Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

अंतर्जात के immunofluorescence विश्लेषण और exogenous गुणसूत्रबिंदु-kinetochore प्रोटीन

Published: March 3, 2016 doi: 10.3791/53732

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

"Centromeres" प्रतिष्ठित आनुवंशिकी में दबा दिया meiotic पुनर्संयोजन के क्षेत्रों के रूप में परिभाषित किया गया और बाद में mitotic गुणसूत्रों के प्राथमिक कसना है, जो बँटवारा दौरान सटीक गुणसूत्र अलगाव में एक आवश्यक भूमिका निभाता है के रूप में मान्यता दी। "गुणसूत्रबिंदुओं" बहुपरती संरचनाओं कि centromeres की सतह पर सूक्ष्मनलिकाएं करने के लिए बाध्य, के रूप में इलेक्ट्रॉन माइक्रोस्कोपी द्वारा पता चला है के रूप में वर्णित किया गया; "गुणसूत्रबिंदुओं" बाद में macromolecular जटिल है कि mitotic गुणसूत्रों के गुणसूत्रबिंदु पर localizes के रूप में परिभाषित किया गया। रीढ़ के बीच centromeric डीएनए दृश्यों का एक नाटकीय विचलन के बावजूद, kinetochore संरचना और संरचना अत्यधिक संरक्षित कर रहे हैं। धुरी सूक्ष्मनलिकाएं और kinetochore के बीच एक गतिशील बातचीत बँटवारा दौरान गुणसूत्रों के वफादार अलगाव के लिए आवश्यक है, और aneuploidy और इस तरह के कैंसर के लिए गुणसूत्रबिंदु-kinetochore समारोह नेतृत्व में दोष है।

सबसे eukaryotes में गुणसूत्रबिंदुकोई परिभाषित डीएनए अनुक्रम है, लेकिन दोहराए alphoid 171-बीपी α-उपग्रह डीएनए से मिलकर डीएनए की बड़ी सरणियों (.3-5 एमबी) से बना है। नवोदित खमीर में छोड़कर, गुणसूत्रबिंदु पहचान डीएनए अनुक्रम से नहीं बल्कि एक विशेष nucleosome कि हिस्टोन H3 संस्करण CenH3 शामिल की मौजूदगी से हासिल की है (गुणसूत्रबिंदु एक प्रोटीन [CENP-ए] मानव में)। 5 CENP-ए nucleosomes को स्थानीय बनाना स्तनधारी गुणसूत्रबिंदुओं 7 और 171-बी पी α-उपग्रह डीएनए के लिए बाँध के भीतरी थाली। सक्रिय centromeres आवश्यकता CENP-ए-युक्त nucleosomes एक विधान गुणसूत्रबिंदु जुड़े नेटवर्क (CCAN) और kinetochore प्रोटीन की भर्ती करने के लिए प्रत्यक्ष, जो एक साथ धुरी जांच की चौकी के माध्यम से mitotic धुरा और बाद में चक्र प्रगति के गुणसूत्रों की कुर्की विनियमित।

ऊपर साक्ष्य के आलोक में, CENP-ए गुणसूत्रबिंदु 8 की epigenetic मार्क किए जाने का प्रस्ताव किया गया है; हालांकि, इस प्रक्रिया है जिसके द्वारा CENP-ए मैं शामिल हैNto centromeric डीएनए और कारकों इस समावेश के लिए जिम्मेदार अभी तक अच्छी तरह से होती नहीं किया गया है। एक छोटी-गुणसूत्रबिंदु को निशाना डोमेन (CATD) हिस्टोन में रहता है CENP-ए का क्षेत्र गुना, और CATD साथ H3 की इसी क्षेत्र के प्रतिस्थापन गुणसूत्रबिंदु के लिए सीधी H3 करने के लिए पर्याप्त है। 9 कई अध्ययनों बाद translational के लिए कार्यात्मक भूमिका का सुझाव दिया संशोधन CENP-ए 12-16 की (PTM); हालांकि, centromeres पर भर्ती में CENP-ए का इन PTMs के आणविक तंत्र अभी तक स्पष्ट नहीं किया गया है। हम पहले से सूचित किया है कि CUL4A-RBX1-COPS8 E3 ligase गतिविधि CENP-ए K124 ubiquitylation और centromeres को CENP-ए का स्थानीयकरण के लिए आवश्यक है। 17

खोज और kinetochore प्रोटीन के लक्षण वर्णन गुणसूत्र अलगाव के बारे में नई जानकारी के लिए मार्ग प्रशस्त किया है। 18 अधिक 100 से kinetochore घटकों विभिन्न दृष्टिकोणों से कशेरुकी कोशिकाओं में पहचान की गई है। 19,20 के तहत एकप्रतिदीप्ति माइक्रोस्कोपी में। कैसे गुणसूत्रबिंदुओं इकट्ठा और समारोह भी कोशिकाओं के भीतर प्रत्येक गुणसूत्रबिंदु-kinetochore प्रोटीन और प्रोटीन, प्रोटीन नेटवर्क के सेलुलर कार्यों के लक्षण वर्णन से आता है के खड़े 19 प्रत्यक्ष दृश्य और उन्नत इमेजिंग तरीकों गुणसूत्रबिंदु-kinetochore घटकों की उल्लेखनीय संकल्प प्रदान और अनुमति centromeres और गुणसूत्रबिंदुओं के विशिष्ट आणविक घटकों के प्रत्यक्ष अवलोकन। इसके अलावा, अप्रत्यक्ष immunofluorescent के तरीकों (आईआईएफ) विशिष्ट एंटीबॉडी का उपयोग धुंधला इन टिप्पणियों के लिए महत्वपूर्ण हैं। हालांकि, IIF प्रोटोकॉल, कुछ विशिष्ट गुणसूत्रबिंदु-kinetochore प्रोटीन के विस्तार में चर्चा की समस्याओं के बारे में कई रिपोर्टों के बावजूद। 1-4 इस प्रकार, विकासशील और रिपोर्टिंग IIF धुंधला हो जाना और एक मात्रात्मक IIF परख के तरीकों विशेष रूप से प्रत्येक गुणसूत्रबिंदु-kinetochore प्रोटीन का विश्लेषण करने के लिए अत्यंत महत्वपूर्ण है। IIF धुंधला में, एक ब्याज की प्रोटीन के नुकसान से बचने के लिए धुंधला प्रोटोकॉल के साथ आगे बढ़ना चाहिए यासेल के बाकी। हालांकि, कभी कभी निर्धारण प्रतिजनी साइटों को नष्ट कर देता है, और विभिन्न एंटीबॉडी प्रतिजन संयोजन एक लगानेवाला के साथ खराब काम करते हैं, लेकिन बहुत अच्छी तरह से एक, 21 और लगानेवाला के विकल्प के साथ बड़े पैमाने पर ब्याज की प्रोटीन (ओं) पर निर्भर करता है। इसलिए, विभिन्न तरीकों लगानेवाला गुणसूत्रबिंदु-kinetochore प्रोटीन के IIF धुंधला में महत्वपूर्ण हैं।

अप्रत्यक्ष immunofluorescent (आईआईएफ) धुंधला हो जाना और CENP-ए और फ्लैग टैग बहिर्जात CENP-ए प्रोटीन, और मानव कोशिकाओं में इन प्रोटीनों की quantitation सहित अंतर्जात गुणसूत्रबिंदु-kinetochore प्रोटीन, के स्थानीयकरण संबोधित करने के लिए एक परख के यहां अनुकूलित तरीके विकसित किया गया है। इन विधियों अन्य प्रजातियों में गुणसूत्रबिंदु-kinetochore प्रोटीन का विश्लेषण करने के लिए लागू किया जा सकता है।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. सेल संस्कृति और अभिकर्मक

  1. 6 अच्छी तरह से polystyrene थाली में एक गिलास को कवर (22 मिमी x 22 मिमी) रखो। वैकल्पिक रूप से कोट पाली एल Lysine के साथ एक कवर ग्लास, 0.1% w / वी, पानी में (सामग्री / उपकरण की सूची देखें) कवर कांच नीचे चरणों का पालन करने पर mitotic कोशिकाओं रखने के लिए:
    नोट: इष्टतम स्थितियों प्रत्येक कोशिका लाइन और आवेदन के लिए निर्धारित किया जाना चाहिए।
    1. पानी में पाली एल Lysine, 0.1% w / वी, साथ Aseptically कोट संस्कृति सतह (0.4 मिलीग्राम / अच्छी तरह से 6 अच्छी तरह से polystyrene प्लेट)। धीरे रॉक संस्कृति की सतह का भी कोटिंग सुनिश्चित करने के लिए।
    2. 5 मिनट के बाद, आकांक्षा से समाधान निकालने और अच्छी तरह से बाँझ टिशू कल्चर ग्रेड पानी के साथ सतह कुल्ला।
    3. कोशिकाओं और मध्यम शुरू करने से पहले सूखे कम से कम 2 घंटा।
  2. बीज हेला कोशिकाओं 17 या हेला Tet-बंद कोशिकाओं 17,22 एक कवर ग्लास (22 मिमी x 22 मिमी) 6 अच्छी तरह से polystyrene प्लेट में डाल दिया है। जाँच करें कि सेल घनत्व 5.4 x 10 5 प्रति अच्छी तरह से है। संस्कृति कोशिकाओं10% FBS और 1% पेनिसिलिन स्ट्रेप्टोमाइसिन के साथ उच्च ग्लूकोज DMEM में।
    नोट: इष्टतम परिणामों के लिए, अनुभव से बोने में उपयोग करने के लिए सेल घनत्व का निर्धारण।
  3. 18 घंटे के लिए 5% सीओ 2 के माहौल में 37 डिग्री सेल्सियस पर कोशिकाओं को सेते हैं।
    नोट: हेला Tet-बंद कोशिकाओं के मामले में, बहिर्जात जीन के प्रतिलेखन inducer (यानी, टेट्रासाइक्लिन / डॉक्सीसाइक्लिन) के बिना टेट्रासाइक्लिन / डॉक्सीसाइक्लिन इसलिए संस्कृति कोशिकाओं के अभाव में सक्रिय है और pTRM4 overexpression वेक्टर (तालिका 2 के साथ क्षणिक transfect ), जिसका प्रतिलेखन TRE प्रमोटर द्वारा नियंत्रित किया जाता है (देखें नीचे)।
  4. बोने, transfect कोशिकाओं के बाद अठारह घंटे इस प्रकार है:
    1. (20 माइक्रोन annealed शेयर, 1 टेबल) 1.5 μl siRNA oligo मिश्रण से समाधान एक मेकअप और / या 2.0 माइक्रोग्राम प्लाज्मिड (तालिका 2) 50 μl कम हो सीरम माध्यम में (सामग्री / उपकरण की सूची देखें), और 5 मिनट के लिए आरटी पर सेते ।
      नोट: इस विश्लेषण में,सीए-UTR siRNAs (5 का एक मिश्रण 'और 3' UTR siRNA, 1 टेबल) सह ट्रांसफ़ेक्ट प्रोटोकॉल 3 और 4 (चर्चा देखने के लिए) में इस्तेमाल के लिए थे।
    2. 0.75 μl अभिकर्मक अभिकर्मक मैं सीरम मध्यम कम कर 50 μl में (सामग्री / उपकरण की सूची देखें), और 5 मिनट के लिए आरटी पर सेते मिश्रण से समाधान बी बनाओ।
      नोट: एक वैकल्पिक कदम अभिकर्मक अभिकर्मक द्वितीय μl 1.0 के अतिरिक्त है (सामग्री / उपकरण की सूची देखें)।
    3. एक साथ समाधान ए और बी मिक्स, और 15 मिनट के लिए आरटी पर सेते हैं।
    4. पीबीएस के साथ एक बार सुसंस्कृत कोशिकाओं को धो लें, और फिर 6 अच्छी तरह से polystyrene थाली के प्रत्येक अच्छी तरह से करने के लिए सीरम मध्यम कम कर 500 μl जोड़ें। व्यक्तिगत अच्छी तरह से प्रत्येक के लिए सीधे समाधान ए और बी (यानी, शाही सेना और / या डीएनए लिपिड जटिल) का मिश्रण जोड़ें।
      नोट: अंतिम एकाग्रता 3.3 माइक्रोग्राम / एमएल (प्लाज्मिड) है; 50 एनएम (siRNA)।
    5. 4.5 घंटे के लिए 5% सीओ 2 के माहौल में 37 डिग्री सेल्सियस पर कोशिकाओं को सेते हैं। उच्च ग्लूकोज DMEM बुद्धि के लिए मध्यम बदलेंh 10% FBS और 1% पेनिसिलिन स्ट्रेप्टोमाइसिन।
    6. अभिकर्मक के बाद 48-72 घंटे के लिए 5% सीओ 2 के माहौल में 37 डिग्री सेल्सियस पर कोशिकाओं को सेते हैं।
      नोट: इष्टतम परिणामों के लिए, निर्धारण से पहले सेल के विकास के लिए ऊष्मायन अवधि के अनुभव से निर्धारित किया जाना चाहिए, और प्रोटीन की कमी और / या अभिव्यक्ति पश्चिमी धब्बा विश्लेषण द्वारा पुष्टि की जानी चाहिए (प्रोटोकॉल 6 देखें)।
    7. mitotic सेल विश्लेषण ब्याज की है, तो पैक्लिटैक्सेल (10 एनएम) संवर्धित कोशिकाओं को निर्धारण से पहले 24 घंटा जोड़ने के लिए, या निर्धारण से पहले संवर्धित कोशिकाओं 2.5 घंटा TN16 (0.5 माइक्रोन) के जोड़ें।

2. सेल फिक्सेशन और Immunofluorescent धुंधला अंतर्जात गुणसूत्रबिंदु-kinetochore प्रोटीन का पता लगाने के लिए (paraformaldehyde निर्धारण)

  1. लगानेवाला, buffers, और अभिकर्मकों की तैयारी।
    1. हौसले पीबीएस, 7.4 पीएच में 4% paraformaldehyde समाधान के 50 मिलीलीटर की तैयारी।
      1. एक हवादार हुड में एक हलचल प्लेट पर एक गिलास बीकर 1 × पीबीएस के 40 मिलीलीटर जोड़ें। हीट जबकि stirrinलगभग 60 डिग्री सेल्सियस के लिए जी। paraformaldehyde पाउडर के 2 जी गर्म पीबीएस में जोड़े।
      2. धीरे-धीरे, कुल में 1 एन NaOH के 1 मिलीलीटर जोड़कर पीएच उठाएँ क्योंकि पाउडर तुरंत भंग नहीं होगी।
        नोट: समाधान NaOH के अलावा के बाद साफ करता है।
      3. एक बार जब paraformaldehyde, शांत भंग कर दिया और समाधान फिल्टर है।
      4. 7.4 पीएच 1 एन एचसीएल के साथ पीएच और 50 मिलीलीटर के लिए 1 × पीबीएस के साथ समाधान की मात्रा समायोजित करें।
        नोट: समाधान के Aliquots जमे हुए या रूप में लंबे समय के रूप में 1 सप्ताह के लिए 2-8 डिग्री सेल्सियस पर संग्रहित किया जा सकता है। समाधान ठंडा या 4 डिग्री सेल्सियस पर संग्रहित किया जाना चाहिए जब तक यह प्रयोग किया जा रहा है।
    2. बफर KB1, 10 मिमी Tris एचसीएल, पीएच 7.5 के होते हैं जिनमें से 50 मिलीलीटर की तैयारी; 150 मिमी NaCl; 0.5% बीएसए; और 0.5% ट्राइटन X-100।
      नोट: बीएसए हौसले से जोड़ा जाना चाहिए।
      नोट: बफर केबी सीरीज बफर पिछली रिपोर्टों में वर्णित KB पर आधारित हैं 1,2,4।
    3. बफर KB2, 10 मिमी Tris एचसीएल के होते हैं जिनमें से 50 मिलीलीटर की तैयारीपीएच 7.5; 150 मिमी NaCl; और 0.5% BSA।
      नोट: बीएसए हौसले से जोड़ा जाना चाहिए।
    4. बफर DAPI (50 एनजी / एमएल) युक्त KB3 के 1 मिलीलीटर तैयार करें।
    5. 1 मिलीग्राम / एमएल पी PHENYLENEDIAMINE के होते हैं जो बढ़ते मध्यम, की 100 मिलीलीटर की तैयारी; 10% पीबीएस, और 90% ग्लिसरॉल।
      1. 1 एन NaOH के साथ 9.8 के लिए 1 × पीबीएस के पीएच को समायोजित समाधान में पी-PHENYLENEDIAMINE भंग, और फिर ग्लिसरॉल जोड़ें।
      2. स्टोर -80 डिग्री सेल्सियस पर 1 मिलीलीटर aliquots। लाइट से बचाएँ।
  2. 48-72 घंटा के बाद अभिकर्मक (1 प्रोटोकॉल देखें) सेल निर्धारण के लिए कम से आकांक्षा से संस्कृति के माध्यम से निकालें। पीबीएस के साथ एक बार कुल्ला कोशिकाओं। संस्कृति कुओं की ओर करने के लिए पीबीएस लागू कोशिकाओं की सतह को परेशान करने से बचने के लिए।
    नोट: सेल निर्धारण के लिए इष्टतम समय बिंदु अनुभव से निर्धारित किया जाना चाहिए।
  3. 4 डिग्री सेल्सियस पर 30 मिनट के लिए पीबीएस में 4% paraformaldehyde में कोशिकाओं को ठीक करें। बफर KB2 के साथ दो बार कोशिकाओं कुल्ला पर्याप्त अवशिष्ट 4% paraformaldehyde हटा दें।
  4. Permeabiआरटी पर 30 मिनट के लिए बफर KB1 में नमूने Lize। बफर KB2 के साथ एक बार कोशिकाओं कुल्ला, और अविशिष्ट बंधन के अतिरिक्त ब्लॉक साइटों के लिए आरटी पर 5 मिनट के लिए बफर KB2 जोड़ें।
    नोट: बफर KB1 भी अवरुद्ध करने के लिए काफी योगदान देता है।
  5. 6 अच्छी तरह से polystyrene संदंश का उपयोग थाली से एक गिलास को कवर (22 मिमी x 22 मिमी) निकालें। एक हाइड्रोफोबिक बाधा पेन का उपयोग (सामग्री / उपकरण की सूची देखें), प्रत्येक कवर गिलास नमूना के चारों ओर एक हाइड्रोफोबिक बाधा फार्म के लिए एक हरे रंग पीला वर्ग या वृत्त खींचना। स्पर्श या न हाइड्रोफोबिक बाधा कलम के साथ कोशिकाओं को भी बंद मिलता है। नई 6 अच्छी तरह से polystyrene थाली में कांच कवर रखो।
  6. (; भी सामग्री / उपकरण की सूची देखें: 200: 100 1 के लिए 1 के कमजोर पड़ने अनुपात) और या तो एक विरोधी CENP-बी एंटीबॉडी (1 के कमजोर पड़ने अनुपात: 400) या एक विरोधी एक प्राथमिक गुणसूत्रबिंदु करने के लिए या एंटीबॉडी kinetochore प्रोटीन पतला गुणसूत्रबिंदु एंटीबॉडी (एसीए) (1 के कमजोर पड़ने अनुपात: 2,000) बफर KB2 में एक गुणसूत्रबिंदु स्थान मार्कर के रूप में।
    नोट: इष्टतम परिणामों के लिए, अंतिम concentraइस समाधान में प्राथमिक एंटीबॉडी के tion अनुभव से निर्धारित किया जाना चाहिए।
  7. सेल नमूना विसर्जित करने के लिए पतला प्राथमिक एंटीबॉडी की पर्याप्त मात्रा (सीए 30 μl) को लागू करें। 37 डिग्री सेल्सियस पर 1 घंटे के लिए सेल नमूना सेते हैं। कोशिकाओं बफर KB2 के साथ 3 बार कुल्ला।
  8. प्रत्येक प्राथमिक एंटीबॉडी के खिलाफ निर्देशित बफर KB2 का उपयोग करना, एक fluorophore संयुग्मित माध्यमिक एंटीबॉडी (:: 100 1 200 1 के कमजोर पड़ने अनुपात) पतला।
    नोट: इष्टतम परिणामों के लिए, इस समाधान में माध्यमिक एंटीबॉडी के अंतिम एकाग्रता अनुभव से निर्धारित किया जाना चाहिए।
  9. पर्याप्त मात्रा सेल नमूना विसर्जित करने के लिए पतला एंटीबॉडी के (एक कांच कवर पर सीए 30 μl के ड्रॉप) को लागू करें। 37 डिग्री सेल्सियस पर 1 घंटे के लिए सेल नमूना सेते हैं। 30 मिनट (पांच 6 मिनट washes) की अवधि के दौरान कोशिकाओं बफर KB2 के साथ 5 बार कुल्ला।
    नोट: इष्टतम परिणाम (यानी, कोशिकाओं का कम से कम नुकसान के लिए) के लिए, इष्टतम धोने हालत निर्धारित किया जाना चाहिए Empirically।
  10. बफर DAPI (50 एनजी / एमएल) युक्त सेल नमूना विसर्जित करने के लिए KB3 की पर्याप्त मात्रा को लागू करें। आरटी पर 5 मिनट के लिए सेल नमूना सेते हैं। कोशिकाओं बफर KB2 साथ 1-2 बार कुल्ला।
  11. कांच कवर कि सूक्ष्म स्लाइड पर सेल नमूना शामिल माउंट।
    1. सूक्ष्म स्लाइड के केंद्र में बढ़ते मध्यम की एक बूंद रखें।
    2. सेल नमूना से तरल निकालें और, हाथ या संदंश का उपयोग, सूक्ष्म स्लाइड के केंद्र में नमूना स्थिति। हवा के बुलबुले से बचें।
    3. एक कागज तौलिया के साथ अतिरिक्त बढ़ते मध्यम निकालें।

3. सेल फिक्सेशन और Immunofluorescent सी टर्मिनल का धुंधला करें टैग CENP-ए प्रोटीन (एसीटोन निर्धारण)

  1. तैयारी
    1. ठंडा 75% एसीटोन तैयार करें।
    2. हौसले पीबीएस (7.4 पीएच) 0.5% और 0.5% BSA युक्त दूध स्किम के 50 मिलीलीटर तैयार करते हैं।
    3. हौसले पीबीएस (7.4 पीएच) 0.1% और 0.1% BSA युक्त दूध स्किम के 50 मिलीलीटर तैयार करते हैं।
    4. (पीबीएस के 1 मिलीलीटर की तैयारी7.4 पीएच) DAPI (50-100 एनजी / एमएल) युक्त।
    5. 2.1.5 में वर्णित के रूप में बढ़ते मध्यम की 100 मिलीलीटर की तैयारी।
  2. 48-72 घंटा के बाद अभिकर्मक (1 प्रोटोकॉल देखें) सेल निर्धारण के लिए कम से आकांक्षा से संस्कृति के माध्यम से निकालें। पीबीएस के साथ एक बार कुल्ला कोशिकाओं। संस्कृति में अच्छी तरह से की ओर करने के लिए पीबीएस लागू कोशिकाओं की सतह को परेशान करने से बचने के लिए।
    नोट: सेल निर्धारण के लिए इष्टतम समय बिंदु अनुभव से निर्धारित किया जाना चाहिए।
  3. ठंडा 75% एसीटोन में कोशिकाओं को ठीक करें, और -20 डिग्री सेल्सियस पर 10 मिनट के लिए कोशिकाओं सेते हैं। आरटी पर 30-60 मिनट के लिए एक धूआं हुड में कांच कवर पर सूखी कोशिकाओं।
    नोट: इष्टतम परिणामों के लिए, निर्धारण और सेल सुखाने के लिए आवश्यक समय की लंबाई के अनुभव से निर्धारित किया जाना चाहिए।
  4. हाइड्रोफोबिक बाधा पेन का उपयोग (सामग्री / उपकरण की सूची देखें), प्रत्येक कवर गिलास नमूना के चारों ओर एक हाइड्रोफोबिक बाधा फार्म के लिए एक हरे रंग पीला वर्ग या वृत्त खींचना। स्पर्श या न हाइड्रोफोबिक बाधा कलम के साथ कोशिकाओं को भी बंद मिलता है।
  5. ब्लॉक nonspecific पीबीएस आरटी पर 5 मिनट के लिए युक्त 0.5% मलाई निकाला दूध और 0.5% बीएसए जोड़कर कोशिकाओं पर बाध्यकारी साइटों।
  6. (: 1,000 कमजोर पड़ने अनुपात 1) और या तो एक विरोधी CENP-बी एंटीबॉडी (1 के कमजोर पड़ने अनुपात: 200) या एसीए (1: 2,000 कमजोर पड़ने अनुपात पीबीएस युक्त 0.1% और 0.1% बीएसए मलाई निकाला दूध का उपयोग करना, एक विरोधी झंडा एंटीबॉडी पतला ) एक गुणसूत्रबिंदु स्थान मार्कर के रूप में।
    नोट: इष्टतम परिणामों के लिए, इस समाधान में प्राथमिक एंटीबॉडी के अंतिम एकाग्रता अनुभव से निर्धारित किया जाना चाहिए।
  7. सेल नमूना विसर्जित करने के लिए पतला प्राथमिक एंटीबॉडी की पर्याप्त मात्रा (सीए 30 μl) को लागू करें। 37 डिग्री सेल्सियस पर 1 घंटे के लिए सेल नमूना सेते हैं। 30 मिनट की अवधि के दौरान कोशिकाओं अवरुद्ध बफर के साथ 5 बार कुल्ला।
    नोट: कोशिकाओं पीबीएस के साथ rinsed जा सकता है। इष्टतम परिणाम (यानी, कोशिकाओं के नुकसान से बचने के लिए) के लिए, इष्टतम धोने की स्थिति अनुभव से निर्धारित किया जाना चाहिए।
  8. के खिलाफ निर्देशित एक fluorophore संयुग्मित माध्यमिक एंटीबॉडी (:: 100 1 200 1 के कमजोर पड़ने अनुपात) पतलापीबीएस 0.1% मलाई निकाला दूध और 0.1% बीएसए युक्त प्रत्येक प्राथमिक एंटीबॉडी।
    नोट: इष्टतम परिणामों के लिए, इस समाधान में माध्यमिक एंटीबॉडी के अंतिम एकाग्रता अनुभव से निर्धारित किया जाना चाहिए।
  9. सेल नमूना विसर्जित करने के लिए पतला एंटीबॉडी की पर्याप्त मात्रा (सीए 30 μl) को लागू करें। 37 डिग्री सेल्सियस पर 1 घंटे के लिए सेल नमूना सेते हैं। पीबीएस 0.1% और 0.1% BSA युक्त दूध स्किम के साथ कोशिकाओं को 2 बार कुल्ला।
    नोट: पीबीएस अकेले भी कोशिकाओं को धोने के लिए इस्तेमाल किया जा सकता है।
  10. पीबीएस की पर्याप्त मात्रा DAPI (50-100 एनजी / एमएल) युक्त सेल नमूना विसर्जित करने के लिए लागू करें। आरटी पर 5 मिनट के लिए सेल नमूना सेते हैं। पीबीएस के साथ कोशिकाओं 1-2 बार कुल्ला।
  11. कांच कवर 2.11 में वर्णित के रूप में सूक्ष्म स्लाइड पर सेल नमूना युक्त माउंट।

4. सेल फिक्सेशन और Immunofluorescent एन टर्मिनल का धुंधला करें टैग CENP-ए प्रोटीन (मेथनॉल निर्धारण)

  1. तैयारी
    1. ठंडा मेथनॉल तैयार करें।
    2. टीबीएस (7.4 पीएच) 4% बकरी सीरम युक्त तैयार करें।
    3. टीबीएस (7.4 पीएच) DAPI (50-100 एनजी / एमएल) युक्त के 1 मिलीलीटर तैयार करें।
    4. 2.1.5 में वर्णित के रूप में बढ़ते मध्यम की 100 मिलीलीटर की तैयारी।
  2. 48-72 घंटा के बाद अभिकर्मक (1 प्रोटोकॉल देखें) सेल निर्धारण के लिए कम से आकांक्षा से संस्कृति के माध्यम से निकालें। टीबीएस के साथ एक बार कुल्ला कोशिकाओं। संस्कृति कुओं की ओर करने के लिए टीबीएस लागू कोशिकाओं की सतह को परेशान करने से बचने के लिए।
    नोट: सेल निर्धारण के लिए इष्टतम समय बिंदु अनुभव से निर्धारित किया जाना चाहिए।
  3. ठंडा मेथनॉल में कोशिकाओं को ठीक करें, और -20 डिग्री सेल्सियस पर 6 मिनट के लिए कोशिकाओं सेते हैं। टीबीएस के साथ कोशिकाओं को दो बार कुल्ला पर्याप्त अवशिष्ट मेथनॉल हटा दें।
  4. एक हाइड्रोफोबिक बाधा पेन का उपयोग (सामग्री / उपकरण की सूची देखें), प्रत्येक कवर गिलास नमूना के चारों ओर एक हाइड्रोफोबिक बाधा पैदा करने के लिए एक हरे रंग पीला वर्ग या वृत्त खींचना। स्पर्श या न हाइड्रोफोबिक बाधा कलम के साथ कोशिकाओं को भी बंद मिलता है।
  5. सेल पर अविशिष्ट बाध्यकारी साइटों को ब्लॉकउनका कहना है टीबीएस 4% बकरी सीरम युक्त द्वारा LS। आरटी पर 10 मिनट के लिए सेते हैं।
  6. (: 1,000 कमजोर पड़ने 1) और या तो एक विरोधी CENP-बी एंटीबॉडी (1 के कमजोर पड़ने अनुपात: 200): 4% बकरी सीरम युक्त टीबीएस में (2,000 कमजोर पड़ने अनुपात 1) एक गुणसूत्रबिंदु स्थान मार्कर के रूप में या एसीए एक विरोधी झंडा एंटीबॉडी पतला ।
    नोट: इष्टतम परिणामों के लिए, इस समाधान में प्राथमिक एंटीबॉडी के अंतिम एकाग्रता अनुभव से निर्धारित किया जाना चाहिए।
  7. सेल नमूना विसर्जित करने के लिए पतला प्राथमिक एंटीबॉडी की पर्याप्त मात्रा (सीए 30 μl) को लागू करें। 37 डिग्री सेल्सियस पर 1 घंटे के लिए सेल नमूना सेते हैं। 30 मिनट की अवधि के दौरान कोशिकाओं अवरुद्ध बफर के साथ 5 बार कुल्ला। इष्टतम परिणाम (यानी, कोशिकाओं का कम से कम नुकसान) के लिए, इष्टतम धोने हालत अनुभव से निर्धारित किया जाना चाहिए।
  8. 4% बकरी सीरम युक्त टीबीएस में प्रत्येक प्राथमिक एंटीबॉडी के खिलाफ निर्देशित एक fluorophore संयुग्मित माध्यमिक एंटीबॉडी (:: 100 1 200 1 के कमजोर पड़ने अनुपात) पतला।
    नोट: इष्टतम परिणामों के लिए, वित्तीय और प्रक्रियात्मक पहलुओंइस समाधान में माध्यमिक एंटीबॉडी के एल एकाग्रता अनुभव से निर्धारित किया जाना चाहिए।
  9. सेल नमूना विसर्जित करने के लिए पतला एंटीबॉडी की पर्याप्त मात्रा (सीए 30 μl) को लागू करें। 37 डिग्री सेल्सियस पर 1 घंटे के लिए सेल नमूना सेते हैं। अवरुद्ध बफर के साथ कोशिकाओं 3 बार कुल्ला।
  10. DAPI (50-100 एनजी / एमएल) युक्त सेल नमूना विसर्जित करने के लिए टीबीएस की पर्याप्त मात्रा को लागू करें। आरटी पर 5 मिनट के लिए सेल नमूना सेते हैं। टीबीएस के साथ कोशिकाओं को 1-2 बार कुल्ला।
  11. कांच कवर कि सूक्ष्म स्लाइड पर सेल नमूना 2.11 में वर्णित के रूप में शामिल है माउंट।

5. इम्यूनोफ्लोरेसेंस छवि अवलोकन, अधिग्रहण, Quantitation, और विश्लेषण

  1. एक 63X और 100X तेल विसर्जन लेंस, एक बाहरी कॉम्पैक्ट प्रकाश स्रोत, और एक डिजिटल सीसीडी कैमरा से लैस एक मोटर चालित प्रतिदीप्ति माइक्रोस्कोप के माध्यम से सेल नमूना निरीक्षण करें।
  2. छवि अधिग्रहण और प्रसंस्करण, deconvolution सहित प्रदर्शन सॉफ्टवेयर का उपयोग करकेए, बी 1 और बी 2 या सॉफ्टवेयर्स (सामग्री / उपकरण की सूची देखें)। सॉफ्टवेयर सॉफ्टवेयर ए बी 1 और बी 2 में प्रयुक्त सभी आदेशों के लिए में इस्तेमाल सभी आदेशों के लिए कृपया पूरक संहिता फ़ाइलें (5.2.1) को देखने के लिए, कृपया (5.2.2) पूरक कोड फ़ाइलें में देखते हैं।
  3. गुणसूत्रबिंदु-kinetochore प्रोटीन के संकेतों यों तो एक पहले से वर्णित विधि का प्रयोग 23-25 ​​(जैसे, शेष गुणसूत्रबिंदु पर CENP-ए का संकेत है) के बाद मामूली संशोधनों के साथ:
    1. गुणसूत्रबिंदु-kinetochore प्रोटीन के क्षेत्र का चयन और पृष्ठभूमि की है कि इस प्रकार है:
      1. Mitotic सेल: (गुणसूत्रबिंदु-kinetochore क्षेत्र) का चयन करें क्षेत्र DAPI के साथ दाग गुणसूत्रों के साथ ओवरलैपिंग; (पृष्ठभूमि क्षेत्र) और क्षेत्र के बाहर गुणसूत्रों लेकिन समान एकल कक्ष के अंदर (यानी, साइटोसोलिक क्षेत्र)।
      2. Interphase सेल: (गुणसूत्रबिंदु-kinetochore क्षेत्र) का चयन करें क्षेत्र DAPI के साथ दाग क्रोमेटिन साथ ओवरलैपिंग; (पृष्ठभूमि क्षेत्र) और क्षेत्र के बाहर क्रोमेटिन लेकिन समान एकल कक्ष के अंदर (<उन्हें> यानी, साइटोसोलिक क्षेत्र)।
        नोट: क्रमशः, सॉफ्टवेयर एक या सॉफ्टवेयर बी 2 के साथ क्षेत्र के चयन के लिए भी पूरक संहिता फ़ाइलें (5.2.1.4.3) या (5.2.2.6.4) देखें।
    2. सॉफ्टवेयर एक या बी का उपयोग कर इस कार्य के लिए, निम्न सूत्र का उपयोग करके centromeres पर शेष संकेतों का प्रतिशत यों:
      गुणसूत्रबिंदु-kinetochore पर गुणसूत्रबिंदु-kinetochore प्रोटीन के संकेतों शेष
      Equation1
      बी पृष्ठभूमि संकेत चमक है; जहां एस चयनित क्षेत्र है, जो एसीए या CENP-बी धुंधला द्वारा की पुष्टि की है की चमक संकेत है आर नमूना siRNA (s) -treated कोशिकाओं के लिए संदर्भ एसीए या CENP-बी का संकेत है; और आर Ctrl संदर्भ एसीए या ल्यूक siRNA ट्रांसफ़ेक्ट कोशिकाओं के लिए CENP-बी का संकेत है।
      नोट: इस विश्लेषण में, CENP-बी संकेतों CUL4A के लिए संदर्भ संकेतों के रूप में और RBX1 पिछली रिपोर्टों में वर्णित के रूप में इस्तेमाल किया गया।
    3. कॉपी करने के बाद इस गणना के लिए एक एक्सेल फ़ाइल का उपयोग करें और संकेत quantitation ऊपर वर्णित सॉफ्टवेयर से कच्चे डेटा चिपकाने। यह भी देखें पूरक संहिता फ़ाइलें: (5.2.1.4) और (5.2.2.6) जानकारी के लिए। गणना का एक उदाहरण तालिका 3 में दिखाया गया है।
  4. धुंधला हो जाना और प्रत्येक माप स्तर के लिए छवि अधिग्रहण में भिन्नता को खत्म करने में कम से कम 20 कोशिकाओं का विश्लेषण। प्रत्येक कोशिका का विश्लेषण के लिए वैकल्पिक रूप से शेष गुणसूत्रबिंदु-kinetochore संकेतों के "औसतन मूल्य" का उपयोग अलग-गुणसूत्रबिंदु kinetochore प्रोटीन के बीच इन मूल्यों की तुलना करें।

6. वेस्टर्न ब्लाट कुल प्रोटीन का विश्लेषण

  1. एक बफर denaturing में कोशिकाओं Resuspend (20 मिमी Tris एचसीएल, पीएच 7.4, 50 मिमी NaCl, 0.5% Nonidet पी 40; 0.5% deoxycholate; 0.5% एसडीएस, 1 मिमी EDTA, और पूरा EDTA मुक्त protease अवरोध कॉकटेल), 26 विषय एक sonication और फ्रीज पिघलना प्रक्रिया, और उपाय करने के लिए निलंबनप्रोटीन सांद्रता इस प्रकार है:
    1. sonication प्रक्रिया के लिए, 48-72 घंटा के बाद अभिकर्मक पर 6 अच्छी तरह से polystyrene थाली के दो कुओं से एकत्र की कोशिकाओं के लिए बफर के 50 μl जोड़ने (1 प्रोटोकॉल देखें)। disruptor सींग और microtip से लैस एक sonicator प्रचालन कुल 15 सेकंड रुक-रुक कर पल्स अवधि (कर्तव्य चक्र 50%) एक नमूना प्रति के लिए (सामग्री / उपकरण की सूची देखें)।
    2. फ्रीज पिघलना प्रक्रिया के लिए, तरल नाइट्रोजन के साथ कोशिकाओं फ्रीज और आरटी पर कोशिकाओं पिघलना।
    3. एक वाणिज्यिक प्रोटीन परख अभिकर्मक मैं या द्वितीय का उपयोग को मापने प्रोटीन सांद्रता (सामग्री / उपकरण की सूची देखें)।
      नोट: lysates अभिकर्मक या तो मैं या द्वितीय के साथ प्रोटीन की सांद्रता की माप में 1:10 के अनुपात के साथ पतला कर रहे हैं। इस कमजोर पड़ने पर, बफर में एसडीएस उपस्थित इस माप में कम या कोई हस्तक्षेप से पता चलता है।
  2. 2 × 4 × या एसडीएस पृष्ठ लोड हो रहा है बफर के साथ कुल प्रोटीन के 20-30 माइक्रोग्राम युक्त lysate मिक्स। 27 उबाल लें लिए नमूने5 मिनट के लिए और फिर उन्हें एक 12.0% -15.0% denaturing वैद्युतकणसंचलन के लिए एसडीएस polyacrylamide जेल पर लोड।
  3. एक पश्चिमी सोख्ता पहले से वर्णित विधि का उपयोग करके प्रोटीन एक PVDF झिल्ली पर एसडीएस पृष्ठ से अलग स्थानांतरण। 17,24,27-31
    1. 1 × पीबीएस में 5% गैर वसा दूध के साथ झिल्ली पर अविशिष्ट बाध्यकारी साइटों ब्लॉक, और फिर आरटी पर 1 घंटे के लिए पतला प्राथमिक एंटीबॉडी के समाधान के साथ झिल्ली सेते हैं। प्रत्येक प्राथमिक एंटीबॉडी की विस्तृत जानकारी (जैसे, कमजोर पड़ने अनुपात) के लिए सामग्री / उपकरण की सूची देखें।
    2. पीबीएस टी बफर के साथ (झटकों के साथ प्रत्येक 3 से 5 मिनट ऊष्मायन) झिल्ली 3-4 बार धोने के बाद (1 × पीबीएस और 0.1% बीच 20), लगभग अवरक्त (आईआर) का एक मिश्रण में झिल्ली सेते फ्लोरोसेंट डाई संयुग्मित माध्यमिक एंटीबॉडी (1 के कमजोर पड़ने अनुपात: 20,000), DyLight संयुग्मित माध्यमिक एंटीबॉडी (1 के कमजोर पड़ने अनुपात: 20,000), और / या हॉर्सरैडिश peroxidase (एचआरपी) माध्यमिक एंटीबॉडी (पीबीएस-टी में पतला संयुग्मित; dilutiआरटी पर 1 घंटे के लिए 10,000): 1 के अनुपात पर। प्रत्येक माध्यमिक एंटीबॉडी की विस्तृत जानकारी (जैसे, कमजोर पड़ने अनुपात) के लिए सामग्री / उपकरण की सूची देखें।
  4. झिल्ली 3 बार धोएं, और फिर झिल्ली स्कैन अवरक्त इमेजिंग प्रणाली और / या immunoblot पता लगाने के लिए chemiluminescence इमेजर के साथ प्रोटीन का विश्लेषण करने के लिए (सामग्री / उपकरण की सूची देखें)।
    1. अवरक्त इमेजिंग प्रणाली का उपयोग के लिए, पूरक कोड फ़ाइलें में (6.4.1) देखें।
    2. chemiluminescence इमेजर का उपयोग कर के लिए, पूरक कोड फ़ाइलें में (6.4.2) देखें। एक अति संवेदनशील बढ़ाया chemiluminescent (ईसीएल) सब्सट्रेट का उपयोग इस प्रणाली के लिए (सामग्री / उपकरण की सूची देखें)।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

अंतर्जात CENP-ए का immunofluorescence विश्लेषण परिकल्पना है कि CUL4A-E3 ligase centromeres को CENP-ए का स्थानीयकरण के लिए आवश्यक है का समर्थन करता है
हमारे हाल के अध्ययनों से पता चला है कि CUL4A-RBX1-COPS8 E3 ligase गतिविधि CENP-ए और centromeres को CENP-ए का स्थानीयकरण पर लाइसिन 124 (K124) के ubiquitylation के लिए आवश्यक है। 17 प्रारंभ में, अंतरावस्था-गुणसूत्रबिंदु परिसर (ICEN) द्वारा पृथक किया गया विरोधी CENP-ए: मूल क्रोमेटिन immunoprecipitation, 32-34 और यह धारणा रही है ICEN प्रोटीन के कुछ centromeres को CENP-ए स्थानीयकृत करने में एक भूमिका निभा सकते हैं। इसलिए, siRNA पछाड़ना प्रयोगों प्रोटीन अभिव्यक्ति की जिसका अभाव centromeres 17 CENP-ए का delocalization प्रेरित करने के लिए स्क्रीन करने के लिए प्रदर्शन किया गया (नहीं दिखाया डेटा): asynchronously बढ़ रही हेला कोशिकाओं समय के लिए Cullin -4 ए (CUL4A) siRNA या RBX1 siRNA साथ ट्रांसफ़ेक्ट थे इष्टतम प्रोटीन की कमी के लिए आवश्यक (48 जCUL4A के लिए आर और RBX1 के लिए 72 घंटा)। CUL4A siRNA साथ ट्रांसफ़ेक्ट कोशिकाओं centromeres पर CENP-ए का एक महत्वपूर्ण delocalization (चित्रा 1 ए सी) से पता चला। जैसा कि चित्र 2 जी में देखा, CUL4A siRNA ट्रांसफ़ेक्ट कोशिकाओं की कुल सेल lysates में CENP-ए का प्रोटीन का स्तर (ल्यूक) एक ही संस्कृति की शर्तों के तहत siRNA ट्रांसफ़ेक्ट कोशिकाओं luciferase से lysates में CENP-एक स्तर के समान थे। CUL4A siRNA के बंद लक्ष्य प्रभाव की संभावना है, क्योंकि बाहर रखा CUL4A-ध्वज के अस्थानिक अभिव्यक्ति centromeres पर CENP-ए की कमी को बचाया जब CUL4A siRNA लक्षित 3 'UTR (चित्रा 2A सी) था। कुल सेल lysates में CENP-ए का प्रोटीन का स्तर एक ही संस्कृति की स्थिति सेल चक्र चरण (आंकड़े 1 बी, 2 जी) के तहत की परवाह किए बिना ल्यूक siRNA ट्रांसफ़ेक्ट कोशिकाओं से lysates में CENP-एक स्तर के समान होने की पुष्टि की गई है; इस प्रकार, संभावना है कि CUL4A कमी की वजह से CENP-ए प्रोटीन गिरावट का सफाया कर दिया गया था।

35 कर रहे हैं और 3 प्रमुख तत्व होते हैं: एक Cullin पाड़, एक अंगूठी उंगली प्रोटीन (RBX1 या RBX2), और एक यूबीक्यूटिन आरोप लगाया E2 एंजाइम है कि RBX1 या RBX2 द्वारा भर्ती किया गया है, 36 ए अनामिका प्रोटीन भी एक सब्सट्रेट एडाप्टर E2 एंजाइम से निकटता में substrates स्थानों यूबीक्यूटिन हस्तांतरण की सुविधा के लिए भर्ती करता है। 36 RBX1 siRNAs की एक महत्वपूर्ण कमी प्रेरित जिन परिस्थितियों में RBX1 siRNA ट्रांसफ़ेक्ट कोशिकाओं की कुल सेल lysates में CENP-ए का प्रोटीन का स्तर ल्यूक siRNA ट्रांसफ़ेक्ट कोशिकाओं से lysates में CENP-एक स्तर के समान थे तहत centromeres (चित्रा 1 डी-एफ) में CENP-ए (चित्रा 2 जी)। या तो RBX1 कमी से या एक ही संस्कृति की शर्तों के तहत CUL4A के संयोजन और RBX1 कमी से CENP-एक प्रोटीन की गिरावट (चित्रा 2 जी) नहीं मनाया गया। बंद लक्ष्य प्रभाव की संभावनाRBX1 siRNA के एस, बाहर रखा गया है क्योंकि ध्वज-RBX1 के अस्थानिक अभिव्यक्ति centromeres पर CENP-ए की कमी को बचाया जब RBX1 siRNA लक्षित 3 'UTR (चित्रा 2 डी-एफ) था। इन निष्कर्षों को सुझाव दिया है कि CUL4A-RBX1-E3 ligase विशेष centromeres को CENP-ए का स्थानीयकरण के लिए आवश्यक है।

बहिर्जात CENP-ए का immunofluorescence विश्लेषण - ध्वज प्रोटीन इंगित करता है कि CENP-ए K124 ubiquitylation centromeres को CENP-ए का स्थानीयकरण के लिए आवश्यक है
इससे पहले, हमारे immunoprecipitation-मास स्पेक्ट्रोमेट्री विश्लेषण से पता चला है कि लाइसिन 124 CENP-ए-ध्वज के (K124) हेला कोशिकाओं में ubiquitylated है। CENP 17-ए nucleosome की संरचना में क्रिस्टल, K124, α3 हेलिक्स में रहता है, हालांकि साइट है CATD क्षेत्र के भीतर नहीं। 17 इसके अलावा, K124 स्तनधारी, पक्षी, छिपकली, पौधों, और कवक के एक समूह (जैसे, कली के बीच में संरक्षित हैडिंग खमीर)। CENP 17-ए लाइसिन म्यूटेंट (चित्रा 3 ए) का निर्माण किया और गुणसूत्रबिंदु को स्थानीय बनाना करने की क्षमता का परीक्षण किया गया। दोनों mitotic और अंतरावस्था हेला कोशिकाओं में फैलाना संकेतों के साथ बहिर्जात CENP-ए K124R उत्परिवर्ती की centromeric स्थानीयकरण के पर्याप्त निराकरण (चित्रा 3 बी, सी) मनाया गया। गुणसूत्रबिंदु स्थानीयकरण काफी प्रभावित नहीं था न K9A म्यूटेशन द्वारा और न ही K77R म्यूटेशन (K77 CATD में एक अद्वितीय लाइसिन साइट है) (चित्रा 3 बी, सी) (K9 हिस्टोन के लिए H3 K9 मेथिलिकरण मेल खाती है)।

इन परिणामों के आधार पर, दो परिकल्पना K124 पर CENP-ए ubiquitylation के vivo समारोह के संबंध में प्रस्ताव है। सबसे पहले, K124 ubiquitylation की भूमिका euchromatin को overexpressed और / या mislocalized CENP-ए को खत्म करने ubiquitin की मध्यस्थता प्रोटियोलिसिस के लिए है। दूसरा, K124 पर CENP-ए ubiquitylation की भूमिका centromeres पर CENP-एक लोडिंग के लिए है। एफ परीक्षण करने के लिएirst संभावना है, CUL4A- की CENP-ए-ध्वज जंगली प्रकार और K124R उत्परिवर्ती के साथ ही अंतर्जात CENP-ए cycloheximide (CHX) के बाद उपचार या RBX1 समाप्त कोशिकाओं के stabilities संबोधित कर रहे थे। इन आंकड़ों से सुझाव दिया है कि K124 के ubiquitylation शायद overexpressed और / या mislocalized CENP-ए को खत्म करने ubiquitin की मध्यस्थता प्रोटियोलिसिस में शामिल नहीं है (नहीं दिखाया डेटा)। 17। इसके अलावा, यह पुष्टि की गई है कि K124R उत्परिवर्तन ख्यात monoubiquitylation और diubiquitylation बैंड abrogates, दोनों vivo में इन विट्रो में और ubiquitylation assays में (डेटा) नहीं दिखाया। 17 सामूहिक रूप से, इन आंकड़ों का सुझाव है कि CUL4A-RBX1 जटिल योगदान "सिगनल" ubiquitylation, जो CENP-ए centromeres पर स्थानीयकरण के लिए आवश्यक है।

बहिर्जात ध्वज के immunofluorescence विश्लेषण - CENP-ए प्रोटीन इंगित करता है कि monoubiquitin संलयन लोड करने के लिए पर्याप्त हैCENP-ए centromeres पर K124R
ऊपर दिए गए परिणामों के आधार पर यह धारणा थी कि covalently जुड़े monoubiquitin CENP-ए centromeres पर लोड करने के लिए एक संकेत के रूप में कार्य करता है। इस परिकल्पना, एक एन टर्मिनल करें टैग और सी टर्मिनल यूबीक्यूटिन-दूसरे से जुड़ने जंगली प्रकार CENP-ए और एक K124R उत्परिवर्ती CENP-ए निर्माण किया गया था (चित्रा -4 ए) का परीक्षण करने के लिए। Monoubiquitin उत्परिवर्ती यूबी (K48R), जो polyubiquitylation 37-39 के लिए एक प्रमुख स्थल का अभाव भी संभावित polyubiquitylation से यूबीक्यूटिन-दूसरे से जुड़ने CENP-ए प्रोटीन को रोकने के लिए इस्तेमाल किया गया था। विरोधी झंडा immunofluorescent संकेतों पर कब्जा करके, इन निर्माणों द्वारा इनकोडिंग प्रोटीन के centromeric स्थानीयकरण परीक्षण किया गया था। जबकि ध्वज-CENP-ए (K124) CENP-ए का काफी हद तक निराकृत गुणसूत्रबिंदु स्थानीयकरण (चित्रा 4 बी और 4C, स्तंभ [6]), ध्वज-CENP-ए दोनों (डब्ल्यूटी) और फ्लैग-CENP-ए (डब्ल्यूटी) -Ub ( डब्ल्यूटी) उनकी गुणसूत्रबिंदु स्थानीयकरण (चित्रा 4 बी और 4C बनाए रखा, स्तंभों [1] और [2])।ध्वज-CENP-ए (K124R) -Ub (K48R) प्रोटीन मुमकिन है, monoubiquitylated मजाक उड़ाया CENP-ए के रूप में इस प्रोटीन काफी centromeres को बहाल स्थानीयकरण (चित्रा 4C तुलना स्तंभों [5] और [6]) किया था और अधिक कुशलता से CENP-ए (K124R) -Ub (डब्ल्यूटी) (चित्रा 4C, स्तंभों की तुलना [4] - [6])। इन आंकड़ों से दिखा दिया है कि monoubiquitylation centromeres को CENP-ए की भर्ती के लिए पर्याप्त है।

आकृति 1
चित्रा 1. अंतर्जात CENP-ए का immunofluorescence विश्लेषण परिकल्पना है कि CUL4A-E3 ligase (आंकड़े Niikura एट अल। 17 से अनुकूलित किया गया) centromeres को CENP-ए का स्थानीयकरण के लिए आवश्यक है समर्थन करता है। (ए) CUL4A siRNA प्रेरित centromeres पर CENP-ए का delocalization। हेला कोशिकाओं CUL4A या luciferase (ल्यूक) siRNA साथ ट्रांसफ़ेक्ट और 48 घंटे के लिए incubated (थे1 टेबल)। स्केल पट्टी का प्रतिनिधित्व करता है 10 माइक्रोन। (बी) (ए) के रूप में हेला पूरे सेल एक ही संस्कृति हालत का उपयोग कर lysates के पश्चिमी धब्बा विश्लेषण। प्रकोष्ठों CUL4A siRNA या ल्यूक siRNA (तालिका 1) के साथ अभिकर्मक के बाद 48 घंटा काटा गया। GAPDH एक लोडिंग नियंत्रण के रूप में कार्य किया। (सी) (ए) में दिखाया गया centromeres में मात्रा निर्धारित अंतर्जात CENP-ए का संकेत है। संकेतों को सामान्य बनाने ल्यूक siRNA ट्रांसफ़ेक्ट कोशिकाओं का उपयोग करके किया गया था, और मतलब प्रतिशत (± एसडी) दिखाए जाते हैं। **** पी <0.0001 बनाम ल्यूक siRNA ट्रांसफ़ेक्ट कोशिकाओं (छात्र टी परीक्षण)। (डी) RBX1 siRNA प्रेरित centromeres से CENP-ए का delocalization। हेला कोशिकाओं RBX1 या ल्यूक siRNA (एस) के साथ ट्रांसफ़ेक्ट और 72 घंटा (तालिका 1) के लिए incubated रहे थे। स्केल बार 10 माइक्रोन का प्रतिनिधित्व करता है। (ई) (डी) के रूप में हेला पूरे सेल एक ही संस्कृति हालत का उपयोग कर lysates के पश्चिमी धब्बा विश्लेषण। प्रकोष्ठों RBX1 ओ के साथ अभिकर्मक के बाद 72 घंटा काटा गयाआर ल्यूक siRNA (एस) (1 टेबल)। GAPDH एक लोडिंग नियंत्रण के रूप में कार्य किया। (एफ) में (डी) से पता चला centromeres में मात्रा निर्धारित अंतर्जात CENP-ए का संकेत है। संकेतों को सामान्य बनाने ल्यूक siRNA ट्रांसफ़ेक्ट कोशिकाओं का उपयोग करके किया गया था, और मतलब प्रतिशत (± एसडी) दिखाए जाते हैं। **** पी <0.0001 बनाम ल्यूक siRNA ट्रांसफ़ेक्ट कोशिकाओं (छात्र टी परीक्षण)। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र 2
चित्रा 2. पूरक 1 centromeres चित्रा से संबंधित जानकारी। (ए) Exogenous CUL4A-ध्वज CENP-ए का delocalization बचाया जब CUL4A siRNA लक्षित 3 'UTR (आंकड़े से Niikura एट अल। 17 अनुकूलित किया गया)। हेला Tet-ऑफ सेलरास siRNA साथ cotransfection के बाद 48 घंटा में तय किया गया (CUL4A # 2: 3 'UTR लक्ष्य या ल्यूक, 1 टेबल) प्लस प्लाज्मिड निर्माण (pTRM4-CUL4A-झंडा या वेक्टर; तालिका 2)। 4-रंग immunostaining: DAPI (नीला) के लिए धुंधला हो जाना; झंडा; अंतर्जात CENP-बी (लाल); और अंतर्जात CENP-ए (हरा), प्रदर्शन किया गया था और फ्लैग पॉजिटिव कोशिकाओं हल किया गया है, लेकिन ध्वज छवियों सादगी के लिए छोड़े गए हैं। नोट: CUL4A # 2 चित्रा 1 ए सी में दिखाया गया है कि के रूप में समान लक्ष्य है। स्केल पट्टी का प्रतिनिधित्व करता है 10 माइक्रोन। (बी) एक ही संस्कृति शर्त के रूप में (ए) से पता चला निम्नलिखित हेला Tet-ऑफ पूरे सेल lysates के पश्चिमी धब्बा विश्लेषण। GAPDH एक लोडिंग नियंत्रण के रूप में कार्य किया। (ए) में दिखाया गया centromeres पर (सी) CENP-ए संकेतों एक विरोधी झंडा एंटीबॉडी से बंधे उन कोशिकाओं को अलग-थलग करने की छंटाई के बाद माइक्रोस्कोपी द्वारा मात्रा निर्धारित किया गया। संकेतों को सामान्य बनाने ल्यूक siRNA प्लस वेक्टर साथ ट्रांसफ़ेक्ट कोशिकाओं के साथ प्रदर्शन किया गया था, और मतलब प्रतिशत (± एसडी) दिखाए जाते हैं।**** पी <0.0001 ल्यूक siRNA प्लस वेक्टर (बाएँ स्तंभ, छात्र की टी परीक्षण) के साथ ट्रांसफ़ेक्ट कोशिकाओं बनाम। (डी) Exogenous ध्वज-RBX1 गुणसूत्रबिंदु पर CENP-ए का delocalization बचाया जब RBX1 siRNA लक्षित 3 'UTR । प्लस प्लाज्मिड निर्माण (pcDNA3 झंडा-RBX1 या वेक्टर; तालिका 2);: हेला कोशिकाओं siRNA साथ cotransfection के बाद 72 घंटा (तालिका 1 3 'UTR लक्ष्य या ल्यूक RBX1 # 2) में तय किया गया। 4-रंग immunostaining: DAPI (नीला) के लिए धुंधला हो जाना; झंडा; अंतर्जात CENP-बी (लाल); और अंतर्जात CENP-ए (हरा), प्रदर्शन किया गया था और फ्लैग पॉजिटिव कोशिकाओं हल किया गया है, लेकिन ध्वज छवियों सादगी के लिए छोड़े गए हैं। स्केल बार 10 माइक्रोन का प्रतिनिधित्व करता है। (ई) (डी) के रूप में ही संस्कृति हालत निम्नलिखित हेला पूरे सेल lysates के पश्चिमी धब्बा विश्लेषण। GAPDH एक लोडिंग नियंत्रण के रूप में कार्य किया। (एफ) (डी) में दिखाया गया centromeres पर CENP-ए संकेतों कोशिकाओं की छँटाई एक से बंधे उन को अलग करने के बाद माइक्रोस्कोपी द्वारा मात्रा निर्धारित किया गया n विरोधी झंडा एंटीबॉडी। संकेतों को सामान्य बनाने ल्यूक siRNA प्लस वेक्टर साथ ट्रांसफ़ेक्ट कोशिकाओं के साथ प्रदर्शन किया गया था, और मतलब प्रतिशत (± एसडी) दिखाए जाते हैं। **** पी <0.0001 बनाम ल्यूक siRNA प्लस वेक्टर (बाएँ स्तंभ, छात्र की टी परीक्षण) के साथ ट्रांसफ़ेक्ट कोशिकाओं। (G) CUL4A और RBX1 की कमी अंतर्जात CENP-ए प्रोटीन के स्तर को प्रभावित नहीं किया। अंतर्जात CENP-ए प्रोटीन का स्तर हेला पूरे सेल lysates में मापा गया CUL4A, RBX1, CUL4A प्लस RBX1, या ल्यूक siRNA साथ अभिकर्मक के बाद 72 घंटा काटा। अभिकर्मक के बाद अड़तालीस घंटे, कोशिकाओं थे या तो इलाज (asyn) या पैक्लिटैक्सेल (+ टैक्स) बँटवारा में गिरफ्तारी के लिए प्रेरित करने के लिए, और वे 24 घंटे के लिए सुसंस्कृत थे साथ इलाज किया। GAPDH एक लोडिंग नियंत्रण के रूप में कार्य किया। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

32 / 53732fig3highres.jpg "चौड़ाई =" 700 "/>
चित्रा बहिर्जात CENP-ए-ध्वज प्रोटीन के 3. immunofluorescence विश्लेषण से संकेत दिया कि CENP-ए K124 ubiquitylation (आंकड़े Niikura एट अल से अनुकूलित किया गया। 17) CENP-ए centromeres पर स्थानीयकरण के लिए आवश्यक है। (ए) CENP-ए की overexpression ध्वज निर्माणों (WT और के.आर. म्यूटेंट) हेला Tet-ऑफ पूरे सेल lysates के पश्चिमी धब्बा विश्लेषण द्वारा पुष्टि की गई। प्रकोष्ठों pTRM4-CENP-ए-ध्वज गुम्मट, के.आर. म्यूटेंट, या pTRM4 वेक्टर (तालिका 2) के साथ अभिकर्मक के बाद 48 घंटा काटा गया। CENP-ए-ध्वज के overexpression एक विरोधी झंडा एंटीबॉडी द्वारा खोजा गया था। GAPDH एक लोडिंग नियंत्रण के रूप में कार्य किया। ख्यात CENP-ए-ध्वज डिमर (##) और CENP-ए-ध्वज मोनोमर (#) दिखाए जाते हैं। नोट: एसडीएस प्रतिरोधी CENP-ए dimers पहले से सूचित किया गया है 40,41 (बी) CENP-ए K124R उत्परिवर्ती centromeres से दूर तक फैला हुआ delocalization दिखाया।। DAPI (नीला), झंडा (से सिग्नल Green), और अंतर्जात CENP-बी (लाल, एक गुणसूत्रबिंदु स्थान नियंत्रण) दिखाए जाते हैं। नोट: CUL4A या RBX1 siRNA साथ ट्रांसफ़ेक्ट कोशिकाओं में अंतर्जात CENP-ए के विपरीत, फैलाना संकेतों कोशिकाओं है कि अक्षमता का एक phenotype के रूप में exogenous CENP-ए-K124R करें overexpressed में छपी centromeres को लक्षित किया जाना है, शायद क्योंकि इसकी अभिव्यक्ति के स्तर लगभग 10 है - करने के लिए अंतर्जात CENP-ए की तुलना में अधिक 25 गुना (डेटा नहीं दिखाया गया है) 17 स्केल बार 10 माइक्रोन (सी) (बी) में दिखाया गया स्थानीयकरण पैटर्न के histograms प्रतिनिधित्व करता है।।। 50 से अधिक समर्थक / prometaphase और metaphase कोशिकाओं और प्रयोग के प्रति 200 से अधिक अंतरावस्था कोशिकाओं (एन ≥ 3 प्रयोगों) गिना रहे थे। मतलब प्रतिशत (± एसडी) दिखाए जाते हैं। "दूसरों (गैर-गुणसूत्रबिंदु)" ज्यादातर क्षतिग्रस्त कोशिकाओं, मृत कोशिकाओं, या nucleolar स्थानीयकरण (केवल interphase में) के साथ कोशिकाओं, शायद अभिकर्मक या अन्य उपचार की वजह से इंगित करता है। *** पी <0.001 CENP-एक WT-ध्वज (छात्र टी परीक्षण) बनाम।

चित्रा 4
चित्रा बहिर्जात ध्वज-CENP-ए प्रोटीन के 4. immunofluorescence विश्लेषण से संकेत दिया कि CENP-ए centromeres से CENP-ए K124R उत्परिवर्ती की monoubiquitin संलयन बचाया delocalization (आंकड़े Niikura एट अल। 17 से अनुकूलित किया गया)। (ए) इस अध्ययन में इस्तेमाल प्रत्येक निर्माण के योजनाबद्ध कार्टून (भी 2 टेबल देखें)। CENP-ए (लाल) और monoubiquitin (नीला) पर K48R उत्परिवर्तन साइट पर K124R उत्परिवर्तन साइट दिखाए जाते हैं। (1) गुम्मट: ध्वज-CENP-ए गुम्मट, (2) WT-UB (डब्ल्यूटी): ध्वज-CENP-एक WT-UB (डब्ल्यूटी), (3) WT-यूबी (K48R): ध्वज-CENP-एक WT -Ub (K48R), (4) K124R-UB (डब्ल्यूटी): ध्वज-CENP-ए-UB K124R (डब्ल्यूटी), (5) K124R-UB (K48R): ध्वज-CENP-ए-K124R यूबी (K48R), (6) K124R: ध्वज-CENP-ए K124R (बी) Exogenous CENP-ए centromeres से CENP-ए K124R उत्परिवर्ती की monoubiquitin संलयन बचाया delocalization।। DAPI (नीला), ध्वज (हरा), और अंतर्जात CENP-बी (लाल, एक गुणसूत्रबिंदु स्थान नियंत्रण) दिखाए जाते हैं। स्केल बार 10 माइक्रोन। (सी) (सी) में दिखाया गया स्थानीयकरण पैटर्न के histograms प्रतिनिधित्व करता है। 50 से अधिक समर्थक / prometaphase और metaphase कोशिकाओं और प्रयोग के प्रति 200 से अधिक अंतरावस्था कोशिकाओं (एन ≥ 3 प्रयोगों) गिना रहे थे। मतलब प्रतिशत (± एसडी) दिखाए जाते हैं। **** पी <0.0001 और *** पी <0.001 बनाम गैर-दूसरे से जुड़ने ध्वज-CENP-ए K124R (स्तंभ [6]) (छात्र टी परीक्षण)। कृपया यहाँ यह आंकड़ा का एक बड़ा संस्करण देखने के लिए क्लिक करें।

siRNA लक्ष्य वर्तमान अध्ययन में संकेत लक्ष्य प्रकार siRNA डेटाबेस नंबर फॉरवर्ड अनुक्रम (ओं) स्रोत / संदर्भ
Luciferase (GL3) - 1 लक्ष्य RKK9 CUUACGCUGAGUACUUCGAdTdT Elbashir एट अल।, (2001)
CENP-ए सीए-UTR siRNA पूल (2 लक्ष्यों मिश्रण) RKK375 / 5 'UTR T1 CGAGCGGCGCGGACUUCUGCCdTdT Niikura एट अल।, (2015)
RKK383 / 3 'UTR T1 UCCUGCACCCAGUGUUUCUGUdGdT Niikura एट अल।, (2015)
CUL4A # 1 1 लक्ष्य CRKK178 / RKK309 / T1 AGCGAUCGUAAUCAAUCCUGA Niikura एट अल।, (2015)
# 2 (3'UTR) 1 लक्ष्य CRKK181 / RKK331 / T4 AUGCGGGUUUGAAAUAUGACA Niikura एट अल।, (2015)
RBX1 / ROC1 # 1 siRNA पूल (4 लक्ष्यों मिश्रण) CRKK198 / RKK411 / T1 GAAGCGCUUUGAAGUGAAA Niikura एट अल।, (2015)
CRKK198 / RKK413 / T2 GCAUAGAAUGUCAAGCUAA Niikura एट अल।, (2015)
CRKK198 / RKK415 / T3 GCAAGAAGCGCUUUGAAGU Niikura एट अल।, (2015)
CRKK198 / RKK417 / T4 CAACAGAGAGUGGGAAUUC Niikura एट अल।, (2015)
# 2 (3 'UTR) 1 लक्ष्य CRKK206 / RKK425 / T8 UUCCCUGCUGUUACCUAAUUA Niikura एट अल।, (2015)

तालिका 1 siRNA इस अध्ययन में इस्तेमाल दृश्यों।

बी नंबर प्रासंगिक विशेषता (s) स्रोत / संदर्भ
B288 pTRM4 Niikura एट अल।, (2006)
B2067 pTRM4 मानव CENP-ए-ध्वज Niikura एट अल।, (2015)
B2281 pTRM4 मानव CENP-ए-K9A करें Niikura एट अल।, (2015)
B2387 pTRM4 मानव CENP-ए-K77R करें Niikura एट अल।, (2015)
B2388 pTRM4-हुमाn CENP-ए-K124R करें Niikura एट अल।, (2015)
B2512 pTRM4 झंडा-मानव CENP-ए Niikura एट अल।, (2015)
B2579 pTRM4 झंडा-मानव CENP-ए K124R Niikura एट अल।, (2015)
B2513 pTRM4 झंडा-मानव CENP-ए-UB (डब्ल्यूटी) Niikura एट अल।, (2015)
B2559 pTRM4 झंडा-मानव CENP-ए-UB K124R (डब्ल्यूटी) Niikura एट अल।, (2015)
B2515 pTRM4 झंडा-मानव CENP-ए-UB (K48R) Niikura एट अल।, (2015)
B2560 pTRM4 झंडा-मानव CENP-ए-K124R यूबी (K48R) Niikura एट अल।, (2015)
B2759 pTRM4-मानव-CUL4A करें Niikura एट अल।, (2015)
B2624 pcDNA3 झंडा-मानव RBX1 Niikuraएट अल।, (2015)
B1491 pcDNA3 झंडा Niikura एट अल।, (2015)

तालिका 2 प्लाज्मिड इस अध्ययन में इस्तेमाल वैक्टर।

आर (विरोधी CENP-बी) नमूना बी (विरोधी CENP-बी) आर नमूना (घटाया) अनुपात (एस नमूना: आर नमूना) सही अनुपात (एस नमूना: आर नमूना)
520 514 6 -४.१६७ 0.000
535 445 90 -१.०३३ 0.000
515 431 84 0.274 0.274
562 483 79 0.506 0.506
902 562 340 .509 .509
1,203 703 500 -०.५६० 0.000
1,014 589 425 -०.८१९ 0.000
768 510 258 -१.३४५ 0.000
555 458 97 -१.८४५ 0.000
781 576 205 -१.१४६ 0.000
556 436 120 .758 .758
534 493 41 -१.६३४ 0.000
702 543 159 0.667 0.667
482 429 53 -१.००० 0.000 654 531 123 .740 .740
1,190 607 583 0.384 0.384
552 454 98 .969 .969
489 413 76 .539 .539
511 452 59 -३.१८६ 0.000
485 475 10 -२.७०० 0.000
481 441 40 -१.४७५ 0.000
योग ५.३४७
औसत .255
आर (विरोधी CENP-बी) Ctrl बी (विरोधी CENP-बी) अनुपात (एस Ctrl: आर Ctrl) सही अनुपात (एस Ctrl: आर Ctrl)
543 483 60 ३.०१७ ३.०१७
526 466 60 २.६६७ २.६६७
532 460 72 १.७९२ १.७९२
507 457 50 ३.५२० ३.५२०
491 458 33 ४.२७३ ४.२७३
545 464 81 २.१६० २.१६०
518 484 34 ३.५५९ ३.५५९
461 404 57 २.४०४ २.४०४
487 447 40 ३.५५० ३.५५०
534 477 57 3.965 3.965
528 456 72 ३.०९७ ३.०९७
707 601 106 १.८६८ १.८६८
615 528 87 २.८२८ २.८२८
660 481 179 १.६२० १.६२०
565 476 89 1.607 1.607
527 455 72 ३.५८३ ३.५८३
560 474 86 २.९३० २.९३०
510 451 59 ४.०१७ ४.०१७
729 586 143 २.६७८ २.६७८
634 576 58 ३.६५५ ३.६५५
507 476 31 ३.९३५ ३.९३५
योग ६२.७२५
औसत २.९८७
गुणसूत्रबिंदु पर शेष CENP-ए संकेतों (%) 8.5

तालिका 3. गुणसूत्रबिंदु (%) में शेष CENP-ए संकेतों की गणना का एक उदाहरण चित्रा 2 एफ में प्रो / prometaphase का एक उदाहरण दिखाया गया है: नमूना # RBX1 2 (3'UTR) + वीइसी (केंद्र स्तंभ चित्रा 2 एफ में है ) और नियंत्रण ल्यूक + वीइसी (चित्रा 2 एफ में बाएँ स्तंभ) है। नतीजतन, पर शेष CENP-ए संकेतोंगुणसूत्रबिंदु (%) = (0,255 / 2,987) x 100 = 8.5% प्राप्त की है (या [५.३४७ / ६२.७२५] x 100 = 8.5% ही कुल सेल नंबर के साथ [यानी, 21 कोशिकाओं] दो नमूनों के बीच का विश्लेषण किया)। ध्यान दें कि यदि बी एस मूल्य मूल्य से अधिक है (यानी, अगर घटाया मूल्य नकारात्मक है), को सही अनुपात मूल्य 0.00 को तैयार है।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

हाल के वर्षों में कई अध्ययनों गुणसूत्रबिंदु-kinetochore जीव विज्ञान में तय की कोशिकाओं के लिए अलग मात्रात्मक माइक्रोस्कोपी assays विकसित किया है। 42 प्रगति अक्सर प्रोटीन के गुणसूत्रबिंदु विशेष या kinetochore विशेष समारोह का एक समझ है जो की subcellular स्थानिक लौकिक विनियमन के बदलते कार्यों को दर्शाता है की आवश्यकता है सेल चक्र के दौरान इन प्रोटीनों। इसलिए, हम यहाँ IIF धुंधला हो जाना और एक मात्रात्मक IIF परख विशेष अंतर्जात और exogenous CENP-ए प्रोटीन के रिश्तेदार स्तर है, जो अलग ढंग से इलाज के नमूनों में लागू किया जा सकता का विश्लेषण करने के तरीकों को विकसित किया। वर्तमान में हम अंतर्जात CENP-मैं, CENP-एच, KNL1, Hec1, और Ska1 इस अध्ययन में प्रोटोकॉल 2 का उपयोग करने का सफल IIF धुंधला हासिल की (; एंटीबॉडी की जानकारी के लिए सामग्री / उपकरण की सूची देखें Niikura एट अल 24 और डेटा नहीं दिखाया गया।) । भविष्य में, एक अलग गुणसूत्रबिंदु-kinetochore प्रोटीन का स्तर यों तो दोनों endog ही विधि लागू कर सकते हैं (enous और फ्लैग टैग exogenous प्रोटीन) विशिष्ट एंटीबॉडी का चयन, तथापि, हमारे IIF तरीकों इन प्रोटीनों का पता लगाने के जीवित कोशिकाओं में या पूरे सेल चक्र के दौरान एक विशिष्ट एकल कक्ष में कवर नहीं है। क्योंकि इन प्रक्रियाओं कोशिकाओं की आवश्यकता तय की और अलग coverslips पर कार्रवाई की जा करने के लिए, हम क्रम काफी अलग नमूनों के बीच संकेतों की तुलना और परख की सटीकता को बढ़ाने के लिए सामान्य बनाने के उद्देश्य के लिए संदर्भ संकेतों (जैसे, एसीए या CENP-बी) की शुरुआत की। क्योंकि एसीए अंतर्जात और / या exogenous CENP-ए का संकेत है, CENP-बी शामिल सामान्य बनाने के उद्देश्य के लिए एक संदर्भ के संकेत एसीए से होगा CENP-ए संकेतों के मात्रात्मक परख की शुद्धता के मामले में तुलना के लिए अधिक उपयुक्त होगा के रूप में। CENP-बी के एमिनो टर्मिनल क्षेत्र alphoid डीएनए में CENP-बी बॉक्स अनुक्रम का 17-बीपी के मूल भाव को बांधता है, और CENP-बी की carboxy टर्मिनल क्षेत्र रूपों homodimers। 43,44 CENP-बी को पूरी तरह से colocalize नहीं है CENP-ए और / या अन्य centr साथomere-kinetochore प्रोटीन, हालांकि, उनके साथ मिलकर जुड़ा हुआ है। 45 जबकि विरोधी CENP-सी एंटीबॉडी के साथ immunofluorescence आम तौर पर दो असतत स्पॉट देता है, विरोधी CENP-बी अक्सर दोनों बहन centromeres को जोड़ने के लिए एक भी उज्ज्वल पट्टी के रूप में प्रकट होता है। हालांकि 46 के साथ धुंधला हो जाना , हमारे वृहद पैमाने पर सूक्ष्म अवलोकन में, कुछ CENP-बी संकेतों जाहिरा तौर पर CENP-ए संकेतों के साथ, विशेष रूप से पहले mitotic चरणों (देर से metaphase prophase-prometaphase) में, भाग में पर्यवेक्षणीय कोण और इस्तेमाल लगानेवाला के प्रकार पर निर्भर करता है ओवरलैप भी (डाटा नहीं दिखाया गया)। इसके विपरीत, CENP-ए संकेतों के एक मात्रात्मक IIF परख में, संदर्भ संकेतों के प्रोटीन स्थानीयकरण कमी और / या निष्पक्ष विश्लेषण के लिए CENP-ए का रोग से प्रभावित नहीं होना चाहिए, हालांकि गुणसूत्रबिंदु-kinetochore प्रोटीन के अधिकांश के स्थानीयकरण पर निर्भर है CENP-ए centromeres पर स्थानीयकरण। 47,48 CENP-ए-स्वतंत्र kinetochore विधानसभा CENP के डीएनए बाध्यकारी क्षेत्रों की जगह से स्थापित है-सी और वैकल्पिक गुणसूत्र को निशाना डोमेन अस्थानिक लोकी के लिए इन प्रोटीनों की भर्ती के साथ कि CENP टी। 49,50 इसके अलावा, हाल ही में काम संकेत दिया कि आंतरिक घटकों kinetochore CENP-सी और समानांतर में CENP आयकर अधिनियम के KMN नेटवर्क भर्ती करने के लिए गुणसूत्रबिंदुओं। 51-54 इसके अलावा, Nishino एट अल। सुझाव दिया है कि CENP-TWSX जटिल रूपों एक अनूठा nucleosome की तरह संरचना डीएनए के साथ संपर्कों उत्पन्न करने के लिए, विहित nucleosome प्रोटीन से परे 'हिस्टोन कोड' का विस्तार। 55 क्योंकि CENP- की गुणसूत्रबिंदु स्थानीयकरण सी CENP-ए का गुणसूत्रबिंदु स्थानीयकरण पर निर्भर है, 47,48 CENP-TWSX या विशेष रूप से CENP टी हो सकता है एक और प्रोटीन उम्मीदवार (s) CENP-ए का एक मात्रात्मक IIF परख में संदर्भ संकेतों प्रदान करने के लिए। हालांकि, संदर्भ संकेतन के लिए उम्मीदवार को ध्यान से निर्धारित करने के लिए centromeres पर स्थानीयकरण कमी और / या CENP-ए का रोग से प्रभावित है कि क्या परख से पहले परीक्षण किया जाना चाहिए। अनुरूप विचारअन्य गुणसूत्रबिंदु-kinetochore प्रोटीन की मात्रात्मक IIF assays के लिए लिया जाना चाहिए: संदर्भ संकेतों के प्रोटीन स्थानीयकरण कमी और / या निष्पक्ष विश्लेषण के लिए लक्ष्य प्रोटीन की शिथिलता से प्रभावित नहीं होना चाहिए। पिछले अध्ययन में, हम अन्य केंद्रीय-बाहरी kinetochore प्रोटीन की मात्रात्मक IIF परख के लिए एक संदर्भ के संकेत के रूप में एसीए इस्तेमाल किया। 24 एसीए एक स्थिति नियंत्रण के रूप में एकल CENP-बी की तुलना में एक अधिक उपयुक्त विकल्प के रूप में अच्छी तरह से एक संदर्भ संकेत है, अगर हो सकता है एसीए संकेतों कमी और / या लक्ष्य प्रोटीन की शिथिलता लेकिन CENP-बी के साथ लक्ष्य प्रोटीन की colocalization से प्रभावित नहीं हैं गरीब उपरोक्त के रूप में है।

Bodor एट अल। खबर दी है कि centromeric CENP-ए का स्तर बड़े पैमाने पर कार्रवाई की है, यानी, centromeric CENP-ए की राशि सेलुलर सामग्री के लिए सीधे अनुपात में बदलता द्वारा विनियमित रहे हैं। उन्होंने यह भी पता चला है कि 56 CENP-ए अभिव्यक्ति की क्षणिक प्रेरण में एक त्वरित वृद्धि हो जाती है centromeric CENP-ए स्तर। इसके विपरीत, हम सीए-UTR siRNAs (5 'और 3' की UTR siRNA एक मिश्रण, 1 टेबल) के साथ pTRM4 अभिव्यक्ति वेक्टर के बाद cotransfection साथ गुणसूत्रबिंदु स्थानीय, फ्लैग टैग CENP-एक WT एक बड़ी सेल की आबादी मनाया (डेटा नहीं दिखाया गया है); इस आबादी केवल pTRM4 अभिव्यक्ति वेक्टर के साथ अभिकर्मक के बाद देखा है कि अधिक से बड़ा था। बहिर्जात करें टैग CENP-ए प्रोटीन का स्तर जिनकी अभिव्यक्ति pTRM4 द्वारा संचालित किया गया था, परिमाण (10 से 25 गुना करने के लिए) अंतर्जात CENP-ए की तुलना में अधिक के लगभग 1.0-1.4 के आदेश था (डेटा) नहीं दिखाया। यह अनुमान लगाया गया है कि एक खास सीमा से ऊपर बहिर्जात CENP-ए गुम्मट की अभिव्यक्ति पर प्रतिकूल इसके समुचित centromeric स्थानीयकरण को प्रभावित कर सकता है।

वर्तमान प्रोटोकॉल में, निर्धारण मूल राज्य के लिए संभव के रूप में समीपस्थ स्थिति के रूप में सेलुलर संरचना और वातावरण बनाए रखने के लिए एक महत्वपूर्ण कदम है। एक बार कोशिकाओं तय कर रहे हैं, एक धुंधला प्रोटोकॉल के साथ आगे बढ़ना inte के प्रोटीन के नुकसान से बचने के लिए चाहिएआराम या सेल के बाकी। हालांकि, निर्धारण प्रतिजनी साइटों को नष्ट कर देता है कभी कभी, और विभिन्न एंटीबॉडी प्रतिजन संयोजन इस बदलाव की वजह से एक दूसरे के साथ लगानेवाला के साथ खराब काम करते हैं, लेकिन बहुत अच्छी तरह से। 21, लगानेवाला का चुनाव काफी हद तक ब्याज की प्रोटीन (ओं) पर निर्भर करता है। निर्धारण के समय की लंबाई काफी, इसलिए immunostaining द्वारा प्रोटीन (एस) का पता लगाने को प्रभावित कर सकते हैं, और आम तौर पर कम निर्धारण प्रतिजनकता बनाए रखने के लिए बेहतर है। 57 जब अन्य गुणसूत्रबिंदु-kinetochore प्रोटीन का एक नया लक्ष्य के लिए धुंधला प्रक्रियाओं का निर्धारण करने, विशेष रूप से अनिश्चित की स्थानीयकरण, या जब एक नई एंटीबॉडी के साथ काम कर रहा है, एक निर्धारण और buffers के कई तरीके इष्टतम स्थिति पता लगाने के लिए परीक्षण करना चाहिए। वर्तमान प्रोटोकॉल में, लोकप्रिय fixatives के दो वर्गों चयन किया गया था: एल्डिहाइड fixatives (प्रोटोकॉल 2) और कार्बनिक सॉल्वैंट्स (प्रोटोकॉल 3 और 4)। fixatives की पवित्रता भी अत्यंत महत्वपूर्ण है। प्रोटोकॉल 4 में, 4% बकरी सीरम especia प्रयोग किया जाता हैlly आईजीजी रिसेप्टर्स को अवरुद्ध एक प्रजाति प्राथमिक एंटीबॉडी के लिए असंबंधित और बेहतर माध्यमिक एंटीबॉडी के रूप में एक ही प्रजाति से होना चाहिए के लिए कोशिका की सतह पर आईजीजी रिसेप्टर्स ब्लॉक करने के लिए अविशिष्ट पृष्ठभूमि को कम करने के लिए। 57 आम तौर पर, सीरम। 57

वर्तमान प्रोटोकॉल से प्रत्येक में, प्राथमिक एंटीबॉडी के चुनाव को सफल immunostaining प्राप्त करने में सबसे महत्वपूर्ण कदम है। सबसे बड़ी विशिष्टता, पवित्रता, आत्मीयता, और उत्सुकता के साथ एंटीबॉडी वांछित है। मोनोक्लोनल एंटीबॉडी के लिए एक अच्छा प्रारंभिक एकाग्रता आमतौर पर 1-5 माइक्रोग्राम / एमएल है। पॉलीक्लोनल एंटीबॉडी का जायजा तैयारी की विशिष्ट dilutions 01:20 करने के लिए 1 से सीमा:। 500 57 एक अनुभव से प्राथमिक एंटीबॉडी की उचित एकाग्रता और प्रत्येक नमूना के लिए मंदक निर्धारित करने के लिए की जरूरत है। नमूने धीरे हिलाकर रख दिया जाना चाहिए, लेकिन समरूप धुंधला के लिए ऊष्मायन के दौरान सूखे नहीं। प्राथमिक और माध्यमिक एंटीबॉडी एक के ऊष्मायन के बीच व्यापक धोनेntibody अन्य प्रजातियों से इम्युनोग्लोबुलिन के साथ पार प्रतिक्रिया से बचने के लिए आवश्यक हो सकता है। हालांकि, इष्टतम धोने हालत अनुभव से निर्धारित किया जाना चाहिए कोशिकाओं, विशेष रूप से mitotic कोशिकाओं है, जो बंद दौर और जब हिल (यानी, mitotic हिला बंद) अलग। 58 सफलता के लिए के नुकसान से बचने के लिए, एक माध्यमिक एंटीबॉडी के लिए बाध्य करने के लिए चुना जाना चाहिए उच्च आत्मीयता के साथ प्राथमिक एंटीबॉडी। उदाहरण के लिए, आईजीजी एफसी रिसेप्टर्स के लिए माध्यमिक एंटीबॉडी के एफसी भाग के अविशिष्ट बाइंडिंग से बचने के लिए, अमेरिकन प्लान (एबी) 2 टुकड़े पूरे एंटीबॉडी के बजाय प्रयोग किया जा सकता है। 57 में कई माध्यमिक एंटीबॉडी के लिए, ऊष्मायन समय 30 मिनट के लिए कम किया जा सकता आरटी पर अविशिष्ट पृष्ठभूमि को कम करने के लिए।

5 प्रोटोकॉल के अलावा, लेजर स्कैनिंग confocal माइक्रोस्कोपी का पता लगाने और स्थानीयकरण और फ्लोरोसेंट गुणों के साथ-गुणसूत्रबिंदु kinetochore प्रोटीन के समारोह का विश्लेषण करने में फायदेमंद हो सकता है। सामग्री / Equipme की सूची में दिखाया गया हैNT, एलेक्सा स्त्राव 488 और 594 एलेक्सा स्त्राव शायद वर्तमान प्रोटोकॉल में सबसे अक्सर इस्तेमाल किया फ्लोरोसेंट रंगों कर रहे हैं। नमूने में दो और / या एकाधिक अलग-गुणसूत्रबिंदु kinetochore प्रोटीन का पता लगाने के लिए, एक सुनिश्चित करना चाहिए कि एक प्रोटीन का पता लगाने के लिए इस्तेमाल किया एंटीबॉडी दूसरे प्रोटीन का पता लगाने को रोकने नहीं है। 57 वर्तमान प्रोटोकॉल में, दो प्राथमिक एंटीबॉडी मिलाया और लागू कर रहे हैं एक ही समय में। हालांकि, एक अलग से प्राथमिक या माध्यमिक एंटीबॉडी एक साथ लागू करने से पहले प्रत्येक प्रोटीन के लिए immunostaining शर्तों का अनुकूलन करना चाहिए: यदि दो प्रोटीन दो गुणसूत्रबिंदु-kinetochore घटकों के मामले में करीब निकटता में हैं, एक प्राथमिक एंटीबॉडी संरचनात्मक रूप से बाध्यकारी रोक सकता है दूसरी प्राथमिक एंटीबॉडी। किसी अन्य के वर्णक्रम चैनल में एक डाई "लीक" से संकेत को रोकने में कठिनाई: एकाधिक संकेत का पता लगाने की एक और चिंता का विषय वर्णक्रमीय ओवरलैप की समस्या है। यह समस्या सम्मेलन के लिए और अधिक मुश्किल हो जाता हैअल हस्तक्षेप फिल्टर रंगों बढ़ जाती है की संख्या के रूप में हल करने के लिए सेट या नमूना overenhanced संकेतों हैं (जैसे, वर्तमान अध्ययन में एसीए या विरोधी झंडा संकेतों), autofluorescence के हस्तक्षेप भी शामिल है। Autofluorescence की समस्या निवारण अन्य अध्ययनों में आयोजित किया गया है। 57,59,60 वर्तमान अध्ययन में, हर चैनल में एकल-लेबल नियंत्रण के साथ फ्लोरोसेंट फिल्टर सेट के अनुकूलन के ज्यादातर मामलों इन समस्याओं (देखें नीचे) से बचने के लिए पर्याप्त है।

वर्तमान प्रोटोकॉल से प्रत्येक में, उचित नियंत्रण जरूरी है। पहले immunostaining शुरू होता है हर नए प्राथमिक एंटीबॉडी विशेषता किया जाना चाहिए। एंटीबॉडी की विशिष्टता यदि लागू हो, पश्चिमी धब्बा विश्लेषण द्वारा पुष्टि की जानी चाहिए। इसके अलावा, पुष्टि है कि धुंधला अविशिष्ट कोशिका की सतह के लिए बाध्यकारी कारण नहीं है प्राप्त किया जाना चाहिए, और एक विशेष प्राथमिक एंटीबॉडी का इष्टतम काम एकाग्रता धारावाहिक dilutions के उपयोग के माध्यम से निर्धारित किया जाना चाहिए(यानी, एक बाध्यकारी वक्र विकसित किया जाना चाहिए)। एक नकारात्मक नियंत्रण (यानी, धुंधला प्रक्रिया से प्राथमिक एंटीबॉडी के अभाव) शामिल किया जाना चाहिए। नकारात्मक नियंत्रण का एक और विकल्प प्राथमिक एंटीबॉडी के लिए एक ही प्रजाति से सामान्य आईजीजी के प्रतिस्थापन है। एकाधिक लेबल का पता लगाने के लिए, एक वर्णक्रमीय ओवरलैप कलाकृतियों (यानी, खून के माध्यम से, विदेशी, crosstalk से बचने के लिए माध्यमिक एंटीबॉडी (पृष्ठभूमि नियंत्रण) के साथ ही एकल लेबल नियंत्रण के बिना नियंत्रण के लिए तैयार करना होगा, या के रूप में ऊपर वर्णित है ", लीक" डाई )। एक, सही संकेत के साथ "गलत" फिल्टर के माध्यम से संकेतों की तुलना इन अनुपात का उपयोग कर computationally सभी हटाने के लिए "लीक" और वास्तविक वितरण और / या फ्लोरोसेंट लेबल के सह स्थानीयकरण कंप्यूटिंग द्वारा "लीक" के अंश यों कर सकते हैं। 60 पृष्ठभूमि नियंत्रण संकेत लाभ की सीमा तय करने के लिए प्रत्येक चैनल के साथ स्वतंत्र रूप से जांच की जानी चाहिए और एडीए होना करने के लिए ऑफसेटअंतिम इमेजिंग के लिए pted। सभी चैनलों कि एक बहु-लेबल नमूने की एक छवि प्राप्त करने के लिए इस्तेमाल किया जाएगा, स्वतंत्र पृष्ठभूमि सुधार के अधीन किया जाना चाहिए, क्योंकि हर चैनल में autofluorescence के स्तर में काफी अंतर होता है। "लीक" के रूप में वर्णित ऊपर का पता लगाने के लिए आसन्न चैनलों में "लीक" बिना हर चैनल में संभव संकेत लाभ की राशि का निर्धारण करने के लिए आवश्यक हैं नियंत्रित करता है। 60

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों घोषणा की कि वे कोई प्रतिस्पर्धा वित्तीय हितों की है कि।

Acknowledgments

यह काम एनआईएच अनुदान GM68418 द्वारा समर्थित किया गया।

Materials

Name Company Catalog Number Comments
Lipofectamin 2000 Life Technologies/Invitrogen 11668 transfection reagent I
Lipofectamin RNAiMAX Life Technologies/Invitrogen 13778 transfection reagent II
Opti-MEM I Life Technologies/Invitrogen 31985 Reduced serum media, warm in 37 °C water bath before use
High-glucose DMEM (Dulbecco’s modified Eagle’s medium) Life Technologies/BioWhittaker 12-604 high-glucose DMEM, warm in 37 °C water bath before use
Fetal Bovine Serum, certified, heat inactivated, US origin Life Technologies/Gibco 10082 FBS (fetal bovine serum)
Poly-L-Lysine SOLUTION SIGMA-SLDRICH P 8920 Poly-L-Lysine, 0.1% w/v, in water
UltraPure Distilled Water Life Technologies/Invitrogen/Gibco 10977 Sterile tissue culture grade water 
Micro Cover glass (22 mm x 22 mm)  Surgipath 105 Cover glass (22 mm x 22 mm) 
6 Well Cell Culture Cluster Fisher/Corning Incorporated 07-200-83 6-well polystyrene plate 
Penicillin, Streptomycin; Liquid Fisher/Gibco 15-140 Penicillin-streptomycin
PAP PEN  Binding Site AD100.1 Hydrophobic barrier pen (for a water repellant barrier in immunofluorescent staining)
Paclitaxel (Taxol) SIGMA-SLDRICH T7402 Taxol for mitotic cell analysis
TN-16, microtubule inhibitor (TN16) Enzo Life Sciences BML-T120 TN16 for mitotic cell analysis
BSA (bovine serum albumin) SIGMA-SLDRICH A7906 Blocking reagent
Triton X-100 SIGMA-SLDRICH T8787 Detergent for permeabilization
Paraformaldehyde SIGMA-SLDRICH P6148 Fixation reagant
DAPI SIGMA-SLDRICH D9542 For nuclear staining
p-phenylenediamine SIGMA-SLDRICH P6001 For mounting medium
VWR Micro Slides, Frosted VWR International 48312-013 Micro slides 
Anti-CENP-A antibody Stressgen/Enzo Life Sciences KAM-CC006 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF), 1:5000 (WB)
Anti-CENP-B antibody Novus Biologicals H00001059-B01P Mouse monoclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-CENP-B antibody  abcam ab25734 Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-centromere antibody (ACA) Fitzgerald Industries International, Inc. 90C-CS1058 Human centromere antiserum; dilution ratio of 1:2000 (IIF)
Anti-CENP-H antibody Bethyl Laboratories BL1112 (A400-007A) Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-H antibody BD 612142 Mouse monoclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-I antibody N/A, Dr. Katusmi Kitagawa N/A, Dr. Katusmi Kitagawa Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF); Niikura et al., Oncogene, 4133-4146 (2006)
Anti-KNL1 antibody Novus Biologicals NBP1-89223 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody Novus Biologicals / GeneTex NB 100-338 / GTX70268 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody GeneTex GTX110735 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Ska1 antibody abcam ab46826 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Flag antibody SIGMA-ALDRICH F3165 Mouse monoclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-Flag antibody SIGMA-ALDRICH F7425 Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-CUL4A antibody N/A, Dr. Pradip Raychaudhuri N/A, Dr. Pradip Raychaudhuri Rabbit polyclonal antibody; dilution ratio of 1:3000 (WB); Shiyanov et al., The Journal of biological chemistry, 35309-35312 (1999)
Anti-RBX1 antibody Cell Signaling 4397 Rabbit polyclonal antibody; dilution ratio of 1:2000 (WB)
Anti-GAPDH antibody Chemicon MAB374 Mouse monoclonal antibody; dilution ratio of 1:5000 (WB)
Alexa Fluor 488 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11001 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11005 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 488 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11008 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11012 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Non fat powdered milk (approved substitution for carnation powdered milk) Fisher Scientific NC9255871 (Reorder No. 190915; Lot# 90629) Skim milk
Leica DM IRE2 motorized fluorescence microscope  Leica motorized fluorescence microscope 
HCX PL APO 63x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PH 3 CS 63X oil immersion lens
HCX PL APO 100x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PHE 100X oil immersion lens
Leica EL6000 compact light source Leica External compact light source for fluorescent excitation
ORCA-R2 Digital CCD camera  Hamamatsu C10600-10B digital CCD camera 
Openlab version 5.5.2 Scientific Imaging Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Velocity version 6.1.1 3D Image Analysis Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Complete EDTA-free protease inhibitor cocktail Roche 11873580001/11836170001 Protease inhibitor cocktail tablets
PlusOne 2-D Quant Kit Amersham Biosciences 80-6483-56 Commercial protein assay reagent I for measurement of protein concentration (compatible with 2% SDS)
Bio-Rad Protein Assay Bio-Rad 500-0006 Commercial protein assay reagent II for measurement of protein concentration (compatible with 0.1% SDS)
Immobilon-FL EMD Millipore IPFL00010 PVDF membrane for transferring
IRDye 800CW Goat Anti-Mouse IgG LI-COR Biosciences 926-32210 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
IRDye 680 Goat Anti-Rabbit IgG LI-COR Biosciences 926-32221 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Mouse IgG DyLight 549 Fisher Scientific PI35507 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Rabbit DyLight 649 Fisher Scientific PI35565 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-mouse IgG-HRP Santa Cruz SC-2005 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Goat anti-rabbit IgG-HRP Santa Cruz SC-2004 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Openlab version 5.5.2. Scientific Imaging Software  Improvision/PerkinElmer Software A
Volocity version 6.3 3D Image Analysis Software (Volocity Acquisition) PerkinElmer Software B1
Volocity version 6.3 3D Image Analysis Software (Volocity Quantification) PerkinElmer Software B2
Branson SONIFIER 450 Sonicator
Branson Ultrasonics sonicator Microtip Step, Solid, Threaded 9.5 mm VWR Scientific Products Inc.  33995-325 Disruptor horn for sonication
Branson Ultrasonics sonicator Microtip Tapered 6.5 mm VWR Scientific Products Inc.  33996-185 Microtip for sonication
Odyssey CLx Infrared imaging System  LI-COR Biosciences Infrared imaging system for immunoblot detection
Image Studio Analysis Software Ver 4.0  LI-COR Biosciences Software C
Molecular Imager Versadoc MP4000 System  Bio-Rad Chemiluminescence imager for immunoblot detection
Quantity One 1-D analysis software  Bio-Rad Software D
SuperSignal West Femto Maximum Sensitivity Substrate Thermo 34095 Ultra-sensitive enhanced chemiluminescent (ECL) substrate

DOWNLOAD MATERIALS LIST

References

  1. DeLuca, J. G., et al. Hec1 and nuf2 are core components of the kinetochore outer plate essential for organizing microtubule attachment sites. Molecular biology of the cell. 16, 519-531 (2005).
  2. Earnshaw, W. C., Halligan, N., Cooke, C., Rothfield, N. The kinetochore is part of the metaphase chromosome scaffold. J Cell Biol. 98, 352-357 (1984).
  3. Hoffman, D. B., Pearson, C. G., Yen, T. J., Howell, B. J., Salmon, E. D. Microtubule-dependent changes in assembly of microtubule motor proteins and mitotic spindle checkpoint proteins at PtK1 kinetochores. Molecular biology of the cell. 12, 1995-2009 (2001).
  4. Regnier, V., et al. CENP-A is required for accurate chromosome segregation and sustained kinetochore association of BubR1. Mol Cell Biol. 25, 3967-3981 (2005).
  5. Bernad, R., Sanchez, P., Losada, A. Epigenetic specification of centromeres by CENP-A. Exp Cell Res. 315, 3233-3241 (2009).
  6. Black, B. E., Cleveland, D. W. Epigenetic centromere propagation and the nature of CENP-a nucleosomes. Cell. 144, 471-479 (2011).
  7. Warburton, P. E., et al. Immunolocalization of CENP-A suggests a distinct nucleosome structure at the inner kinetochore plate of active centromeres. Curr Biol. 7, 901-904 (1997).
  8. Karpen, G. H., Allshire, R. C. The case for epigenetic effects on centromere identity and function. Trends Genet. 13, 489-496 (1997).
  9. Black, B. E., et al. Structural determinants for generating centromeric chromatin. Nature. 430, 578-582 (2004).
  10. Black, B. E., et al. Centromere identity maintained by nucleosomes assembled with histone H3 containing the CENP-A targeting domain. Mol Cell. 25, 309-322 (2007).
  11. Fachinetti, D., et al. A two-step mechanism for epigenetic specification of centromere identity and function. Nat Cell Biol. 15, 1056-1066 (2013).
  12. Zeitlin, S. G., Shelby, R. D., Sullivan, K. F. CENP-A is phosphorylated by Aurora B kinase and plays an unexpected role in completion of cytokinesis. The Journal of cell biology. 155, 1147-1157 (2001).
  13. Zhang, X., Li, X., Marshall, J. B., Zhong, C. X., Dawe, R. K. Phosphoserines on maize CENTROMERIC HISTONE H3 and histone H3 demarcate the centromere and pericentromere during chromosome segregation. The Plant cell. 17, 572-583 (2005).
  14. Goutte-Gattat, D., et al. Phosphorylation of the CENP-A amino-terminus in mitotic centromeric chromatin is required for kinetochore function. Proc Natl Acad Sci U S A. 110, 8579-8584 (2013).
  15. Bailey, A. O., et al. Posttranslational modification of CENP-A influences the conformation of centromeric chromatin. Proc Natl Acad Sci U S A. 110, 11827-11832 (2013).
  16. Samel, A., Cuomo, A., Bonaldi, T., Ehrenhofer-Murray, A. E. Methylation of CenH3 arginine 37 regulates kinetochore integrity and chromosome segregation. Proc Natl Acad Sci U S A. 109, 9029-9034 (2012).
  17. Niikura, Y., et al. CENP-A K124 Ubiquitylation Is Required for CENP-A Deposition at the Centromere. Dev Cell. (2015).
  18. Chan, G. K., Liu, S. T., Yen, T. J. Kinetochore structure and function. Trends in cell biology. 15, 589-598 (2005).
  19. Hori, T., Okada, M., Maenaka, K., Fukagawa, T. CENP-O class proteins form a stable complex and are required for proper kinetochore function. Molecular biology of the cell. 19, 843-854 (2008).
  20. Fukagawa, T., Earnshaw, W. C. The centromere: chromatin foundation for the kinetochore machinery. Developmental cell. 30, 496-508 (2014).
  21. Kedersha, N. The Proteintech Blog.Proteintech. Grainger, D. Proteintech Group. (2012).
  22. Clontech Laboratories, Inc. HeLa Tet-Off Advanced Cell Line. Available from: http://www.clontech.com/CR/Products/Inducible_Systems/Tetracycline-Inducible_Expression/ibcGetAttachment.jsp?cItemId=26908&fileId=6712191&sitex=10020:22372:US (2012).
  23. Meraldi, P., Sorger, P. K. A dual role for Bub1 in the spindle checkpoint and chromosome congression. EMBO J. 24, 1621-1633 (2005).
  24. Niikura, Y., et al. 17-AAG, an Hsp90 inhibitor, causes kinetochore defects: a novel mechanism by which 17-AAG inhibits cell proliferation. Oncogene. 25, 4133-4146 (2006).
  25. Yang, Z., et al. Silencing mitosin induces misaligned chromosomes, premature chromosome decondensation before anaphase onset, and mitotic cell death. Mol Cell Biol. 25, 4062-4074 (2005).
  26. Wang, H., et al. Histone H3 and H4 ubiquitylation by the CUL4-DDB-ROC1 ubiquitin ligase facilitates cellular response to DNA damage. Mol Cell. 22, 383-394 (2006).
  27. Lamb, J. R., Tugendreich, S., Hieter, P. Tetratrico peptide repeat interactions: to TPR or not to TPR? Trends Biochem Sci. 20, 257-259 (1995).
  28. Kitagawa, K., Skowyra, D., Elledge, S. J., Harper, J. W., Hieter, P. SGT1 encodes an essential component of the yeast kinetochore assembly pathway and a novel subunit of the SCF ubiquitin ligase complex. Mol Cell. 4, 21-33 (1999).
  29. Niikura, Y., Dixit, A., Scott, R., Perkins, G., Kitagawa, K. BUB1 mediation of caspase-independent mitotic death determines cell fate. J Cell Biol. 178, 283-296 (2007).
  30. Niikura, Y., Kitagawa, K. Identification of a novel splice variant: human SGT1B (SUGT1B). DNA Seq. 14, 436-441 (2003).
  31. Niikura, Y., Ogi, H., Kikuchi, K., Kitagawa, K. BUB3 that dissociates from BUB1 activates caspase-independent mitotic death (CIMD). Cell Death Differ. 17, 1011-1024 (2010).
  32. Ando, S., Yang, H., Nozaki, N., Okazaki, T., Yoda, K. CENP-A, -B, and -C chromatin complex that contains the I-type alpha-satellite array constitutes the prekinetochore in HeLa cells. Mol Cell Biol. 22, 2229-2241 (2002).
  33. Izuta, H., et al. Comprehensive analysis of the ICEN (Interphase Centromere Complex) components enriched in the CENP-A chromatin of human cells. Genes to cells : devoted to molecular & cellular mechanisms. 11, 673-684 (2006).
  34. Obuse, C., et al. Proteomics analysis of the centromere complex from HeLa interphase cells: UV-damaged DNA binding protein 1 (DDB-1) is a component of the CEN-complex, while BMI-1 is transiently co-localized with the centromeric region in interphase. Genes Cells. 9, 105-120 (2004).
  35. Merlet, J., Burger, J., Gomes, J. E., Pintard, L. Regulation of cullin-RING E3 ubiquitin-ligases by neddylation and dimerization. Cell Mol Life Sci. 66, 1924-1938 (2009).
  36. Bennett, E. J., Rush, J., Gygi, S. P., Harper, J. W. Dynamics of cullin-RING ubiquitin ligase network revealed by systematic quantitative proteomics. Cell. 143, 951-965 (2010).
  37. Antonelli, A., et al. Efficient inhibition of macrophage TNF-alpha production upon targeted delivery of K48R ubiquitin. Br J Haematol. 104, 475-481 (1999).
  38. Codomo, C. A., Furuyama, T., Henikoff, S. CENP-A octamers do not confer a reduction in nucleosome height by AFM. Nat Struct Mol Biol. 21, 4-5 (2014).
  39. Thrower, J. S., Hoffman, L., Rechsteiner, M., Pickart, C. M. Recognition of the polyubiquitin proteolytic signal. The EMBO journal. 19, 94-102 (2000).
  40. Yoda, K., et al. Human centromere protein A (CENP-A) can replace histone H3 in nucleosome reconstitution in vitro. Proc Natl Acad Sci U S A. 97, 7266-7271 (2000).
  41. Shelby, R. D., Vafa, O., Sullivan, K. F. Assembly of CENP-A into centromeric chromatin requires a cooperative array of nucleosomal DNA contact sites. J Cell Biol. 136, 501-513 (1997).
  42. Majumder, S., Fisk, H. A. Quantitative immunofluorescence assay to measure the variation in protein levels at centrosomes. J Vis Exp. (2014).
  43. Masumoto, H., Masukata, H., Muro, Y., Nozaki, N., Okazaki, T. A human centromere antigen (CENP-B) interacts with a short specific sequence in alphoid DNA, a human centromeric satellite. J Cell Biol. 109, 1963-1973 (1989).
  44. Yoda, K., Kitagawa, K., Masumoto, H., Muro, Y., Okazaki, T. A human centromere protein, CENP-B, has a DNA binding domain containing four potential alpha helices at the NH2 terminus, which is separable from dimerizing activity. J Cell Biol. 119, 1413-1427 (1992).
  45. Sugata, N., et al. Human CENP-H multimers colocalize with CENP-A and CENP-C at active centromere--kinetochore complexes. Hum Mol Genet. 9, 2919-2926 (2000).
  46. Earnshaw, W. C., Ratrie, H. 3rd, Stetten, G. Visualization of centromere proteins CENP-B and CENP-C on a stable dicentric chromosome in cytological spreads. Chromosoma. 98, 1-12 (1989).
  47. Goshima, G., Kiyomitsu, T., Yoda, K., Yanagida, M. Human centromere chromatin protein hMis12, essential for equal segregation, is independent of CENP-A loading pathway. J Cell Biol. 160, 25-39 (2003).
  48. Liu, S. T., Rattner, J. B., Jablonski, S. A., Yen, T. J. Mapping the assembly pathways that specify formation of the trilaminar kinetochore plates in human cells. J Cell Biol. 175, 41-53 (2006).
  49. Gascoigne, K. E., Cheeseman, I. M. T time for point centromeres. Nat Cell Biol. 14, 559-561 (2012).
  50. Gascoigne, K. E., et al. Induced ectopic kinetochore assembly bypasses the requirement for CENP-A nucleosomes. Cell. 145, 410-422 (2011).
  51. Nishino, T., et al. CENP-T provides a structural platform for outer kinetochore assembly. EMBO J. 32, 424-436 (2013).
  52. Malvezzi, F., et al. A structural basis for kinetochore recruitment of the Ndc80 complex via two distinct centromere receptors. EMBO J. 32, 409-423 (2013).
  53. Schleiffer, A., et al. CENP-T proteins are conserved centromere receptors of the Ndc80 complex. Nat Cell Biol. 14, 604-613 (2012).
  54. Rago, F., Gascoigne, K. E., Cheeseman, I. M. Distinct organization and regulation of the outer kinetochore KMN network downstream of CENP-C and CENP-T. Curr Biol. 25, 671-677 (2015).
  55. Nishino, T., et al. CENP-T-W-S-X forms a unique centromeric chromatin structure with a histone-like fold. Cell. 148, 487-501 (2012).
  56. Bodor, D. L., et al. The quantitative architecture of centromeric chromatin. Elife. 3, e02137 (2014).
  57. Oliver, C. Ch 58. Molecular Biomethods Handbook. Rapely, R., Walker, J. M. Humana Press. 1063-1079 (2008).
  58. Terasima, T., Tolmach, L. J. Changes in x-ray sensitivity of HeLa cells during the division cycle. Nature. 190, 1210-1211 (1961).
  59. Levenson, G. B. R. Ch 8. Biomedical Photonics Handbook. Vo-Dinh, T. uan CRC Press LLC. 8-19 (2003).
  60. Sanderson, J. Fluorescence bleed-though. Available from: http://www.gum2012.fionastoreydesign.co.uk/Downloads/Bleed through text.pdf (2011).
अंतर्जात के immunofluorescence विश्लेषण और exogenous गुणसूत्रबिंदु-kinetochore प्रोटीन
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).More

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter