Utilisation de l'assemblage de l'ADN, de multiples vecteurs de CRISPR peuvent être construits en parallèle dans une réaction de clonage unique, ce qui rend la construction d'un grand nombre de vecteurs CRISPR une tâche simple. Tomate racines chevelues sont un excellent modèle pour valider des vecteurs CRISPR et de générer des matériaux mutantes.
Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for functional genomics studies. While most cloning strategies are simple to perform, they generally use multiple steps and can require several days to generate the ultimate constructs. The method presented here is based on DNA assembly and can produce fully functional CRISPR vectors in a single cloning reaction. Vector construction can also be pooled, further increasing the efficiency and utility of the process. A modification of the method is used to create CRISPR vectors with multiple gene targets. CRISPR vectors are then transformed into tomato hairy roots to generate transgenic materials with targeted DNA modifications. Hairy roots are a useful system for testing vector functionality as they are technically simple to generate and amenable to large-scale production. The methods presented here will have wide application as they can be used to generate a variety of CRISPR vectors and be used in a wide range of plant species.
La capacité de générer des modifications d'ADN ciblées avec CRISPR / cas9 a un grand potentiel pour les études de génomique fonctionnelle. Il y a deux composantes du système CRISPR / cas9; la nucléase cas9, provenant de Staphylococcus pyogenes et d'environ 100 nt ARN guide (ARNg) molécule qui dirige cas9 vers le site d'ADN cible (s) 1. Reconnaissance cible est conférée par la première ~ 20 nt de l'gARN, ce qui permet une production à haut débit de vecteurs de ciblage 2,3. La plupart des organismes qui peuvent être conçus, ont déjà été avec CRISPR technologie / cas9 4,5.
Dans les plantes, des promoteurs constitutifs tels que le promoteur CaMV 35S, sont couramment utilisés pour diriger l'expression de la nucléase cas9 6. Les ARNg sont exprimés en utilisant les ARN polymérase III U6 ou U3 promoteurs qui restreint la première base du gARN soit un G, pour U6, ou A pour U3, pour une transcription efficace. Cependant l'ARN polymérase II promoteurs, qui sont exempts de ces restrictions, ont également été utilisés 7,8.
Différents ARNg induisent des mutations d'ADN avec des efficacités différentes, et ainsi il peut être important d'abord de valider les vecteurs CRISPR avant d'investir dans des transformations de plantes entières ou de la mise en place de vastes écrans phénotypiques. L' expression transitoire de constructions CRISPR chez les plantes, à l'aide agroinfiltration par exemple, se traduit généralement par une fréquence inférieure de la modification de l' ADN par rapport à des plantes stables 6, ce qui rend difficile la détection de mutations et des analyses phénotypiques peu pratique avec de telles approches. Les soi-disant racines chevelues sont, d'un autre système commode étant donné qu'un grand nombre de matériaux indépendants, transformées de manière stable peuvent être générés en quelques semaines, au lieu de mois pour les plantes stables. Vecteurs CRISPR sont très efficaces pour induire des mutations de l' ADN dans les racines velues 9,10.
les méthodes d'assemblage d'ADN ligaturer efficacement des fragments d'ADN contenant Surpressionapping 11 se termine. Un avantage majeur de certains procédés d'assemblage d'ADN est la capacité d'incorporer ADNss (c. -à- oligos) dans les produits assemblés. Etant donné que ARNg ne sont ~ 20 nt de long et de nouvelles cibles peuvent être réalisées avec des oligos de synthèse, ces procédés d'assemblage d'ADN sont bien adaptés pour le clonage CRISPR. Les protocoles décrits ici sont basés sur la série de vecteurs p201 CRISPR qui a été utilisé avec succès dans 10 le soja, le peuplier 12 et maintenant la tomate. La procédure de clonage présente plusieurs avantages par rapport au procédé 10 de clonage courant. À savoir, des vecteurs totalement fonctionnels peuvent être générés dans une réaction de clonage unique en une seule journée. La construction du vecteur peut également être mis en commun pour générer de multiples vecteurs CRISPR en parallèle, réduisant encore les mains sur les coûts de temps et de matériel. Nous présentons également un protocole pour la production de tomates racines velues comme une méthode efficace pour produire des matériaux transgéniques avec des délétions de gènes ciblés. racines poilues sont utilisés pour validermangé les vecteurs CRISPR et fournir du matériel pour les expériences ultérieures.
Since DNA assembly is used to recombine any overlapping DNA sequences, this cloning method can be applied to any CRISPR vector construction. Most CRISPR cloning schemes use either gene synthesis of the gRNA, type IIS restriction enzymes17,18, or overlap-extension PCR19. Each of these techniques has inherent advantages and disadvantages, but they typically require multiple hands-on cloning steps. The primary advantage of the cloning method presented here is that the entire process occurs in a single,…
The authors have nothing to disclose.
Cette recherche a été financée par la subvention National Science Foundation IOS-1025642 (GBM). Nous remercions Maria Harrison pour fournir la souche ARqua1.
NEBuilder® (HiFi DNA assembly mix) | New England Biolabs | E5520 | |
p201N:Cas9 | Addgene | 59175 | The p201H:Cas9 plasmid (59176) is also compatible with the reported overlaps and enzymes. |
pUC gRNA Shuttle | Addgene | 47024 | |
SwaI | New England Biolabs | R0604S | |
SpeI | New England Biolabs | R0133S | |
Zymo clean and concentrator-5 column purification | Zymo Research | D4003 | |
NEB Buffer 2.1 | New England Biolabs | B7202S | |
NEB CutSmart (Buffer 4) | New England Biolabs | B7204S | |
NEB Buffer 3.1 | New England Biolabs | B7203S | |
EconoSpin Mini Spin Column (plasmid prep) | Epoch Life Sciences | 1910-050/250 | |
EcoRV-HF® | New England Biolabs | R3195S | |
StyI-HF® | New England Biolabs | R3500S | |
MS Salts + Gamborg Vitamins | Phytotechnology Laboratories | M404 | |
Phytagel™ (gellan gum) | Sigma Aldrich | P8169 | |
GA-7 Boxes | Sigma Aldrich | V8505 | |
Micropore™ surgical tape | 3M | 1535-0 | |
Timentin® (Ticarcillin/Clavulanic acid) | Various | 0029-6571-26 | |
Primers 5' -> 3' | |||
SwaI_MtU6F | GATATTAATCTCTTCGATGAAATTTATGCCTATCTTATATGATCAATGAGG | ||
MtU6R | AAGCCTACTGGTTCGCTTGAAG | ||
ScaffoldF | GTTTTAGAGCTAGAAATAGCAAGTT | ||
SpeI_Scaffold R | GTCATGAATTGTAATACGACTCAAAAAAAAGCACCGACTCGGTG | ||
StUbi3P218R | ACATGCACCTAATTTCACTAGATGT | ||
ISceIR | GTGATCGATTACCCTGTTATCCCTAG | Cannot be used for Sanger sequencing since there is a second binding site on the plasmid | |
UNS1_Scaffold R | GAGAATGGATGCGAGTAATGAAAAAAAGCACCGACTCGGTG | ||
UNS1_MtU6 F | CATTACTCGCATCCATTCTCATGCCTATCTTATATGATCAATGAGG | ||
p201R | CGCGCCGAATTCTAGTGATCG | ||
Bolded sequences denote 20-nt overlaps with linearized p201N:Cas9. |