikörpern (Verdünnungsverhältnis von 1: 20.000), DyLight-konjugiertem Sekundärantikörper (Verdünnungsverhältnis von 1: 20.000) und / oder Meerrettich-Peroxidase (HRP) -konjugierten sekundären Antikörper (verdünnt in PBS-T; dilutiauf Verhältnis von 1: 10.000) 1 h bei RT. Siehe Liste der Materialien / Ausrüstung für detaillierte Informationen (zB Verdünnungsverhältnis) jeder sekundären Antikörper.
  4. Waschen Sie die Membran 3 mal, und dann scannen die Membran, die die Proteine ​​mit dem Infrarot-Imaging-System und / oder die Chemilumineszenz-Imager für Immunoblot-Detektion (siehe Liste der Materialien / Geräte) zu analysieren.
    1. Für die Infrarot-Imaging-System finden Sie unter (6.4.1) in Ergänzenden Code-Dateien.
    2. Für die Chemilumineszenz-Imager finden Sie unter (6.4.2) in Ergänzenden Code-Dateien. Verwenden Sie ein ultra-sensitive verstärkten chemolumineszenten (ECL) Substrat (siehe Liste der Materialien / Ausrüstung) für dieses System.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Immunfluoreszenz - Analyse von endogenen CENP-A unterstützt die Hypothese , dass CUL4A-E3 - Ligase für die Lokalisierung von CENP-A bis Romeren erforderlich ist
Unsere jüngsten Studien zeigten , dass CUL4A-RBX1-COPS8 E3 - Ligase - Aktivität für die Ubiquitinierung von Lysin 124 (K124) auf CENP-A und Lokalisierung von CENP-A bis Romeren 17 zunächst erforderlich ist. Die Interphase-Zentromer - Komplex (ICEN) wurde isoliert , indem Anti-CENP-A: nativem Chromatin - Immunopräzipitation, 32-34 und die Hypothese aufgestellt worden , dass einige der ICEN Proteine ​​eine Rolle bei der Lokalisierung von CENP-A an Zentromeren spielen. Daher wurden siRNA Knockdown Experimente durchgeführt , die für Proteine ​​, deren Abwesenheit der Expression zu screenen 17 die Delokalisierung von CENP-A an Zentromeren induziert (Daten nicht gezeigt) asynchron wachsende HeLa - Zellen wurden mit Cullin 4A (CUL4A) siRNA oder RBX1 siRNA für die Zeiten transfiziert erforderlich für eine optimale Proteinabbau (48 hr für CUL4A und 72 Stunden für RBX1). Zellen , transfiziert mit CUL4A siRNA zeigten eine signifikante Delokalisierung von CENP-A an Zentromeren (1A-C). Wie in Figur 2G zu sehen ist , waren die Proteinspiegel von CENP-A in Gesamtzell - Lysaten von CUL4A siRNA-transfizierten Zellen ähnlich wie CENP-A levels in Lysaten von Luciferase (Luc) siRNA-transfizierten Zellen unter den gleichen Kulturbedingungen. Die Möglichkeit , Off-Target - Effekte von CUL4A siRNA wurde ausgeschlossen, weil die ektopische Expression von CUL4A-Flag die Reduktion von CENP-A bei Romeren gerettet , als CUL4A siRNA die 3' - UTR (2A-C) ausgerichtet. Die Proteinniveaus von CENP-A in Gesamtzell - Lysaten wurden bestätigt CENP-A levels in Lysaten von Luc siRNA-transfizierten Zellen unter gleichen Kulturbedingungen ähnlich zu sein , unabhängig von der Zellzyklusstufe (1B, 2G); Somit wird die Möglichkeit, dass CUL4A Verarmungs verursacht CENP-A Proteinabbau wurde eliminiert.

35 und enthält drei Hauptelemente: ein Cullin Gerüst, ein RING - Finger - Protein (RBX1 oder RBX2) und einem Ubiquitin-geladenen E2 Enzym , das durch RBX1 oder RBX2, 36 A RING - Finger - Protein auch ein Substrat rekrutiert Adapter rekrutiert , die Substrate in der Nähe des E2 - Enzym stellt Ubiquitin Transfer zu erleichtern. 36 RBX1 siRNAs induzierte eine signifikante Reduktion der CENP-A an Zentromeren (1D-F) unter den Bedingungen , bei denen die Proteinspiegel von CENP-A in Gesamtzell - Lysaten von RBX1 siRNA-transfizierten Zellen waren ähnlich zu CENP-A levels in Lysaten von Luc siRNA-transfizierten Zellen (Fig 2G). Abbau von CENP-A - Protein entweder durch RBX1 Abreicherung oder durch die Kombination von CUL4A und RBX1 Abreicherung unter den gleichen Kulturbedingungen wurde nicht beobachtet (Abbildung 2G). Die Möglichkeit, Off-Target-Effekts von RBX1 siRNA wurde ausgeschlossen, weil die ektopische Expression von Flag-RBX1 die Reduktion von CENP-A bei Romeren gerettet , als RBX1 siRNA die 3' - UTR (2D-F) ausgerichtet. Diese Befunde legen nahe, dass CUL4A-RBX1-E3-Ligase spezifisch für die Lokalisierung von CENP-A an Zentromeren erforderlich ist.

Immunfluoreszenz - Analyse von exogenen CENP-A - Flag Proteine ​​zeigt an, dass CENP-A K124 Ubiquitinierung für die Lokalisierung von CENP-A bis Romeren von wesentlicher Bedeutung ist
Zuvor unsere Immunpräzipitation-Massenanalyse Spektrometrie zeigte , daß Lysin 124 (K124) von CENP-A-Flag wird in HeLa - Zellen ubiquitiniert. 17 In der Kristallstruktur von dem CENP-A Nukleosomen, befindet K124 in der α3 helix, obwohl die Seite ist , nicht innerhalb der CATD Region. 17 Darüber hinaus ist K124 bei Säugetieren, Vögeln, Eidechsen, Pflanzen konserviert, und eine Gruppe von Pilzen (zB Knospeding Hefe). 17 CENP-A Lysin - Mutanten (3A) wurden konstruiert und getestet , um ihre Fähigkeit , an das Zentromer zu lokalisieren. Wesentliche Aufhebung der Zentromer Lokalisierung von exogenen CENP-A K124R Mutante mit diffuse Signale in sowohl mitotischer und Interphase - HeLa - Zellen beobachtet wurde (3B, C). Zentromer Lokalisation wurde nicht signifikant beeinflusst weder durch K9A Mutationen (K9 entspricht H3 K9 - Methylierung an Histon) noch K77R Mutationen (K77 ist ein einzigartiges Lysin Website in CATD) (3B, C).

Basierend auf diesen Ergebnissen werden zwei Hypothesen über die in vivo - Funktion von CENP-A Ubiquitinierung bei K124 vorgeschlagen. Erstens ist die Rolle von K124 Ubiquitinierung für Ubiquitin-vermittelte Proteolyse überexprimiert und / oder mislocalized CENP-A zu Euchromatin zu beseitigen. Zweitens ist die Rolle von CENP-A Ubiquitinierung auf K124 zum Laden CENP-A an Zentromeren. Um zu testen, die frste Möglichkeit, die Stabilitäten von CENP-A-Flag Wildtyp und der K124R-Mutante sowie endogene CENP-A nach Cycloheximid (CHX) Behandlung von CUL4A- oder RBX1 verarmten Zellen wurden angesprochen. Diese Daten legten nahe , dass Ubiquitinierung von K124 ist wahrscheinlich nicht in Ubiquitin-vermittelte Proteolyse beteiligt zu beseitigen überexprimierten und / oder mislocalized CENP-A (Daten nicht gezeigt). 17. Darüber hinaus wurde bestätigt , dass die K124R - Mutation putative monoubiquitylation und diubiquitylation bands, sowohl in in vivo und in vitro Ubiquitinierung Assays (Daten nicht gezeigt) hebt. 17 Zusammengefasst legen diese Daten nahe , dass die CUL4A-RBX1 Komplex "Signalisierung" Ubiquitinierung trägt, die für CENP-A-Lokalisierung bei Romeren erforderlich ist.

Immunfluoreszenz - Analyse von exogenen Flag - CENP-A - Proteine ​​zeigt an, dass monoubiquitin Fusion ausreichend ist , zu ladenCENP-A K124R bei Romeren
Basierend auf den obigen Ergebnissen wurde angenommen, daß kovalent gebundene monoubiquitin als Signal dient für CENP-A Laden auf Zentromeren. Um diese Hypothese zu testen, eine N-terminale Flag-markiert und C-terminale Ubiquitin-fusionierten Wildtyp - CENP-A und eine K124R - Mutante CENP-A konstruiert wurde (4A). Die monoubiquitin Mutante Ub (K48R), das eine Hauptstelle für Polyubiquitinierung fehlt 37-39 wurde auch Ubiquitin-fusionierten Protein CENP-A , um zu verhindern Potential Polyubiquitinierung verwendet. Durch die Erfassung anti-Flag Immunofluoreszenz-Signale, die Zentromer Lokalisierung von Proteinen, die durch diese Konstrukte codiert wurde getestet. Während Flag-CENP-A (K124) im Wesentlichen außer Kraft gesetzt Zentromer Lokalisierung von CENP-A (4B und 4C, Spalte [6]), die beide Flag-CENP-A (WT) und Flag-CENP-A (WT) -Ub ( WT) behielten ihre Zentromer - Lokalisierung (4B und 4C Spalten [1] und [2]). DasFlag-CENP-A (K124R) -Ub (K48R) Protein vermutlich nachgeahmt monoubiquitylated CENP-A, wie dieses Protein im Wesentlichen die Lokalisierung Romeren wiederhergestellt (4C, vergleichen Spalten [5] und [6]) effizienter als tat CENP-A (K124R) -Ub (WT) (4C, vergleichen Spalten [4] - [6]). Diese Daten zeigten, dass monoubiquitylation für die Rekrutierung von CENP-A bis Romeren ausreichend ist.

Abbildung 1
Abbildung 1. Immunfluoreszenzanalyse von endogenen CENP-A unterstützt die Hypothese , dass CUL4A-E3 - Ligase für die Lokalisierung von CENP-A bis Romeren erforderlich ist ( Die Zahlen wurden von Niikura angepasst et al. 17). (A) CUL4A siRNA induzierte Delokalisierung von CENP-A bei Romeren. HeLa-Zellen wurden mit CUL4A oder Luciferase (Luc) siRNA transfiziert und für 48 Stunden inkubiert (Tabelle 1). Maßstabsbalken entspricht 10 & mgr; m. (B) Western - Blot - Analyse von HeLa Ganzzelllysaten den gleichen Kulturbedingungen wie in (A) verwendet wird . Die Zellen wurden 48 h nach der Transfektion mit CUL4A siRNA oder Luc siRNA (Tabelle 1) geerntet. GAPDH diente als Ladekontrolle. (C) quantifizierte endogene CENP-A Signale an Zentromeren in (A) gezeigt ist . Normalisierung der Signale durchgeführt wurde von Luc siRNA-transfizierten Zellen verwendet, und die mittleren Prozentsätze (± SD) sind gezeigt. **** P <0,0001 vs Luc siRNA-transfizierten Zellen (Student-t-Test). (D) RBX1 siRNA induzierte Delokalisierung von CENP-A von Romeren. HeLa - Zellen wurden mit RBX1 oder Luc siRNA (s) transfiziert und für 72 Stunden (Tabelle 1) inkubiert. Maßstabsbalken entspricht 10 & mgr; m. (E) Western - Blot - Analyse von HeLa Ganzzelllysaten den gleichen Kulturbedingungen wie in (D) verwendet wird . Die Zellen wurden 72 Stunden nach der Transfektion mit RBX1 o geerntetr Luc siRNA (s) (Tabelle 1). GAPDH diente als Ladekontrolle. (F) endogene CENP-A Signale an Zentromeren in (D) quantitativ bestimmt. Normalisierung der Signale durchgeführt wurde von Luc siRNA-transfizierten Zellen verwendet, und die mittleren Prozentsätze (± SD) sind gezeigt. **** P <0,0001 vs Luc siRNA-transfizierten Zellen (t-Test nach Student). Bitte hier klicken , um eine größere Version dieser Figur zu sehen.

Figur 2
Abbildung 2. Ergänzende Informationen im Zusammenhang 1 Zentromer auf Figur (Figuren wurden von Niikura et al angepasst. 17). (A) Exogene CUL4A-Flag die Delokalisierung von CENP-A gerettet , als CUL4A siRNA die 3' - UTR ausgerichtet. HeLa Tet-Off celplus dem Plasmidkonstrukt (pTRM4-CUL4A-Flag oder Vektor; Tabelle 2); ls wurden bei 48 Stunden nach der Cotransfektion mit siRNA (Tabelle 1 3 'UTR Ziel oder Luc CUL4A # 2) festgelegt. 4-Farben-Immunfärbung: Färbung für DAPI (blau); Flagge; endogene CENP-B (rot); und endogene CENP-A (grün), wurde durchgeführt und Flag-positive Zellen wurden sortiert, aber Flag Bilder sind der Einfachheit halber weggelassen. Anmerkung: CUL4A # 2 ist das gleiche Ziel wie die in Figur 1A-C gezeigt. Maßstabsbalken entspricht 10 & mgr; m. (B) Western - Blot - Analyse von HeLa Tet-Off Ganzzelllysaten nach dem gleichen Kulturbedingungen wie in (A) gezeigt ist . GAPDH diente als Ladekontrolle. (C) CENP-A Signale an Zentromeren in (A) gezeigt , durch Mikroskopie nach der Sortierung von Zellen quantifiziert wurden die von einem Anti-Flag - Antikörper gebunden zu isolieren. Normalisierung der Signale wurde mit Zellen, transfiziert mit Luc siRNA sowie Vektor durchgeführt und die Durchschnittsprozentsätzen (± SD) sind gezeigt.**** P <0,0001 vs Zellen , die mit Luc siRNA und Vektor (linke Spalte, Student-t-Test). (D) Exogene Flag-RBX1 rettete die Delokalisierung von CENP-A am Zentromer , wenn RBX1 siRNA die 3' - UTR gezielte . Plus Plasmidkonstrukt (pcDNA3-Flag-RBX1 oder Vektor; Tabelle 2);: HeLa - Zellen wurden bei 72 Stunden nach der Cotransfektion mit siRNA (Tabelle 1 3 'UTR Ziel oder Luc RBX1 # 2) festgelegt. 4-Farben-Immunfärbung: Färbung für DAPI (blau); Flagge; endogene CENP-B (rot); und endogene CENP-A (grün), wurde durchgeführt und Flag-positive Zellen wurden sortiert, aber Flag Bilder sind der Einfachheit halber weggelassen. Maßstabsbalken entspricht 10 & mgr; m. (E) Western - Blot - Analyse von HeLa Ganzzelllysaten nach dem gleichen Kulturbedingungen wie in (D). GAPDH diente als Ladekontrolle. (F) CENP-A Signale an Zentromeren in (D) gezeigt , durch Mikroskopie nach der Sortierung von Zellen quantifiziert wurden diejenigen , die durch a gebunden zu isolieren n Anti-Flag-Antikörper. Normalisierung der Signale wurde mit Zellen, transfiziert mit Luc siRNA sowie Vektor durchgeführt und die Durchschnittsprozentsätzen (± SD) sind gezeigt. **** P <0,0001 vs mit Luc siRNA transfizierten Zellen plus Vektor (linke Spalte, Student-t-Test). (G) Depletion von CUL4A und RBX1 nicht Konzentrationen von endogenem CENP-A - Protein nicht beeinträchtigte. Die Niveaus an endogenem CENP-A-Protein wurden in HeLa Ganzzelllysaten gemessen geerntet 72 Stunden nach der Transfektion mit CUL4A, RBX1, CUL4A und RBX1 oder Luc siRNA. Achtundvierzig Stunden nach der Transfektion wurden die Zellen entweder unbehandelt (Asyn) oder mit Paclitaxel (+ Tax) behandelt Arrest in der Mitose zu induzieren, und sie für 24 h kultiviert. GAPDH diente als Ladekontrolle. Bitte hier klicken , um eine größere Version dieser Figur zu sehen.

32 / 53732fig3highres.jpg "width =" 700 "/>
Abbildung 3. Immunfluoreszenz - Analyse von exogenen CENP-A-Flag - Proteine ​​zeigten , dass CENP-A K124 Ubiquitinierung für CENP-A - Lokalisierung bei Romeren erforderlich ist ( Die Zahlen wurden von Niikura angepasst et al. 17). (A) Die Überexpression von CENP-A- Flag-Konstrukte (WT und KR-Mutanten) wurde durch Western-Blot-Analyse von HeLa Tet-Off Ganzzelllysaten bestätigt. Die Zellen wurden 48 h nach der Transfektion mit pTRM4-CENP-A-Flag WT, KR Mutanten oder pTRM4 Vektors (Tabelle 2) geerntet. Überexpression von CENP-A-Flag wurde durch einen Anti-Flag-Antikörper nachgewiesen. GAPDH diente als Ladekontrolle. Putative CENP-A-Flag-Dimer (##) und CENP-A-Flag-Monomer (#) gezeigt. Hinweis: SDS-resistenten Dimere CENP-A zuvor berichtet wurden 40,41 (B) Die CENP-A K124R Mutante zeigte diffundiert Delokalisierung von Zentromeren.. Die Signale von DAPI (blau), Flagge (grünn) und endogene CENP-B (rot, ein Zentromer Standort Kontrolle) gezeigt. Hinweis: Im Gegensatz zu endogenen CENP-A in Zellen, die mit CUL4A oder RBX1 siRNA, diffuse Signale in Zellen erschienen, die exogene CENP-A K124R-Flagge als Phänotyp der Unfähigkeit zu Romeren ausgerichtet sein überexprimiert wird, vermutlich, weil seine Expression Level 10 ist ungefähr - bis 25-fach höher als die von endogenen CENP-A (Daten nicht gezeigt) 17 Maßstabsbalken entspricht 10 & mgr; m (C) Histogramme der Lokalisierungsmuster in (B) gezeigt... Mehr als 50 pro / Prometaphase und Metaphase - Zellen und mehr als 200 Interphase - Zellen pro Experiment wurden gezählt (n ≥ 3 Versuche). Die mittleren Prozentsätze (± SD) sind gezeigt. "Andere (Non-Zentromer)" gibt meist beschädigte Zellen, tote Zellen oder Zellen mit nucleolar Lokalisation (nur in der Interphase), vermutlich wegen der Transfektion oder andere Behandlungen. *** P <0,001 vs CENP-A WT-Flag (Student-t-Test).

Abbildung 4
Abbildung 4. Immunfluoreszenzanalyse von exogenen Flag-CENP-A - Proteine ​​zeigten , dass CENP-A monoubiquitin Fusion gerettet Delokalisierung der CENP-A K124R - Mutante von Romeren (Zahlen aus Niikura angepasst wurden et al. 17). (A) Schematische Karikaturen von jedem Konstrukt in dieser Studie verwendet wurden (siehe auch Tabelle 2). Die Website K124R-Mutation auf CENP-A (rot) und der K48R Mutationsstelle auf monoubiquitin (blau) dargestellt. (1) WT: Flag-CENP-A WT, (2) WT-Ub (WT): Flag-CENP-A WT-Ub (WT), (3) WT-Ub (K48R): Flag-CENP-A WT -Ub (K48R), (4) K124R-Ub (WT): Flag-CENP-A K124R-Ub (WT), (5) K124R-Ub (K48R): Flag-CENP-A K124R-Ub (K48R), (6) K124R: Flag-CENP-A K124R (B) Exogene CENP-A monoubiquitin Fusion gerettet Delokalisierung der CENP-A K124R - Mutante von Romeren.. DAPI (blau), Flagge (grün) und endogene CENP-B (rot, ein Zentromer Standort Kontrolle) gezeigt. Maßstabsbalken entspricht 10 & mgr; m. (C) Histogramme der Lokalisierungsmuster in (C) gezeigt. Mehr als 50 pro / Prometaphase und Metaphase - Zellen und mehr als 200 Interphase - Zellen pro Experiment wurden gezählt (n ≥ 3 Versuche). Die mittleren Prozentsätze (± SD) sind gezeigt. **** P <0,0001 und *** P <0,001 vs nicht fusionierte Flag-CENP-A K124R (Spalte [6]) (Student-t-Test). Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

siRNA Ziel Anzeige in dieser Studie Zieltyp siRNA Datenbank Nummer Vorwärts-Sequenz (en) Quelle / Referenz
Luziferase (GL3) - 1 Ziel RKK9 CUUACGCUGAGUACUUCGAdTdT Elbashir et al., (2001)
CENP-A CA-UTR siRNA-Pool (2 Ziele Mischung) RKK375 / 5 'UTR t1 CGAGCGGCGCGGACUUCUGCCdTdT Niikura et al., (2015)
RKK383 / 3 'UTR t1 UCCUGCACCCAGUGUUUCUGUdGdT Niikura et al., (2015)
CUL4A # 1 1 Ziel CRKK178 / RKK309 / t1 AGCGAUCGUAAUCAAUCCUGA Niikura et al., (2015)
# 2 (3'UTR) 1 Ziel CRKK181 / RKK331 / T4 AUGCGGGUUUGAAAUAUGACA Niikura et al., (2015)
RBX1 / ROC1 # 1 siRNA-Pool (4 Ziele Mischung) CRKK198 / RKK411 / t1 GAAGCGCUUUGAAGUGAAA Niikura et al., (2015)
CRKK198 / RKK413 / T2 GCAUAGAAUGUCAAGCUAA Niikura et al., (2015)
CRKK198 / RKK415 / T3 GCAAGAAGCGCUUUGAAGU Niikura et al., (2015)
CRKK198 / RKK417 / T4 CAACAGAGAGUGGGAAUUC Niikura et al., (2015)
# 2 (3 'UTR) 1 Ziel CRKK206 / RKK425 / t8 UUCCCUGCUGUUACCUAAUUA Niikura et al., (2015)

Tabelle 1 siRNA Sequenzen in dieser Studie verwendet.

B - Nummer Relevante Eigenschaft (en) Quelle / Referenz
B288 pTRM4 Niikura et al., (2006)
B2067 pTRM4-human CENP-A-Flag Niikura et al., (2015)
B2281 pTRM4-human CENP-A K9A-Flagge Niikura et al., (2015)
B2387 pTRM4-human CENP-A K77R-Flagge Niikura et al., (2015)
B2388 pTRM4-Human CENP-A K124R-Flagge Niikura et al., (2015)
B2512 pTRM4-Flag-human CENP-A Niikura et al., (2015)
B2579 pTRM4-Flag-human CENP-A K124R Niikura et al., (2015)
B2513 pTRM4-Flag-human CENP-A-Ub (WT) Niikura et al., (2015)
B2559 pTRM4-Flag-human CENP-A K124R-Ub (WT) Niikura et al., (2015)
B2515 pTRM4-Flag-human CENP-A-Ub (K48R) Niikura et al., (2015)
B2560 pTRM4-Flag-human CENP-A K124R-Ub (K48R) Niikura et al., (2015)
B2759 pTRM4-human CUL4A-Flagge Niikura et al., (2015)
B2624 pcDNA3-Flag-human RBX1 Niikuraet al., (2015)
B1491 pcDNA3-Flag Niikura et al., (2015)

Tabelle 2 Plasmid - Vektoren in dieser Studie verwendet.

R (anti-CENP-B) Probe b (anti-CENP-B) R Probe (subtrahiert) Ratio (S Beispiel: R Probe) Korrigierte Ratio (S Beispiel: R Probe)
520 514 6 -4,167 0.000
535 445 90 -1,033 0.000
515 431 84 0,274 0,274
562 483 79 0,506 0,506
902 562 340 0,509 0,509
1203 703 500 -0,560 0.000
1014 589 425 -0,819 0.000
768 510 258 -1,345 0.000
555 458 97 -1,845 0.000
781 576 205 -1,146 0.000
556 436 120 0,758 0,758
534 493 41 -1,634 0.000
702 543 159 0,667 0,667
482 429 53 -1.000 0.000 654 531 123 0,740 0,740
1190 607 583 0,384 0,384
552 454 98 0,969 0,969
489 413 76 0,539 0,539
511 452 59 -3,186 0.000
485 475 10 -2,700 0.000
481 441 40 -1,475 0.000
Summe 5,347
Durchschnittlich 0,255
R (anti-CENP-B) ctrl b (anti-CENP-B) Ratio (S - Abfrage: R - Abfrage) Korrigierte Ratio (S - Abfrage: R - Abfrage)
543 483 60 3,017 3,017
526 466 60 2,667 2,667
532 460 72 1,792 1,792
507 457 50 3,520 3,520
491 458 33 4,273 4,273
545 464 81 2,160 2,160
518 484 34 3,559 3,559
461 404 57 2,404 2,404
487 447 40 3,550 3,550
534 477 57 3,965 3,965
528 456 72 3,097 3,097
707 601 106 1,868 1,868
615 528 87 2,828 2,828
660 481 179 1,620 1,620
565 476 89 1,607 1,607
527 455 72 3,583 3,583
560 474 86 2,930 2,930
510 451 59 4,017 4,017
729 586 143 2,678 2,678
634 576 58 3,655 3,655
507 476 31 3,935 3,935
Summe 62,725
Durchschnittlich 2,987
Verbleibende CENP-A Signale bei Zentromer (%) 8.5

. Tabelle 3. Ein Beispiel für die Berechnung der verbleibenden CENP-A - Signale am Zentromer (%) Ein Beispiel für Pro / Prometaphase in 2F gezeigt: Probe ist RBX1 # 2 (3'UTR) + Vec (mittlere Spalte in 2F ) und die Steuerung ist Luc + Vec (linke Spalte in 2F). Als Ergebnis verbleibenden CENP-A Signale anZentromer (%) = (0,255 / 2,987) × 100 = 8,5% (oder [5,347 / 62,725] x mit der gleichen Gesamtzellzahl [dh 21 Zellen] 100 = 8,5% analysiert zwischen zwei Proben) erhalten wird. Beachten Sie, dass , wenn b - Wert mehr als S - Wert ist (dh, wenn subtrahiert Wert negativ ist), korrigierte Verhältniswert auf 0,00 gesetzt ist.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

In den letzten Jahren haben viele Studien unterschiedliche quantitative Mikroskopie - Assays für fixierte Zellen entwickelt. 42 Die Fortschritte in der Biologie Zentromer-Kinetochor erfordert oft ein Verständnis für die Zentromer-spezifischen oder kinetochore spezifische Funktion von Proteinen , von denen subzellulärer räumlich-zeitliche Regulation die wechselnden Funktionen widerspiegelt diese Proteine ​​während des Zellzyklus. Daher entwickelten wir hier Methoden der IIF-Färbung und einer quantitativen IIF-Assay, um spezifisch die relativen Pegel von endogenen und exogenen CENP-A-Proteine ​​zu analysieren, die in unterschiedlich behandelten Proben anwendbar sein kann. Wir erfolgreiche IIF - Färbung von endogenen CENP-I, CENP-H, KNL1, Hec1 und SKA1 mit Protokoll 2 in dieser Studie (siehe Niikura et al 24 und Daten nicht gezeigt. Liste der Materialien / Ausrüstung für die Informationen von Antikörpern) erreicht Aktuell . In Zukunft kann man die gleiche Methode anwenden, die Ebene der verschiedenen Zentromer-Kinetochor Proteine ​​(sowohl ENDOG zu quantifizierenenous und Flag-markierte exogene Proteine), die spezifischen Antikörper der Wahl, jedoch decken unsere IIF Methoden nicht den Nachweis dieser Proteine ​​in lebenden Zellen oder in einer bestimmten einzelnen Zelle während gesamten Zellzyklus. Da diese Verfahren erfordern Zellen auf separaten Deck fixiert und verarbeitet werden, führten wir Referenzsignale (zB ACA oder CENP-B) zum Zweck der Normalisierung , um Signale zwischen den verschiedenen Proben zu ziemlich vergleichen und die Genauigkeit des Tests zu erhöhen. Weil ACA endogene und / oder exogene CENP-A-Signale, CENP-B als ein Referenzsignal für den Zweck der Normalisierung einzubeziehen wäre besser geeignet für einen Vergleich als würde ACA in Bezug auf die Genauigkeit der quantitativen Bestimmung von CENP-A-Signale. Die Amino-terminale Region von CENP-B bindet an das 17 bp-Motiv des CENP-B - Box - Sequenz in alphoid DNA und die carboxy-terminale Region von CENP-B bildet Homodimere. 43,44 CENP-B colokalisieren nicht vollständig mit CENP-A und / oder andere centromere-kinetochore Proteine ​​ist jedoch eng mit ihnen verbunden sind . 45 Während Immunfluoreszenz mit anti-CENP-C - Antikörper typischerweise zwei diskrete Flecken gibt, Färbung mit anti-CENP-B erscheint oft als eine einzige helle Bar verbindet die beiden Schwester Romeren. 46 jedoch in unserer Makromaßstab mikroskopische Beobachtung einige CENP-B-Signale überlappen sich scheinbar mit CENP-A-Signale, insbesondere in früheren mitotischen Stadien (Prophase-Prometaphase als spät Metaphase), die auch teilweise abhängig von dem Beobachtungswinkel und der Art des Fixiermittels verwendet (Daten nicht gezeigt). Im Gegensatz dazu ist in einem quantitativen IIF-Assay von CENP-A-Signale, Proteinlokalisierung von Referenzsignalen nicht durch Abreicherung und / oder Dysfunktion von CENP-A für faire Analyse beeinflusst werden, wenn auch die Lokalisierung der meisten der Zentromer-kinetochore Proteine ​​ist abhängig von CENP-A Lokalisierung an Zentromeren. 47,48 CENP-A-unabhängige kinetochore Anordnung wird durch ersetzen der DNA-Bindungsbereiche von CENP etabliert-C Und CENP-T mit alternativen Chromosom-Targeting - Domänen , die diese Proteine ​​ektoper loci rekrutieren. 49,50 Zusätzlich zeigte jüngsten Arbeiten , dass die inneren kinetochore Komponenten CENP-C und CENP-T Akt parallel die KMN Netzwerk zu rekrutieren Kinetochore. 51-54 Ferner Nishino et al. vorgeschlagen , daß die CENP-TWSX komplexen Formen eine einzigartige Nukleosom artige Struktur zu erzeugen Kontakte mit DNA, die "Histon - Code" erstreckt jenseits canonical Nukleosom Proteine. 55 Da die Zentromer Lokalisierung von CENP- C ist abhängig von der Zentromer Lokalisierung von CENP-A, 47,48 CENP-TWSX oder insbesondere CENP-T könnte eine andere Proteinkandidat (en) werden Referenzsignale in einem quantitativen IIF - Assay von CENP-A bereitzustellen. Jedoch sollte die Kandidaten für Referenzsignal sorgfältig vor dem Assay getestet werden, um zu bestimmen, ob die Lokalisierung an Zentromeren durch Abreicherung und / oder Dysfunktion von CENP-A betroffen ist. Analoge Betrachtungsollte für die quantitative IIF-Assays anderer Zentromer-Kinetochor Proteine ​​genommen werden: Protein-Lokalisierung von Referenzsignalen sollten nicht durch Erschöpfung und / oder Dysfunktion des Zielproteins für eine faire Analyse beeinflusst werden. In der vorangegangenen Studie verwendeten wir ACA als ein Referenzsignal für die quantitative IIF - Assay von anderen zentral äußeren kinetochore Proteinen. 24 ACA eine entsprechende Option als einzelne CENP-B als Positionskontrolle sowie ein Referenzsignal sein könnte, wenn ACA Signale werden nicht durch Abreicherung und / oder Fehlfunktion des Zielproteins aber Kolokalisation des Zielproteins mit CENP-B betroffen ist schlecht, wie oben erwähnt.

Bodor et al. in direktem Verhältnis variiert die Menge an zentromerischen CENP-A auf den zellulären Gehalt berichtet , dass CENP-A Ebenen durch Massenwirkungs zentromerischen reguliert werden, dh. 56 Sie zeigten auch , dass transiente Induktion von CENP-A - Expression auf eine Aufforderung Anstieg in den Zuleitungen Zentromer-CENP-A-Ebene. Umgekehrt wir eine große Zellpopulation mit Zentromer lokalisiert, Flag-markiertes CENP-A WT nach Kotransfektion des pTRM4 Expressionsvektor mit CA-UTR siRNAs (einer Mischung aus 5 'und 3' UTR siRNA; Tabelle 1) beobachtet (Daten nicht gezeigt); Diese Bevölkerung war größer als die nur mit dem pTRM4 Expressionsvektor nach der Transfektion gesehen. Die Höhe der exogenen Flag-markiertes CENP-A-Protein, dessen Expression wurde durch pTRM4 angetrieben wird, betrug etwa 1,0 bis 1,4 Grßenordnungen (10- bis 25-fach) höher als die der endogenen CENP-A (Daten nicht gezeigt). Es wird spekuliert, dass die Expression von exogenen CENP-A WT über einer bestimmten Schwelle negativ auf die richtige zentromerischen Lokalisation beeinflussen könnten.

In den vorliegenden Protokollen ist Fixierung ein kritischer Schritt zelluläre Struktur und Umgebung als proximal Situation wie möglich zu dem nativen Zustand zu halten. Sobald die Zellen fixiert sind, sollte man mit dem Färbungsprotokoll gehen Verlust des Proteins zu vermeiden inteRest oder den Rest der Zelle. Jedoch Fixierung gelegentlich Antigenstellen zerstört und unterschiedliche Antikörper-Antigen - Kombinationen arbeiten schlecht mit einem Fixiermittel, aber sehr gut mit einem anderen. 21 Aufgrund dieser Variante hängt die Wahl des Fixierungs weitgehend auf die Protein (e) von Interesse. Die Zeitdauer der Fixierung kann signifikant die Detektion der Protein (s) beeinflussen durch Immunfärbung und kürzere Fixierung ist im Allgemeinen besser Antigenität beizubehalten. 57 Wenn daher Färbeverfahren für ein neues Ziel von anderen Zentromer-kinetochore Proteine ​​zu bestimmen, insbesondere von ungewisser Lokalisierung, oder wenn sie mit einem neuen Antikörper arbeiten, sollte man verschiedene Methoden der Fixierung und Puffer testen Sie die optimalen Bedingungen zu finden. In den vorliegenden Protokollen, zwei Klassen von populären Fixierungen wurden gewählt: Aldehyd Fixierungen (Protokoll 2) und organischen Lösungsmitteln (Protokolle 3 und 4). Die Reinheit der Fixative ist auch extrem wichtig. In Protokoll 4, 4% Ziegenserum verwendet especially IgG - Rezeptoren auf der Zelloberfläche zu blockieren unspezifischen Hintergrund zu verringern. 57 Im allgemeinen wird das Serum zur Blockierung IgG - Rezeptoren aus einer Spezies in keinem Zusammenhang mit dem primären Antikörper und vorzugsweise von der gleichen Spezies wie der sekundäre Antikörper sein sollte. 57

In jeder der vorliegenden Protokolle, ist die Wahl des primären Antikörpers der wichtigste Schritt in erfolgreichen Immunfärbung zu erreichen. Der Antikörper mit der höchsten Spezifität, Reinheit, Affinität und Avidität erwünscht ist. Eine gute Ausgangskonzentration für monoklonale Antikörper ist in der Regel 1-5 ug / ml. Typische Verdünnungen der Stamm Herstellung von polyklonalen Antikörpern liegen im Bereich von 1:20 bis 1:. 500 57 Eine empirisch für jede Probe die geeignete Konzentration des Primärantikörpers und des Verdünnungsmittels zu bestimmen braucht. Die Proben sanft geschaukelt werden sollte, aber nicht während der Inkubation für homogene Färbung getrocknet. Gründliches Waschen zwischen der Inkubation des primären Antikörpers und Sekundär einntibody erforderlich sein Kreuzreaktion von anderen Spezies mit Immunglobulinen zu vermeiden. Jedoch muss die optimale Waschbedingungen empirisch den Verlust von Zellen zu vermeiden , bestimmt werden, insbesondere mitotische Zellen, die abzurunden und zu lösen , wenn sie geschüttelt (dh mitotischen shake-off). 58 für den Erfolg, muss ein sekundärer Antikörper zu binden , ausgewählt werden , um der primäre Antikörper mit hoher Affinität. Beispielsweise unspezifische Bindung der des sekundären Antikörpers an IgG Fc - Rezeptoren, Fb (ab ') 2 - Fragmente Fc - Teil zu vermeiden , kann anstelle des vollständigen Antikörpers verwendet werden. 57 für viele sekundäre Antikörper kann Inkubationszeit auf 30 min minimiert werden bei RT, um den nicht-spezifischen Hintergrund zu reduzieren.

Neben Protocol 5, Laser-Scanning-konfokale Mikroskopie konnte in Erfassen und Analysieren der Lokalisierung und die Funktion der Zentromer-kinetochore Proteine ​​mit den Fluoreszenzeigenschaften von Vorteil sein. Wie in der Liste der Materialien / Equipme gezeigtnt, Alexa Fluor 488 und Alexa Fluor 594 sind wahrscheinlich die am häufigsten verwendeten Fluoreszenzfarbstoffe in den vorliegenden Protokollen. Zu erfassen zwei und / oder mehrere verschiedene Zentromer-kinetochore Proteine ​​in der Probe, muss man sicherstellen , dass die verwendeten Antikörper , ein Protein zu detektieren nicht die Detektion des zweiten Proteins zu verhindern. 57 in der vorliegenden Protokollen zwei primäre Antikörper gemischt und angewendet gleichzeitig. Jedoch sollte man die Immunfärbungsbedingungen für jedes Protein separat zu optimieren, bevor die primäre oder sekundäre Antikörper zusammen Anwendung: Wenn die beiden Proteine ​​in unmittelbarer Nähe, wie in dem Fall von zwei Zentromer-kinetochore Komponenten sind, eine primäre Antikörper strukturell die Bindung der verhindern kann, zweiten primären Antikörper. Ein weiteres Problem von Mehrfachsignalerfassungs ist das Problem der spektralen Überlappung: die Schwierigkeit in Signal von einem Farbstoff "undichten" in den spektralen Kanal einer anderen zu verhindern. Dieses Problem wird erschwert, conventional Interferenzfilter setzt , wenn die Anzahl von Farbstoffen , erhöht oder wenn die Probe enthält overenhanced Signale (zB ACA oder Anti-Flag - Signale in der vorliegenden Studie), einschließlich der Störung von Autofluoreszenz zu lösen. Fehlerbehebung von Autofluoreszenz wurde in anderen Studien durchgeführt worden. 57,59,60 In der vorliegenden Studie, die in jedem Kanal Fluoreszenzfiltersätze mit Einzel Label - Steuerelemente Optimierung reicht in den meisten Fällen diese Probleme zu vermeiden (siehe unten).

In jeder der vorliegenden Protokolle, sind geeignete Kontrollen unerlässlich. Jeder neue primäre Antikörper sollte gekennzeichnet werden, bevor Immunfärbung beginnt. Die Spezifität des Antikörpers sollte durch Western-Blot-Analyse, wo zutreffend bestätigt werden. Darüber hinaus bestätigt, dass die Färbung nicht durch unspezifische Bindung an die Zelloberfläche verursacht wird, sollte erhalten werden, und die optimalen Arbeits Konzentration eines bestimmten primären Antikörpers sollte durch die Verwendung von seriellen Verdünnungen bestimmt werden,(Dh sollte eine Bindungskurve entwickelt werden). Eine negative Kontrolle (dh die Abwesenheit des primären Antikörpers aus dem Färbeprozess) sollten enthalten sein. Eine andere Möglichkeit der negativen Kontrolle ist die Substitution von normalem IgG von derselben Spezies des primären Antikörpers. Für den Nachweis von mehreren Etiketten, muss man Kontrollen ohne Sekundärantikörper (die Hintergrundsteuerung) sowie Single-Label - Steuerelemente vorbereiten zu Spektralüberlappung Artefakte zu vermeiden (dh Durchbluten, Crossover, Übersprechens oder Farbstoff "undicht" , wie oben beschrieben , ). Man kann den Anteil von "undichten" quantifizieren , indem Signale durch die "falsche" Filter mit dem richtigen Signal, mit diesen Proportionen Vergleich zu entfernen rechnerisch alle "undicht" , und die Berechnung der tatsächlichen Verteilung und / oder Co-Lokalisation von fluoreszierenden Markierung. 60 Die Hintergrundkontrolle sollte unabhängig mit jedem Kanal untersucht werden, um die Grenzen der Signalverstärkung und sein ada Offset einzustellenfür die endgültige Abbildungs ​​PTED. Alle Kanäle, die verwendet wird, um ein Bild eines Multiple-Label-Probe zu erhalten müssen unabhängige Hintergrundkorrektur unterzogen werden, weil das Niveau der Autofluoreszenz in jedem Kanal wesentlich ändert. Die "undichte" Kontrollen wie oben beschrieben wurden, sind erforderlich , um die Menge an Signalverstärkung möglich in jedem Kanal ohne Nachweis "undichte" in benachbarte Kanäle zu bestimmen. 60

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren erklären, dass sie keine finanziellen Interessen haben.

Acknowledgments

Diese Arbeit wurde von NIH Zuschusses GM68418 unterstützt.

Materials

Name Company Catalog Number Comments
Lipofectamin 2000 Life Technologies/Invitrogen 11668 transfection reagent I
Lipofectamin RNAiMAX Life Technologies/Invitrogen 13778 transfection reagent II
Opti-MEM I Life Technologies/Invitrogen 31985 Reduced serum media, warm in 37 °C water bath before use
High-glucose DMEM (Dulbecco’s modified Eagle’s medium) Life Technologies/BioWhittaker 12-604 high-glucose DMEM, warm in 37 °C water bath before use
Fetal Bovine Serum, certified, heat inactivated, US origin Life Technologies/Gibco 10082 FBS (fetal bovine serum)
Poly-L-Lysine SOLUTION SIGMA-SLDRICH P 8920 Poly-L-Lysine, 0.1% w/v, in water
UltraPure Distilled Water Life Technologies/Invitrogen/Gibco 10977 Sterile tissue culture grade water 
Micro Cover glass (22 mm x 22 mm)  Surgipath 105 Cover glass (22 mm x 22 mm) 
6 Well Cell Culture Cluster Fisher/Corning Incorporated 07-200-83 6-well polystyrene plate 
Penicillin, Streptomycin; Liquid Fisher/Gibco 15-140 Penicillin-streptomycin
PAP PEN  Binding Site AD100.1 Hydrophobic barrier pen (for a water repellant barrier in immunofluorescent staining)
Paclitaxel (Taxol) SIGMA-SLDRICH T7402 Taxol for mitotic cell analysis
TN-16, microtubule inhibitor (TN16) Enzo Life Sciences BML-T120 TN16 for mitotic cell analysis
BSA (bovine serum albumin) SIGMA-SLDRICH A7906 Blocking reagent
Triton X-100 SIGMA-SLDRICH T8787 Detergent for permeabilization
Paraformaldehyde SIGMA-SLDRICH P6148 Fixation reagant
DAPI SIGMA-SLDRICH D9542 For nuclear staining
p-phenylenediamine SIGMA-SLDRICH P6001 For mounting medium
VWR Micro Slides, Frosted VWR International 48312-013 Micro slides 
Anti-CENP-A antibody Stressgen/Enzo Life Sciences KAM-CC006 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF), 1:5000 (WB)
Anti-CENP-B antibody Novus Biologicals H00001059-B01P Mouse monoclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-CENP-B antibody  abcam ab25734 Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-centromere antibody (ACA) Fitzgerald Industries International, Inc. 90C-CS1058 Human centromere antiserum; dilution ratio of 1:2000 (IIF)
Anti-CENP-H antibody Bethyl Laboratories BL1112 (A400-007A) Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-H antibody BD 612142 Mouse monoclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-I antibody N/A, Dr. Katusmi Kitagawa N/A, Dr. Katusmi Kitagawa Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF); Niikura et al., Oncogene, 4133-4146 (2006)
Anti-KNL1 antibody Novus Biologicals NBP1-89223 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody Novus Biologicals / GeneTex NB 100-338 / GTX70268 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody GeneTex GTX110735 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Ska1 antibody abcam ab46826 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Flag antibody SIGMA-ALDRICH F3165 Mouse monoclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-Flag antibody SIGMA-ALDRICH F7425 Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-CUL4A antibody N/A, Dr. Pradip Raychaudhuri N/A, Dr. Pradip Raychaudhuri Rabbit polyclonal antibody; dilution ratio of 1:3000 (WB); Shiyanov et al., The Journal of biological chemistry, 35309-35312 (1999)
Anti-RBX1 antibody Cell Signaling 4397 Rabbit polyclonal antibody; dilution ratio of 1:2000 (WB)
Anti-GAPDH antibody Chemicon MAB374 Mouse monoclonal antibody; dilution ratio of 1:5000 (WB)
Alexa Fluor 488 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11001 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11005 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 488 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11008 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11012 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Non fat powdered milk (approved substitution for carnation powdered milk) Fisher Scientific NC9255871 (Reorder No. 190915; Lot# 90629) Skim milk
Leica DM IRE2 motorized fluorescence microscope  Leica motorized fluorescence microscope 
HCX PL APO 63x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PH 3 CS 63X oil immersion lens
HCX PL APO 100x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PHE 100X oil immersion lens
Leica EL6000 compact light source Leica External compact light source for fluorescent excitation
ORCA-R2 Digital CCD camera  Hamamatsu C10600-10B digital CCD camera 
Openlab version 5.5.2 Scientific Imaging Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Velocity version 6.1.1 3D Image Analysis Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Complete EDTA-free protease inhibitor cocktail Roche 11873580001/11836170001 Protease inhibitor cocktail tablets
PlusOne 2-D Quant Kit Amersham Biosciences 80-6483-56 Commercial protein assay reagent I for measurement of protein concentration (compatible with 2% SDS)
Bio-Rad Protein Assay Bio-Rad 500-0006 Commercial protein assay reagent II for measurement of protein concentration (compatible with 0.1% SDS)
Immobilon-FL EMD Millipore IPFL00010 PVDF membrane for transferring
IRDye 800CW Goat Anti-Mouse IgG LI-COR Biosciences 926-32210 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
IRDye 680 Goat Anti-Rabbit IgG LI-COR Biosciences 926-32221 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Mouse IgG DyLight 549 Fisher Scientific PI35507 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Rabbit DyLight 649 Fisher Scientific PI35565 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-mouse IgG-HRP Santa Cruz SC-2005 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Goat anti-rabbit IgG-HRP Santa Cruz SC-2004 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Openlab version 5.5.2. Scientific Imaging Software  Improvision/PerkinElmer Software A
Volocity version 6.3 3D Image Analysis Software (Volocity Acquisition) PerkinElmer Software B1
Volocity version 6.3 3D Image Analysis Software (Volocity Quantification) PerkinElmer Software B2
Branson SONIFIER 450 Sonicator
Branson Ultrasonics sonicator Microtip Step, Solid, Threaded 9.5 mm VWR Scientific Products Inc.  33995-325 Disruptor horn for sonication
Branson Ultrasonics sonicator Microtip Tapered 6.5 mm VWR Scientific Products Inc.  33996-185 Microtip for sonication
Odyssey CLx Infrared imaging System  LI-COR Biosciences Infrared imaging system for immunoblot detection
Image Studio Analysis Software Ver 4.0  LI-COR Biosciences Software C
Molecular Imager Versadoc MP4000 System  Bio-Rad Chemiluminescence imager for immunoblot detection
Quantity One 1-D analysis software  Bio-Rad Software D
SuperSignal West Femto Maximum Sensitivity Substrate Thermo 34095 Ultra-sensitive enhanced chemiluminescent (ECL) substrate

DOWNLOAD MATERIALS LIST

References

  1. DeLuca, J. G., et al. Hec1 and nuf2 are core components of the kinetochore outer plate essential for organizing microtubule attachment sites. Molecular biology of the cell. 16, 519-531 (2005).
  2. Earnshaw, W. C., Halligan, N., Cooke, C., Rothfield, N. The kinetochore is part of the metaphase chromosome scaffold. J Cell Biol. 98, 352-357 (1984).
  3. Hoffman, D. B., Pearson, C. G., Yen, T. J., Howell, B. J., Salmon, E. D. Microtubule-dependent changes in assembly of microtubule motor proteins and mitotic spindle checkpoint proteins at PtK1 kinetochores. Molecular biology of the cell. 12, 1995-2009 (2001).
  4. Regnier, V., et al. CENP-A is required for accurate chromosome segregation and sustained kinetochore association of BubR1. Mol Cell Biol. 25, 3967-3981 (2005).
  5. Bernad, R., Sanchez, P., Losada, A. Epigenetic specification of centromeres by CENP-A. Exp Cell Res. 315, 3233-3241 (2009).
  6. Black, B. E., Cleveland, D. W. Epigenetic centromere propagation and the nature of CENP-a nucleosomes. Cell. 144, 471-479 (2011).
  7. Warburton, P. E., et al. Immunolocalization of CENP-A suggests a distinct nucleosome structure at the inner kinetochore plate of active centromeres. Curr Biol. 7, 901-904 (1997).
  8. Karpen, G. H., Allshire, R. C. The case for epigenetic effects on centromere identity and function. Trends Genet. 13, 489-496 (1997).
  9. Black, B. E., et al. Structural determinants for generating centromeric chromatin. Nature. 430, 578-582 (2004).
  10. Black, B. E., et al. Centromere identity maintained by nucleosomes assembled with histone H3 containing the CENP-A targeting domain. Mol Cell. 25, 309-322 (2007).
  11. Fachinetti, D., et al. A two-step mechanism for epigenetic specification of centromere identity and function. Nat Cell Biol. 15, 1056-1066 (2013).
  12. Zeitlin, S. G., Shelby, R. D., Sullivan, K. F. CENP-A is phosphorylated by Aurora B kinase and plays an unexpected role in completion of cytokinesis. The Journal of cell biology. 155, 1147-1157 (2001).
  13. Zhang, X., Li, X., Marshall, J. B., Zhong, C. X., Dawe, R. K. Phosphoserines on maize CENTROMERIC HISTONE H3 and histone H3 demarcate the centromere and pericentromere during chromosome segregation. The Plant cell. 17, 572-583 (2005).
  14. Goutte-Gattat, D., et al. Phosphorylation of the CENP-A amino-terminus in mitotic centromeric chromatin is required for kinetochore function. Proc Natl Acad Sci U S A. 110, 8579-8584 (2013).
  15. Bailey, A. O., et al. Posttranslational modification of CENP-A influences the conformation of centromeric chromatin. Proc Natl Acad Sci U S A. 110, 11827-11832 (2013).
  16. Samel, A., Cuomo, A., Bonaldi, T., Ehrenhofer-Murray, A. E. Methylation of CenH3 arginine 37 regulates kinetochore integrity and chromosome segregation. Proc Natl Acad Sci U S A. 109, 9029-9034 (2012).
  17. Niikura, Y., et al. CENP-A K124 Ubiquitylation Is Required for CENP-A Deposition at the Centromere. Dev Cell. (2015).
  18. Chan, G. K., Liu, S. T., Yen, T. J. Kinetochore structure and function. Trends in cell biology. 15, 589-598 (2005).
  19. Hori, T., Okada, M., Maenaka, K., Fukagawa, T. CENP-O class proteins form a stable complex and are required for proper kinetochore function. Molecular biology of the cell. 19, 843-854 (2008).
  20. Fukagawa, T., Earnshaw, W. C. The centromere: chromatin foundation for the kinetochore machinery. Developmental cell. 30, 496-508 (2014).
  21. Kedersha, N. The Proteintech Blog.Proteintech. Grainger, D. Proteintech Group. (2012).
  22. Clontech Laboratories, Inc. HeLa Tet-Off Advanced Cell Line. Available from: http://www.clontech.com/CR/Products/Inducible_Systems/Tetracycline-Inducible_Expression/ibcGetAttachment.jsp?cItemId=26908&fileId=6712191&sitex=10020:22372:US (2012).
  23. Meraldi, P., Sorger, P. K. A dual role for Bub1 in the spindle checkpoint and chromosome congression. EMBO J. 24, 1621-1633 (2005).
  24. Niikura, Y., et al. 17-AAG, an Hsp90 inhibitor, causes kinetochore defects: a novel mechanism by which 17-AAG inhibits cell proliferation. Oncogene. 25, 4133-4146 (2006).
  25. Yang, Z., et al. Silencing mitosin induces misaligned chromosomes, premature chromosome decondensation before anaphase onset, and mitotic cell death. Mol Cell Biol. 25, 4062-4074 (2005).
  26. Wang, H., et al. Histone H3 and H4 ubiquitylation by the CUL4-DDB-ROC1 ubiquitin ligase facilitates cellular response to DNA damage. Mol Cell. 22, 383-394 (2006).
  27. Lamb, J. R., Tugendreich, S., Hieter, P. Tetratrico peptide repeat interactions: to TPR or not to TPR? Trends Biochem Sci. 20, 257-259 (1995).
  28. Kitagawa, K., Skowyra, D., Elledge, S. J., Harper, J. W., Hieter, P. SGT1 encodes an essential component of the yeast kinetochore assembly pathway and a novel subunit of the SCF ubiquitin ligase complex. Mol Cell. 4, 21-33 (1999).
  29. Niikura, Y., Dixit, A., Scott, R., Perkins, G., Kitagawa, K. BUB1 mediation of caspase-independent mitotic death determines cell fate. J Cell Biol. 178, 283-296 (2007).
  30. Niikura, Y., Kitagawa, K. Identification of a novel splice variant: human SGT1B (SUGT1B). DNA Seq. 14, 436-441 (2003).
  31. Niikura, Y., Ogi, H., Kikuchi, K., Kitagawa, K. BUB3 that dissociates from BUB1 activates caspase-independent mitotic death (CIMD). Cell Death Differ. 17, 1011-1024 (2010).
  32. Ando, S., Yang, H., Nozaki, N., Okazaki, T., Yoda, K. CENP-A, -B, and -C chromatin complex that contains the I-type alpha-satellite array constitutes the prekinetochore in HeLa cells. Mol Cell Biol. 22, 2229-2241 (2002).
  33. Izuta, H., et al. Comprehensive analysis of the ICEN (Interphase Centromere Complex) components enriched in the CENP-A chromatin of human cells. Genes to cells : devoted to molecular & cellular mechanisms. 11, 673-684 (2006).
  34. Obuse, C., et al. Proteomics analysis of the centromere complex from HeLa interphase cells: UV-damaged DNA binding protein 1 (DDB-1) is a component of the CEN-complex, while BMI-1 is transiently co-localized with the centromeric region in interphase. Genes Cells. 9, 105-120 (2004).
  35. Merlet, J., Burger, J., Gomes, J. E., Pintard, L. Regulation of cullin-RING E3 ubiquitin-ligases by neddylation and dimerization. Cell Mol Life Sci. 66, 1924-1938 (2009).
  36. Bennett, E. J., Rush, J., Gygi, S. P., Harper, J. W. Dynamics of cullin-RING ubiquitin ligase network revealed by systematic quantitative proteomics. Cell. 143, 951-965 (2010).
  37. Antonelli, A., et al. Efficient inhibition of macrophage TNF-alpha production upon targeted delivery of K48R ubiquitin. Br J Haematol. 104, 475-481 (1999).
  38. Codomo, C. A., Furuyama, T., Henikoff, S. CENP-A octamers do not confer a reduction in nucleosome height by AFM. Nat Struct Mol Biol. 21, 4-5 (2014).
  39. Thrower, J. S., Hoffman, L., Rechsteiner, M., Pickart, C. M. Recognition of the polyubiquitin proteolytic signal. The EMBO journal. 19, 94-102 (2000).
  40. Yoda, K., et al. Human centromere protein A (CENP-A) can replace histone H3 in nucleosome reconstitution in vitro. Proc Natl Acad Sci U S A. 97, 7266-7271 (2000).
  41. Shelby, R. D., Vafa, O., Sullivan, K. F. Assembly of CENP-A into centromeric chromatin requires a cooperative array of nucleosomal DNA contact sites. J Cell Biol. 136, 501-513 (1997).
  42. Majumder, S., Fisk, H. A. Quantitative immunofluorescence assay to measure the variation in protein levels at centrosomes. J Vis Exp. (2014).
  43. Masumoto, H., Masukata, H., Muro, Y., Nozaki, N., Okazaki, T. A human centromere antigen (CENP-B) interacts with a short specific sequence in alphoid DNA, a human centromeric satellite. J Cell Biol. 109, 1963-1973 (1989).
  44. Yoda, K., Kitagawa, K., Masumoto, H., Muro, Y., Okazaki, T. A human centromere protein, CENP-B, has a DNA binding domain containing four potential alpha helices at the NH2 terminus, which is separable from dimerizing activity. J Cell Biol. 119, 1413-1427 (1992).
  45. Sugata, N., et al. Human CENP-H multimers colocalize with CENP-A and CENP-C at active centromere--kinetochore complexes. Hum Mol Genet. 9, 2919-2926 (2000).
  46. Earnshaw, W. C., Ratrie, H. 3rd, Stetten, G. Visualization of centromere proteins CENP-B and CENP-C on a stable dicentric chromosome in cytological spreads. Chromosoma. 98, 1-12 (1989).
  47. Goshima, G., Kiyomitsu, T., Yoda, K., Yanagida, M. Human centromere chromatin protein hMis12, essential for equal segregation, is independent of CENP-A loading pathway. J Cell Biol. 160, 25-39 (2003).
  48. Liu, S. T., Rattner, J. B., Jablonski, S. A., Yen, T. J. Mapping the assembly pathways that specify formation of the trilaminar kinetochore plates in human cells. J Cell Biol. 175, 41-53 (2006).
  49. Gascoigne, K. E., Cheeseman, I. M. T time for point centromeres. Nat Cell Biol. 14, 559-561 (2012).
  50. Gascoigne, K. E., et al. Induced ectopic kinetochore assembly bypasses the requirement for CENP-A nucleosomes. Cell. 145, 410-422 (2011).
  51. Nishino, T., et al. CENP-T provides a structural platform for outer kinetochore assembly. EMBO J. 32, 424-436 (2013).
  52. Malvezzi, F., et al. A structural basis for kinetochore recruitment of the Ndc80 complex via two distinct centromere receptors. EMBO J. 32, 409-423 (2013).
  53. Schleiffer, A., et al. CENP-T proteins are conserved centromere receptors of the Ndc80 complex. Nat Cell Biol. 14, 604-613 (2012).
  54. Rago, F., Gascoigne, K. E., Cheeseman, I. M. Distinct organization and regulation of the outer kinetochore KMN network downstream of CENP-C and CENP-T. Curr Biol. 25, 671-677 (2015).
  55. Nishino, T., et al. CENP-T-W-S-X forms a unique centromeric chromatin structure with a histone-like fold. Cell. 148, 487-501 (2012).
  56. Bodor, D. L., et al. The quantitative architecture of centromeric chromatin. Elife. 3, e02137 (2014).
  57. Oliver, C. Ch 58. Molecular Biomethods Handbook. Rapely, R., Walker, J. M. Humana Press. 1063-1079 (2008).
  58. Terasima, T., Tolmach, L. J. Changes in x-ray sensitivity of HeLa cells during the division cycle. Nature. 190, 1210-1211 (1961).
  59. Levenson, G. B. R. Ch 8. Biomedical Photonics Handbook. Vo-Dinh, T. uan CRC Press LLC. 8-19 (2003).
  60. Sanderson, J. Fluorescence bleed-though. Available from: http://www.gum2012.fionastoreydesign.co.uk/Downloads/Bleed through text.pdf (2011).
Immunofluoreszenz-Analyse von endogener und exogener Zentromer-Proteine ​​kinetochore
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).More

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter