DNA, düzeneğini kullanarak çok CRISPR vektörleri CRISPR çok sayıda yapı yapım tek klonlama reaksiyonda paralel yapılabilir basit bir işlem vektörleri. Domates kıllı kökleri CRISPR vektörleri doğrulamak ve mutant malzemeleri üretmek için mükemmel bir model sistem.
Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for functional genomics studies. While most cloning strategies are simple to perform, they generally use multiple steps and can require several days to generate the ultimate constructs. The method presented here is based on DNA assembly and can produce fully functional CRISPR vectors in a single cloning reaction. Vector construction can also be pooled, further increasing the efficiency and utility of the process. A modification of the method is used to create CRISPR vectors with multiple gene targets. CRISPR vectors are then transformed into tomato hairy roots to generate transgenic materials with targeted DNA modifications. Hairy roots are a useful system for testing vector functionality as they are technically simple to generate and amenable to large-scale production. The methods presented here will have wide application as they can be used to generate a variety of CRISPR vectors and be used in a wide range of plant species.
CRISPR ile hedeflenen DNA değişiklikleri oluşturmak için yeteneği / Cas9 işlevsel genomik çalışmalar için büyük bir potansiyele sahiptir. CRISPR / Cas9 sisteminin iki bileşeni vardır; Staphylococcus pyogenes ve hedefli DNA ekibi (s, 1) Cas9 yönlendiren bir yaklaşık 100 nt kılavuz RNA (gRNA) molekülünden türetilen Cas9 nükleaz. Hedef tanıma, ilk olarak haiz ~ hedefleme vektörleri 2,3 yüksek kapasiteli bir üretim sağlayan gRNA, 20-nt. Tasarlanmış olabilir Çoğu organizmalar, zaten CRISPR / Cas9 teknolojisi 4,5 ile olmuştur.
Bitkiler, CaMV 35S promotörü gibi yapısal promotörler, in, genel olarak Cas9 nükleaz 6 ekspresyonunu tahrik etmek için kullanılır. gRNAs gRNA ilk taban kısıtlayan RNA polimeraz III U6 ya da U3 promoterler kullanılarak ifade edilir ya G, verimli bir transkripsiyon için U3 U6 veya A için. Ancak RNA polimeraz II baloBu kısıtlamaların ücretsiz oters, aynı zamanda 7,8 kullanılmıştır.
Farklı gRNAs farklı verimlilik ile DNA mutasyonlarının neden, ve bu yüzden ilk olarak tüm fabrika dönüşümleri yatırım veya kapsamlı fenotipik ekranlar kurmadan önce CRISPR vektörleri doğrulamak için önemli olabilir. CRISPR geçici ifadesi zordur mutasyonlar ve bu yaklaşımlar ile pratik fenotipik deneylerinin algılama hale stabil bitkilerde 6 ile karşılaştırıldığında, genel olarak, DNA modifikasyon daha düşük bir frekans ile sonuçlanır örneğin agroinfiltration kullanarak, bitkilerde oluşturur. Sözde saçak kökler stabil bitkiler için ay karşı bağımsız kararlı bir şekilde transforme edilmiş bir malzeme çok sayıda hafta içinde oluşturulabilir çünkü uygun, alternatif sistem vardır. CRISPR vektörleri saçak kök 9,10 DNA mutasyonlarının uyaran çok etkilidir.
DNA montaj yöntemleri etkin bir şekilde overl içeren DNA parçalarını birbirine bağlamakapping 11 sona erer. Bazı DNA düzeneği yöntemlerinin önemli bir avantajı birleştirilmiş ürünler haline ssDNA (yani, oligolar) dahil yeteneğidir. gRNAs yalnızca ~ 20 nt uzunluğunda ve yeni hedefler sentezlenen oligo yapılabilir için, bu DNA montaj yöntemleri CRISPR klonlama için de uygundur. Burada anlatılan protokollerin başarılı soya 10, kavak 12 kullanılan ve şu anda domates edilmiş CRISPR vektörlerinin P201 serisi dayanmaktadır. Sunulan klonlama işlemi geçerli klonlama yöntemiyle 10 üzerinde çeşitli avantajlar sunuyor. Yani, tam fonksiyonel vektörler tek bir gün içinde tek bir klonlama reaksiyonda oluşturulabilir. Vektör yapımı daha da eller üzerinde zaman ve malzeme maliyetleri azaltarak, paralel olarak birden fazla CRISPR vektörleri oluşturmak için toplanmış olabilir. Ayrıca hedef gen delesyonlu transjenik malzemeler üretmek için etkili bir yöntem olarak, domates saçak kök oluşumu için bir protokol mevcut. Saçak kök geçerlidir için kullanılırCRISPR vektörleri yedik ve daha sonraki deneyler için malzeme sağlamak.
Since DNA assembly is used to recombine any overlapping DNA sequences, this cloning method can be applied to any CRISPR vector construction. Most CRISPR cloning schemes use either gene synthesis of the gRNA, type IIS restriction enzymes17,18, or overlap-extension PCR19. Each of these techniques has inherent advantages and disadvantages, but they typically require multiple hands-on cloning steps. The primary advantage of the cloning method presented here is that the entire process occurs in a single,…
The authors have nothing to disclose.
Bu araştırma, Ulusal Bilim Vakfı Hibe IOS-1025642 (GBM) tarafından desteklenmiştir. Biz ARqua1 gerginlik sağlamak için Maria Harrison teşekkür ederiz.
NEBuilder® (HiFi DNA assembly mix) | New England Biolabs | E5520 | |
p201N:Cas9 | Addgene | 59175 | The p201H:Cas9 plasmid (59176) is also compatible with the reported overlaps and enzymes. |
pUC gRNA Shuttle | Addgene | 47024 | |
SwaI | New England Biolabs | R0604S | |
SpeI | New England Biolabs | R0133S | |
Zymo clean and concentrator-5 column purification | Zymo Research | D4003 | |
NEB Buffer 2.1 | New England Biolabs | B7202S | |
NEB CutSmart (Buffer 4) | New England Biolabs | B7204S | |
NEB Buffer 3.1 | New England Biolabs | B7203S | |
EconoSpin Mini Spin Column (plasmid prep) | Epoch Life Sciences | 1910-050/250 | |
EcoRV-HF® | New England Biolabs | R3195S | |
StyI-HF® | New England Biolabs | R3500S | |
MS Salts + Gamborg Vitamins | Phytotechnology Laboratories | M404 | |
Phytagel™ (gellan gum) | Sigma Aldrich | P8169 | |
GA-7 Boxes | Sigma Aldrich | V8505 | |
Micropore™ surgical tape | 3M | 1535-0 | |
Timentin® (Ticarcillin/Clavulanic acid) | Various | 0029-6571-26 | |
Primers 5' -> 3' | |||
SwaI_MtU6F | GATATTAATCTCTTCGATGAAATTTATGCCTATCTTATATGATCAATGAGG | ||
MtU6R | AAGCCTACTGGTTCGCTTGAAG | ||
ScaffoldF | GTTTTAGAGCTAGAAATAGCAAGTT | ||
SpeI_Scaffold R | GTCATGAATTGTAATACGACTCAAAAAAAAGCACCGACTCGGTG | ||
StUbi3P218R | ACATGCACCTAATTTCACTAGATGT | ||
ISceIR | GTGATCGATTACCCTGTTATCCCTAG | Cannot be used for Sanger sequencing since there is a second binding site on the plasmid | |
UNS1_Scaffold R | GAGAATGGATGCGAGTAATGAAAAAAAGCACCGACTCGGTG | ||
UNS1_MtU6 F | CATTACTCGCATCCATTCTCATGCCTATCTTATATGATCAATGAGG | ||
p201R | CGCGCCGAATTCTAGTGATCG | ||
Bolded sequences denote 20-nt overlaps with linearized p201N:Cas9. |