Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Inductie van experimentele auto-immune Encefalomyelitis in Muizen en evaluatie van de ziekte-afhankelijke Verdeling van immuuncellen in verschillende weefsels

Published: May 8, 2016 doi: 10.3791/53933
* These authors contributed equally

Abstract

Multiple sclerose wordt als een autoimmune ziekte, die wordt gekenmerkt door laesievorming in het centrale zenuwstelsel (CNS) leidt tot cognitieve en motorische stoornissen zijn. Experimentele autoimmuun encefalomyelitis (EAE) een nuttig diermodel van MS, omdat het ook gekenmerkt door laesievorming in het CNS, motorische beschadiging en wordt ook aangedreven door auto-immuunziekten en inflammatoire reacties. Een van de modellen EAE wordt geïnduceerd met een peptide afgeleid van myeline oligodendrocyt-eiwit (MOG) 35-55 bij muizen. De EAE muizen ontwikkelen een progressieve ziekte natuurlijk. Deze cursus is verdeeld in drie fasen: de preklinische fase (dag 0-9), het begin van de ziekte (dag 10 - 11) en de acute fase (dag 12 - 14). MS en EAE geïnduceerd door autoreactieve T-cellen die infiltreren het CZS. Deze T-cellen scheiden chemokines en cytokines die leiden tot de aanwerving van verdere immuuncellen. Daarom is de immune celverdeling in het ruggenmerg dijdens de drie fasen ziekte onderzocht. Het tijdstip van de ziekte waarop de activering / proliferatie / accumulatie van T-cellen, B-cellen en monocyten begint markeren werd de immuuncel verdeling lymfklieren, milt en bloed ook beoordeeld. Bovendien voert de verschillende cytokines (IL-1β, IL-6, IL-23, TNFa, IFNy) in de drie ziekte fasen werden bepaald, inzicht in de ontstekingsprocessen van de ziekte. Concluderend, de data geven een overzicht van de functionele profiel van immuuncellen in EAE pathologie.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Multiple sclerose (MS) en de bijbehorende diermodel, experimentele autoimmuun encefalomyelitis (EAE), tonen autoimmune neuroinflammatie veranderingen in het centrale zenuwstelsel (CNS). Vroege actieve MS en EAE letsels worden gekenmerkt door de aanwezigheid van geïnfiltreerde immuuncellen. De etiologie van MS nog steeds onbekend, maar wordt algemeen beschouwd als de vernietiging van myeline gemedieerd door autoreactieve T-cellen omvatten. Deze autoreactieve T-cellen scheiden cytokines en chemokines die andere immune cellen zoals B cellen, monocyten en neutrofielen uit de circulatie te trekken. Monocyten differentiëren tot macrofagen. Interferon gamma (IFNy) uitgescheiden door autoreactieve T cellen polariseert de macrofagen in pro-inflammatoire macrofagen. De pro-inflammatoire cytokinen macrofagen afgifte en reactieve zuurstofdeeltjes die apoptose in oligodendrocyten te bevorderen. De dood van de oligodendrocyten leidt tot demyelinisatie. Voorts B-cellen differentiëren tot pLasma cellen en afgifte autoantilichamen tegen de myelineschede, uiteindelijk leidt tot afbraak van myeline. Het verlies van myeline leidt tot afbraak van axonen en neuronen en daardoor de vorming van laesie plaatsen in het CZS die de belangrijkste kenmerk van MS 1 vertegenwoordigen. In de periferie, worden T-cellen en B-cellen geactiveerd in de lymfeklieren, ze prolifereren in de milt en migreren door de circulatie in het centrale zenuwstelsel. Monocyten en neutrofielen prolifereren in het beenmerg en ook migreren door de circulatie in het centrale zenuwstelsel.

Leukocytextravasatie uit beenmerg, milt en lymfeknopen in het bloed of uit de bloedstroom in het centraal zenuwstelsel is een meerstaps proces dat afhankelijk is van verschillende factoren, waaronder moleculaire interacties tussen leukocyten en endotheel gemedieerd door chemokines en chemokinereceptoren. De productie van chemokinen van verschillende celtypen kunnen worden geïnduceerd tijdens de immune keuze reactietijdn door cytokinen zoals tumornecrosefactor-α (TNFa), IFNy en interleukine-6 ​​(IL-6), die vervolgens rekruteert immuuncellen naar de plaats van ontsteking 2,3. Immune cellen vormen een subset van chemokine receptoren op hun oppervlak, afhankelijk van het celtype en migratie pad naar de ontstekingsplaats. Aldus CXCR2, CCR1 en CXCR1 uitgedrukt op rijpe neutrofielen in het beenmerg en bloed 4 en binding van de liganden, CXCL2, CCL5 of CXCL6 respectievelijk activeert neutrofielen en bevordert hechting aan het endotheel en vervolgens de migratie van de cellen in de weefsels 5-9. CCL2 en CCL20 trekken monocyten en Th1 / Th17 cellen 10, die CCR2 11 en CCR6 12 respectievelijk uit te drukken,. CCR1 en CCR5, door verschillende celtypen, waaronder T-cellen, monocyten en macrofagen 13 uitgedrukt, binden CCL3, CCL5 en CCL7 en worden opgereguleerd tijdens MS-14. CXCR3 wordt uitgedrukt op T-cellen en bindt CCL9, CCL10 enCCL11 15.

Een belangrijkste strategie bij MS behandeling is de uitputting van immuuncellen of voorkomen van immuuncellen infiltratie in het CNS. Daarom heeft de blokkade van specifieke chemokine receptoren onderzocht in EAE. Antagonisme of genetische deletie van CCR1 16, CCR2 17, CCR7 18 of CXCR2 19 vermindert EAE pathologie, terwijl antagonisme of genetische deletie van CCR1 20, leverde CCR5 20 of CXCR3 21 niet de pathologie te verminderen. Daarom is de expressie van specifieke chemokine receptoren op leukocyten is cruciaal voor de infiltratie van de laatste in het CZS en bepaalt het verloop van EAE.

De uitputting van immuuncellen is een effectieve behandelingsstrategie voor MS-patiënten, omdat geïnfiltreerd immune cellen geven cytokines zoals TNFa, IL-6 en IL-1β, die op zijn beurt het bevorderen ontstekingsproces of afbraak van 22 neuronen. Bovendien auto-reactieve Th1 cellen geven IFNy, die op zijn beurt stimuleert macrofagen TNFa, IL-1β en IL-23 vrij.

Dit manuscript beschrijft de inductie van EAE, het bepalen van de immune celverdeling en cytokine niveaus (mRNA) in verschillende weefsels in muizen EAE. Cellen werden op verschillende tijdstippen die in het ziekteverloop een tijdsafhankelijke overzicht van inflammatoire processen die uiteindelijk leiden tot laesievorming in het CZS verschaffen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ETHIEK STATEMENT: Onze experimentele procedures worden goedgekeurd door de ethische commissie van het Regierungspräsidium Darmstadt (Duitsland) en bevestigen om nationale en Europese regelgeving. Alle inspanningen werden gedaan om het dierenleed te beperken en het aantal gebruikte dieren te verminderen.

1. EAE Model

  1. Inductie van de EAE model
    1. Gebruik 10- tot 13-weken oude vrouwelijke 129S4 / SvJae x C57BL / 6 muizen voor de inductie van EAE.
    2. Geven de muizen een subcutane injectie in de bovenste en onderrug van de encefalitogene MOG 35-55 (myeline oligodendrocyt glycoproteïne) peptide (200 ug), geëmulgeerd in 200 gl compleet Freund`s adjuvant (CFA) dat 400 ug Mycobacterium tuberculosis.
      Opmerking: Als negatieve, niet-ziekteverwekkende sham control, incompleet Freund's adjuvans met Mycobacterium tuberculosis, in hetzelfde volume en via dezelfde weg, kan worden gebruikt.
    3. TherENadat en opnieuw 24 uur later, geven de muizen een intraperitoneale injectie van pertussis toxine (in totaal 0,2 g, verdund in 200 ul fosfaat-gebufferde zoutoplossing, PBS). Onbehandeld muizen als controlegroep, te kunnen vergelijken met zieke gezonde dieren.
      Opmerking: Het is ook mogelijk om EAE te induceren met 200-300 gg MOG 35-55 peptide 300-500 ug Mycobacterium tuberculosis in CFA en 0,2-0,3 ug pertussis toxine in een volume van 0,1-0,2 ml per injectie.
    4. Beginnend één week na de injectie, onderzoeken muizen die dagelijks voor de klinische symptomen (zie stap 1.2.1)
      Opmerking: de dag van begin van de ziekte varieert in verschillende experimenten, maar onder de omstandigheden in ons laboratorium, is rond dag 11 en dus hier dag 14 gedefinieerd als 3 dagen na het begin van de ziekte. Alle muizen in deze studie ontwikkelde klinische symptomen.
  2. Scoren van de muizen
    1. Classificeren klinische symptomen van klinische scores als volgt:0) geen tekenen, 0,5) distale verlamming van de staart, 1) volledige verlamming van de staart, 1.5) slappe staart en een lichte zwakte van de achterpoten, 2) slappe staart en ernstige zwakte van de achterpoten, 2.5) slappe staart en verlamming van één achterpoot, 3) slappe staart en verlamming van beide achterpoten, 3.5) verlamming van beide achterpoten en zwakte van één voorste ledemaat (muizen het bereiken van deze score werden gedood, in overeenstemming met de lokale ethische richtlijnen).

2. Voorbereiding van de Single Cellen voor Flowcytometrieanalyse

Opmerking: Het antilichaam mengsel bestaat uit 1 pi CD45-Vioblue, 2 pl CD8-eFluor650, 0,5 gl CD11b-eFluor605, 0,5 gl F4 / 80-PE-Cy7, 1 ui CD3-PE-CF594, CD4-V500, 0,5 gl CD11c -AlexaFluor700, 1 ul CD19-APC-H7 en 1 pl Ly6G-APC-Cy7.

Let op: Als je bloed, lymfeklieren, milt en het ruggenmerg neem vervolgens de procedure is als volgt: Muizen zijn diep verdoofd met een combinatie van isoflUrane (2% in carbogen per minuut) en ketamine (100 mg / kg lichaamsgewicht). Volgende open de thorax, verwijder het bloed met een intracardiale stick en perfuseren de muizen intracardiaal met koude PBS. verwijder de lymfeklieren gevolgd door milt en tenslotte het ruggenmerg. Als u niet nodig om de muizen intracardiaal perfuseren dan euthanaseren de muizen onder diepe narcose door luxatie van de nek.

  1. Isolatie van splenocyten
    1. Verdoven muizen met een combinatie van isofluraan (2% in carbogen per minuut) en ketamine (100 mg / kg lichaamsgewicht).
    2. Natte incisie met 80% isopropanol om eventuele besmetting met haren te voorkomen en open de thorax de lengterichting, zonder prikken diepere weefsels, met een schaar.
    3. Perfuseren muizen intracardiaal met koude PBS pH 7,0 23.
      Opmerking: De milt is gelegen in de linker superieure abdominale kwadrant onder de ribbenkast. Als alleen de milt worden bestudeerd, kan dit orgaan worden verwijderd voordat de perfusie om retain alle celtypen van belang.
    4. Verwijder de milt en afgesneden ongeveer 1/8 en wegen. Bewaar het monster in PBS op ijs.
    5. Knijp het miltweefsel door een 70 urn mesh zeef (geplaatst over een 50 ml buisje) met de zuiger van een 2 ml injectiespuit.
    6. Was de zeef met 5 ml PBS. Centrifugeer bij 1800 xg gedurende 3 min. Resuspendeer de pellet in 500 pl lyserende oplossing.
      Opmerking: In dit stadium kan het nodig zijn om een ​​differentiële celtelling wanneer later een alternatieve FACS analyse methode toegepast die geen kralen (zie hoofdstuk 3) dienst heeft.
    7. Incubeer gedurende 10 minuten bij kamertemperatuur (KT) en voeg 500 ul PBS. Centrifugeer 6 min bij 650 xg bij kamertemperatuur (RT).
    8. Herhaal de wasstap met 500 pi PBS. Verwijder het supernatant, resuspendeer de celpellet in 100 gl 0,2% runderserumalbumine (BSA) / PBS, voeg 2 pl Fc-receptor-1 (FcRI) blokkerende buffer en incubeer gedurende 15 minuten bij kamertemperatuur in het donker.
    9. Voeg 13 ul van eentibody mengsel, incubeer 15 min bij kamertemperatuur in het donker, voeg 500 ul PBS en centrifugeer gedurende 6 min bij 650 x g bij kamertemperatuur. Verwijder het supernatant.
      Opmerking: kleuringsprocedure de fabrikant aanbevolen één wasbeurt, maar extra reductie van achtergrondkleuring kan worden bereikt door eventueel herhalen van de wasstap een of twee keer.
    10. Resuspendeer de celpellet in 500 ui PBS (of eventueel loopbuffer voor eiwitscheiding om te beperken die cel klonteren) en mogelijk in de flowcytometrie buis. Houd cellen op ijs.
  2. Isolatie van lymfeknoopcellen
    1. Verdoven muizen met een combinatie van isofluraan (2% in carbogen per minuut) en ketamine (100 mg / kg lichaamsgewicht).
    2. Natte incisie met 80% isopropanol en open de thorax in lengterichting met een schaar. Perfuseren muizen intracardiaal met koude PBS pH 7,0 23.
    3. Om de lies lymfeklier te isoleren, verwijder voorzichtig de huid in het gebied van de hip en kies de lymfeklier voorzichtig uit het vetweefsel met een tang. Weeg de lies lymfeklier en bewaar het monster in PBS op ijs.
      Opmerking: We gebruikten inguinale lymfeklieren in onze studies omdat O`Connor et al. gevonden dat grote aantallen van geactiveerde monocyten, macrofagen, neutrofielen en T-cellen waren aanwezig in de inguinale lymfeknopen na EAE inductie 24.
    4. Knijp de lymfeklier door een 70 um mesh zeef (geplaatst over een 50 ml tube) met behulp van de zuiger van een 2 ml spuit.
    5. Was de zeef met 5 ml PBS. Centrifugeer bij 2400 xg gedurende 8 minuten. Resuspendeer de celpellet in 100 gl 0,2% BSA / PBS, voeg 2 ul FcRI blokkeerbuffer en incubeer gedurende 15 minuten bij kamertemperatuur in het donker.
    6. Voeg 13 ul antilichaam mengsel, incubeer 15 min bij kamertemperatuur in het donker, voeg 500 ul PBS en centrifugeer gedurende 6 min bij 650 x g bij kamertemperatuur.
    7. Verwijder het supernatant, resuspendeer de celpellet in 300 ui PBS (of een geschikte loopbuffer) en overbrengeneen flowcytometrie buis.
  3. Isolatie van bloedcellen
    1. Voeg 50 ul 20 mM HEPES bij 50 pl bloed (gestabiliseerd met EDTA) en voeg 500 ul lyserende oplossing. Incubeer gedurende 10 minuten bij kamertemperatuur en voeg 500 ul PBS. Centrifugeer 6 min bij 650 x g bij kamertemperatuur. Gooi supernatant en herhaal de wasstap.
    2. Resuspendeer de celpellet in 100 gl 0,2% BSA / PBS, voeg 2 ul FcRI blokkeerbuffer en incubeer gedurende 15 minuten bij kamertemperatuur in het donker.
    3. Voeg 13 ul antilichaam mengsel, incubeer 15 min bij kamertemperatuur in het donker, voeg 500 ul PBS en centrifugeer gedurende 6 min bij 650 x g bij kamertemperatuur. Verwijder het supernatant, resuspendeer de celpellet in 300 pi PBS en mogelijk in de flowcytometrie buis.
  4. Isolatie van het ruggenmerg cellen
    1. Verdoven muizen met een combinatie van isofluraan (2% in carbogen per minuut) en ketamine (100 mg / kg lichaamsgewicht).
    2. Natte incisie met 80% isopropanol en open de thorax lengterichtingmet een schaar. Perfuseren muizen intracardiaal met koude PBS pH 7,0 23.
    3. Bevochtig de incisie gebied op de rug en maak weer een longitudinale snit met een scalpel en verwijder de huid.
    4. Knip het lumbale deel van de wervelkolom (die de achterpoten innervates) en spoelen met PBS een injectiespuit aan het ruggenmerg extraheren. Knip ongeveer 1/3 van de lumbale koord, weegt dit en bewaar het monster in PBS op ijs.
    5. Centrifugeer bij 250 xg gedurende 2 min bij 4 ° C. Verwijder het supernatant, voeg 500 ul cel losraken oplossing en HBSS (1: 1). Voeg 3 mg / ml collagenase A en 1 eenheid / ml DNase I, onthalzen de cellen door herhaaldelijk op en neer pipetteren en incubeer gedurende 30 minuten onder schudden bij 37 ° C bij 400 rpm.
      Opmerking: Desgewenst kan de celsuspensie worden vrijgemaakt van verontreinigende myeline en celresten door dichtheidsgradiënt centrifugatie die de gevoeligheid van de meting kan flowcytometrie verbeteren daardoor reducerende achtergrond autofluorescentie eend het aantal gebeurtenissen die moeten worden overgenomen (zie paragraaf 3.5).
    6. Centrifugeer bij 250 xg gedurende 2 minuten bij kamertemperatuur. Verwijder het supernatant, resuspendeer de pellet in 1 ml 10% foetaal kalfsserum (FCS) / Dulbecco's minimaal essentieel medium (DMEM) en onthalzen de cellen opnieuw door herhaaldelijk op en neer te pipetteren.
    7. Centrifugeer bij 250 xg gedurende 2 minuten bij kamertemperatuur. Herhaal de wasstap.
    8. Resuspendeer de celpellet in 1 ml PBS en knijp het ruggenmerg door een 70 urn mesh zeef (geplaatst over een 50 ml buisje) met de zuiger van een 2 ml injectiespuit.
    9. Was de zeef met 4 ml PBS. Centrifugeer bij 1800 g gedurende 3 minuten bij kamertemperatuur. Verwijder het supernatant, resuspendeer de celpellet in 100 gl 0,2% BSA / PBS, voeg 2 ul FcRI blokkerende reagens en incubeer gedurende 15 minuten bij kamertemperatuur in het donker.
    10. Voeg 13 ul antilichaam mengsel, incubeer 15 min bij kamertemperatuur in het donker, voeg 500 ul PBS en centrifugeer gedurende 6 min bij 650 x g bij kamertemperatuur.
    11. Verwijder het supernatant, resuspendeer de cel pellet in 500 pl PBS (of een geschikte loopbuffer) en mogelijk in de flowcytometrie buis.

3. Flow cytometrische analyse

  1. Titreer alle antilichamen vooraf optimale concentraties te bepalen zoals beschreven door Olesch et al. 25.
  2. Gebruik antilichaam vastleggen compensatie kralen voor eenkleurige compensatie multi-color compensatie matrices maken volgens de instructies fabrikant `.
  3. Controle van de kalibratie dagelijks met behulp van specifieke kralen volgens de instructies de fabrikant.
  4. Direct voor de flowcytometrie meting, voeg 30 ul flowcytometrische absolute aantal standaard om de cellen (voor isolatie zie paragraaf 2,1, 2,2, 2,3, 2,4) absolute celtellingen bepalen. In plaats van het tellen van kralen van de cellen kunnen worden geteld.
  5. Neem monsters (cellen uit de milt, lymfeklieren en bloed: 100.000 gebeurtenissen, het ruggenmerg: 500.000 events) in een flowcytometer eennd analyse met behulp van specifieke software flowcytometrie.
    1. Open de flowcytometrie software en FCS toe te voegen 3.0-bestanden door te drukken op de knop "add samples".
    2. Open het bestand toegevoegd door te dubbelklikken. Stel de kanalen voor de x- en y-as. Om selecteert u de cel populaties van belang te creëren een poort (zie figuur 4).

4. Kwantitatieve PCR analyse

  1. Isolatie van mRNA en transcriptie in cDNA
    1. Pak het mRNA van lumbale ruggenmerg (1/3), milt (1/8) en lies lymfeklieren door fenol-chloroform en neerslaan met ethanol 26.
      1. Hiervoor Homogeniseer het weefsel in 1 ml guanidinium thiocyanaat-fenol mengsel, incubeer gedurende 10 minuten. Voeg 200 ul chloroform en opnieuw incubeer gedurende 10 minuten.
      2. Na een centrifugatie stap (18.000 g gedurende 15 min bij 4 ° C), was de bovenste waterige fase met 500 pl isopropanol en centrifugeer (18.000 xg gedurende 8 minuten bij 4° C).
      3. Was de pellet met 500 pi ethanol en na centrifugatie stap (18.000 g gedurende 5 min bij 4 ° C), droog de pellet in de vacuümconcentrator (5 min bij 30 ° C). Daarna resuspendeer de pellet in 30 ul water.
    2. Om het mRNA te extraheren uit bloed, centrifuge 500 gl EDTA-bloed gestabiliseerd (300 x g 10 min 4 ° C).
      1. Neem de bufferlaag, die witte bloedcellen en verdund in 1 ml lyserende oplossing (150 mM NH4Cl, 100 mM NaHCO 3, 0,1 mM Na-EDTA pH 7,4).
      2. Na 10 minuten incubatie bij kamertemperatuur, gecentrifugeerd cellen bij 650 g gedurende 6 minuten en vervolgens tweemaal wassen met PBS.
      3. Extraheer het mRNA van witte bloedcellen (WBC's) met een kit voor RNA extractie volgens de instructies van de fabrikant.
    3. Voeren cDNA-synthese onder toepassing van een kit voor cDNA-synthese zoals willekeurige hexameren volgens de instructies van de fabrikant. Gebruik 200 ng mRNA voor het CDNEen synthese.
  2. kwantitatieve PCR
    1. Om de hoeveelheid van een specifiek mRNA te kwantificeren, gebruiken 1 ui cDNA, 1 uM vooruit / achteruit primer en een fluorescerende DNA-bindende kleurstof volgens de instructies van de fabrikant 27. Zie Tabel 1 voor de sequenties voor de primer sets. Meet de CT-waarden van IL-1β, IL-6, IL-23, IFNy, TNFa en PPIA (peptidyl prolyl isomerase) met een kwantitatieve PCR systeem.
    2. Om te bepalen van de relatieve mRNA expressie gebruik maken van de vergelijkende methode 27 CT (cyclus drempelwaarde).
      1. Hiervoor normaliseren CT-waarden van de doelgenen de expressieniveaus van PPIA door het aftrekken van de gemiddelde CT-waarde PPIA van het doelwitgen, zoals in eerdere studies (Barthelmes et al. 28, Schiffmann et al. 29, Schiffmann et al. 30). Vervolgens berekent de zogenaamde ΔΔCT-waarden, met behulp waarvan de AC T-waarden normaliserenvan de doelgenen van EAE muizen om het expressieniveau van de doelwitgenen van onbehandelde muizen, weer door het aftrekken van de gemiddelde AC T-waarde in de onbehandelde muizen uit de AC T-waarde in EAE muizen.
      2. De relatieve mRNA-expressie van het doelwitgen te krijgen, berekent de verhouding met de volgende formule: 2 - ΔΔct.
  3. Test de specificiteit van elke primer. Bepaal het geamplificeerde fragment in door middel van een 2% agarosegel 31. De fragmentgrootte is weergegeven in tabel 1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Figuur 1 geeft een schematisch overzicht van de verschillende methoden beschreven in dit artikel. 1) Muizen krijgen een injectie van MOG 35-55 antigen en de ontwikkeling van de eerste klinische symptomen na 10,7 ± 0,3 dagen 28. Een vertegenwoordiger ziekteverloop van EAE muizen wordt weergegeven in figuur 1. 2) verschillende weefsels (milt, lymfeknopen, lumbale ruggenmerg) en bloed worden uit controle- en EAE muizen op verschillende tijdstippen in de preklinische fase (dag 2, dag 4 , dag 6), tijdens het begin van de ziekte (dag 10) en tijdens de acute fase van de ziekte (dag 12, dag 14). 3) het mRNA expressieprofiel van cytokines, die EAE ontwikkeling reguleren, wordt bepaald in de verschillende weefsels geëxtraheerde op verschillende tijdstippen tijdens het ziekteverloop, met behulp van kwantitatieve PCR. 4) Enige cellen geïsoleerd uit verschillende weefsels geëxtraheerdop verschillende tijdstippen tijdens het ziekteverloop en de immune celverdeling bepaald middels flowcytometrie.

In milt en lymfeklieren, worden T-cellen en B-cellen waargenomen als de voornaamste celtype. In tegenstelling tot de lymfeknopen, in de milt, bovendien, een groot aantal monocyten en neutrofielen aanwezig. Alle immune cellen een tijdelijke toename van de lymfeklieren in de acute fase, terwijl alleen macrofagen, B-cellen, T-cellen en neutrofielen verhoging van de milt. In bloed, alle immuuncellen verhogen tijdelijk in de preklinische fase. In het lumbale ruggenmerg, is een ziekte-afhankelijke toename in alle immuuncellen waargenomen naast monocyten, die vermoedelijk differentiëren tot macrofagen na binnenkomst in het ruggenmerg (figuur 2). CD4 + en CD8 + -T-cellen vertonen vergelijkbare veranderingen in milt, lymfeknopen en bloed tijdens de verschillende vakken ziekte. benong cellen infiltreren het ruggenmerg, was de toename van CD4 + T-cellen grootst (figuur 3). In figuur 4 wordt de gating-strategie voor het bepalen van de verschillende celpopulaties getoond. monocyten (CD45hi, CD3-, Ly6G-, CD19-, CD11c-, CD11b +), macrofagen (CD45hi, CD3-, Ly6G-, CD11c-, CD11b +, F4 /: in detail werden celpopulaties in dit manuscript als volgt beschreven geïdentificeerd 80hi), neutrofielen (CD45hi, CD3-, CD11b +, Ly6G +), dendritische cellen (CD45hi, CD3-, Ly6G-, CD19-, CD 11 c +), B-cellen (CD45hi, CD3-, CD19 +) T-cellen (CD45hi, CD3 +) CD4 + T-cellen (CD45hi, CD3 +, CD4 +) en CD8 + T-cellen (CD45hi, CD3 +, CD8 +). Het aantal cellen hebben betrekking op de hoeveelheid weefsel (gewicht van de milt, lymfeknopen, lumbale ruggenmerg) of het bloedvolume, waaruit de absolute celtelling. Het is echter mogelijk om de celtypen tot expressie als percentage van totale cellen gemeten.

in LYMph knooppunten, wordt de expressie van IL-23 mRNA tijdelijk verhoogd in de preklinische fase, terwijl de expressie van IL-6 mRNA nam op ziekte-afhankelijke wijze. In de milt, verhoogt IL-6 en IL-23 mRNA expressie tijdelijk in de preklinische fase, terwijl bij het begin van de ziekte, IL-1β mRNA-expressie wordt verhoogd. In bloed, is de expressie van TNFa mRNA verhoogd in een ziekte-afhankelijke wijze. In het lumbale ruggenmerg, TNFa, IL-1β en verhoging IFNy tijdens de acute fase, terwijl IL-6 opgereguleerd gedurende de aanzet fase (figuur 5).

Figuur 1

Figuur 1: Schema van de workflow voor inductie en immunologische Beoordeling van EAE. 1) EAE geïnduceerd in muizen leidt tot de ontwikkeling van klinische symptomen. Klinische symptomen zijn classified door klinische scores, als volgt: 0) geen tekenen, 0,5) distale verlamming van de staart, 1) volledige verlamming van de staart, 1.5) slappe staart en een lichte zwakte van de achterpoten, 2) slappe staart en ernstige zwakte van de achterpoten , 2.5) slappe staart en verlamming van een achterpoot, 3) slappe staart en verlamming van beide achterpoten. Het aantal muizen die in het getoonde cijfer was 7. De figuur is aangepast Barthelmes et al. 28. 2) De muizen worden in het ziekteverloop, milt, inguïnale lymfklieren, bloed en lumbale ruggenmerg op verschillende tijdstippen opgeofferd geëxtraheerd en enkele cellen geïsoleerd uit deze weefsels. 3) Immune celverdeling in verschillende weefsels, zoals bepaald met flowcytometrie. 4) mRNA expressie van verschillende cytokinen in verschillende weefsels, zoals bepaald door kwantitatieve PCR. klik hier om een grotere versie te bekijken van deze fIGUUR.

Figuur 2
Figuur 2:. Immune Cell Distribution, bepaald door FACS (fluorescentie-geactiveerde celsortering) analyse in milt, lymfeklier, Blood and Spinal Cord Monsters van EAE muizen in verschillende stadia van de ziekte in het experiment weergegeven, het aantal muizen per groep 2 - 10. de verdeling van neutrofielen / monocyten in het bloed en neutrofielen / macrofagen in het ruggenmerg worden aangepast en gewijzigd ten opzichte van Barthelmes et al. 28. klik hier om een grotere versie van deze figuur te bekijken.

figuur 3
Figuur 3: CD4 + -T-cellen en CD8 T-cellen Distributie in Monsters van EAE muizen op verschillende stadia van de ziekte, bepaald door FACS-analyse. A) lymfeknoop, B) milt, C) bloed en D) ruggenmerg. In het getoonde experiment, het aantal muizen per groep was 2 - 10. De resultaten zijn weergegeven als gemiddelden ± standaardfouten (SEM). Klik hier om een grotere versie van deze figuur te bekijken.

figuur 4
Figuur 4: Gating strategie voor Flow cytometrische analyse van T-cellen, B-cellen, neutrofielen, monocyten, dendritische cellen en macrofagen uit het ruggenmerg van EAE muizen op dag 12.) Een perceel van SSC / CD45 van alle cellen. Gate:. CD45 + cellen B) Een perceel van FSC-H / FSC-W van CD45 + cellens. Gate: enkele cellen C) Een perceel van SSC-A / FSC-A van enkelvoudige cellen.. Gate: levensvatbare cellen. D) Een perceel van FSC-H / CD3 van levensvatbare cellen. Gate: CD3 + en CD3 - cellen E) Een perceel van CD4 / CD8 van CD3 + cellen.. Poort CD4 + CD8 - (CD4 + T-cellen) en CD4 - CD8 + (CD8 + T-cellen) F) Een grafiek van CD19 en Ly6G / CD11b van CD3 - cellen.. Gate: CD19 + CD11b - cellen (B-cellen), Ly6G + CD11b + cellen (neutrofielen) en CD19 - Ly6G - cellen G) Een perceel van CD11c / CD11b cellen uit CD19 - Ly6G - cellen. Gate CD11c + cellen (dendritische cellen ) en CD11c - cellen H) Een perceel van SSC / F4 / 80 fr.OM CD11c - cellen. Gate: F4 / 80 - cellen (monocyten) en F4 / 80 + cellen (macrofagen). Een vertegenwoordiger perceel van 9 wordt getoond. Klik hier om een grotere versie van deze figuur te bekijken.

figuur 5
Figuur 5:. Cytokine profiel (IL-1β, IL-6, IL-23, TNFa, IFNy) in Monsters van EAE muizen op verschillende ziektestadia A) lymfeknoop, B) milt, C) bloed en D) ruggenmerg. het mRNA expressieniveaus werden genormaliseerd tot peptidyl propyl isomerase A (PPIA) en werden berekend met de mRNA-niveau van onbehandelde muizen van dezelfde leeftijd. Metingen werden uitgevoerd in drievoud. Het aantal muizen per groep 2 - 3. De resultaten worden weergegeven als het gemiddelde ± standard fouten (SEM). Klik hier om een grotere versie van deze figuur te bekijken.

Gen vooruit omgekeerde fragement grootte (BP)
IL-1β CTGGTGTGTGACGTTCCCATTA CCGACAGCACGAGGCTTT 76
IL-6 TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTTC 76
IL-23 GAGCAGCAACTCTGACTGAGCC GAACAGCACAAGTCCTAATGGGTTA 127
IFNy CACGGCACAGTCATTGAAAGC CACCATCCTTTTGCCAGTTCC 118
TNFa TGACAAGCCTGTAGCCCACG GCCTTGTCCCTTGAAGAGAACC 178
PPIA GCTGGACCAAACACAAACGG GCCATTCCTGGACCCAAAAC 144

Tabel 1: Primer paren.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

EAE model beschreven heeft de meeste aandacht gekregen als een model van MS en wordt routinematig gebruikt in het testen van therapeutische strategieën voor MS 32. De muis ziekte vertoont vele klinische en histologische kenmerken van MS en wordt veroorzaakt door de inductie van autoimmuniteit neuronale antigenen. Sensibilisatie tegen myeline antigenen geassocieerd met bloed hersenbarrière disfunctioneren en daardoor immune cel infiltratie in het CNS. Onze resultaten tonen aan dat immuuncellen verhogen tijdelijk in de lymfeklieren in de acute fase. Milt T-cellen en B-cellen afnemen in de preklinische fase van de ziekte. In circulerend bloed, T-cellen, B-cellen, dendritische cellen en monocyten te verhogen voorbijgaand in de preklinische fase, terwijl neutrofielen te verhogen ziekte-afhankelijk. Tenslotte, in het ruggenmerg, een toename van immuuncellen detecteerbaar (Figuur 2). Deze gegevens geven aan dat T-cellen en B-cellen migreren van de milt, die fungeerteen reservoir voor deze cellen, de lymfeknopen waar ze worden geactiveerd en prolifereren. Vervolgens trekken ze via de circulatie in het ruggenmerg. Neutrofielen, monocyten en dendritische cellen, anderzijds, migreren van het beenmerg door de circulatie in het centraal zenuwstelsel.

Onze gegevens geven aan dat in het ruggenmerg, IFNy, TNFa en IL-1β worden gereguleerd bij een ziekte-afhankelijke manier, terwijl IL-6 tijdelijk opgereguleerd bij het begin van de ziekte. Deze gegevens ondersteunen de hypothese dat EAE pathologie wordt aangedreven door Th1 en Th17 cellen. Th1 cellen geven IFNy, die op zijn beurt activeert macrofagen TNFa en IL-1β 33 vrijgeven. Bovendien is IL-6 bekend om differentiatie van Th1 en Th17 cellen drijven en daardoor de ontwikkeling van EAE 34 bevorderen.

De dag van begin van de klinische symptomen en de ernst van de ziekte in EAE muizen variabele. Op basis van onze ervaring, zijn er verschillende rEasons hiervoor. Muizen blootgesteld aan stress tijdens de preklinische fase vertonen een verminderde ernst van de ziekte en een vertraging van begin van de ziekte. De behuizing van de muizen beïnvloedt ook de ernst van EAE alsook de dag van aanvang. Onlangs werd aangetoond dat de commensale microbiota van muizen invloed op de ontwikkeling van EAE 35 en verschillende huisvestingssituaties kan microbiome en daardoor de EAE pathologie beïnvloeden. Verder is het belangrijk altijd vers bereid pertussis toxine gebruikt. Pertussis toxine beschadigt de bloedhersenbarrière hetgeen een vereiste voor de ontwikkeling van EAE. Gebruik geen geëmulgeerd MOG 35-55 peptide na de vervaldatum. De leeftijd van de muizen ook invloed EAE pathologie. Er zijn dus een aantal regels die om een ​​reproduceerbaar EAE model gegenereerd moet worden voldaan. Gebruik muizen tussen 10 en 13 weken en muizen van dezelfde leverancier, indien mogelijk verouderd. Wanneer de muizen besteld bij een externe leverancier, zodat de muizen acclimatiseren tweeweken in de stal. Behandel de muizen voorzichtig voordat EAE-inductie, zodat ze wennen aan de behandeling. Vermijd onnodige handelingen na EAE inductie. Zorg voor de muizen met voedsel en water, die ze gemakkelijk zodra ze tonen klinische symptomen kunnen bereiken. Wanneer de muizen worden behandeld met een geneesmiddel, is het het beste om het te mengen in het voedsel of drinkwater, om te voorkomen verstorende effecten van stress. Wanneer een sonde of een injectie is essentieel voor geneesmiddeltoediening, is het belangrijk om de dezelfde route voor het voertuig.

Naast de primaire progressieve EAE model beschreven, relapsing remitting EAE modellen bestaan ​​ook. De verschillende beloop wordt veroorzaakt door de toediening van verschillende antigenen in verschillende muizenstammen. Zo is de toepassing van MOG 35-55 in muizenstammen, zoals C57BL / 6, Sv129, B10, NOD en Biozzi muizen leidt tot een primaire progressieve ziekte vormen. Interessant is dat de dag van aanvang verschilt in de verschillende muizenstammen. TerwijlC57BL / 6, SV129 en B10 muizen ontwikkelen eerste klinische symptomen van ongeveer dag 11 tot 12, Biozzi muizen vertonen eerste klinische symptomen na 21 dagen 36. In een eerdere studie werd aangetoond dat 129S4 / SvJae x C57BL / 6 hybriden eerste klinische symptomen vertonen van ongeveer 11 dagen 28. De injectie van proteolipide proteïne (PLP) 131-151 leidt in SJL muizen om de inductie van een relapsing-remitting ziektebeloop 37. De beste EAE model te gebruiken zal afhangen van de focus van het onderzoek. Dus als de terugval fase plaats, de terugval-remitting model wordt toegepast terwijl als begin van de ziekte is de nadruk dient geleidelijk model worden gebruikt. Als de rol van een specifiek eiwit te onderzoeken in het EAE-model, met behulp knock-out muizen, is het belangrijk te bedenken dat niet alle stammen kunnen worden gebruikt om EAE en eventueel terugkruisen van de knock-out stam induceren op een gevoelige stam is noodzakelijk.

De drie meest gebruikte types van dierlijke modellen van MS zijn (1) auto-antigeen geïnduceerde EAE; (2) viraal geïnduceerde spontane chronische demyeliniserende ziekten, en (3) toxine-geïnduceerde demyelinisatie 38. EAE modellen worden gekenmerkt door de inductie van ontsteking en auto-immuunresponsen door toepassing van een autoantigenic peptide zoals myeline-oligodendrocyt-eiwit of proteolipide eiwit 38. EAE spontaan ontwikkelt in transgene muizen die een T cel receptor tot overexpressie tegen een peptide van myeline oligodendrocyt-eiwit 39. Om viraal geïnduceerde chronische ontsteking induceren, kan een neurotrope infectie van het centraal zenuwstelsel worden veroorzaakt, bijvoorbeeld met Theiler`s murine encephalomyelitis virus. Cellen geïnfecteerd met het virus worden aangevallen door zowel T-cellen en humorale reactie en leiden daardoor tot chronische demyelinisatie 40,41. -Toxine geïnduceerde demyelinisatie kan worden geïnduceerd bijvoorbeeld met koper chelator cuprizone 42. Dit model leidt specifiek tot demyelinatie omdat cuprizone valt de oligodendrocyten en leidt daardoor tot activatie van astroglia en microglia, terwijl ontstekingsprocessen slechts een ondergeschikte rol spelen. Na goedkeuring van de toxine, worden nieuwe oligodendrocyten gegenereerd en een nieuwe myelineschede wordt gevormd. Het gebruik van deze drie modellen, op een complementaire manier, maakt de evaluatie van effecten van geneesmiddelen op de verschillende aspecten van de pathogenese van MS, omdat de modellen verschillen met betrekking tot de ontstekings- en immuun- en demyeliniserende processen. In EAE en de virus-geïnduceerde model, ontstekingen en auto-immune processen in de eerste plaats te rijden van de ziekte, terwijl in de toxine geïnduceerde model, demyeliniserende en remyelinisatie-processen overheersen. Preklinische testen van potentiële geneesmiddelen voor de behandeling van MS, tenminste drie modellen, een toxine geïnduceerde model, een terugval remitting EAE en een primair progressieve EAE of een viraal-geïnduceerde model worden gebruikt om de effectiviteit van het geneesmiddel te controleren.

De EAE model beschreef haare kan worden gebruikt om verder inzicht te krijgen in het mechanisme van de ontwikkeling van het ziekteproces MS-achtige, de voornaamste cellulaire determinanten van de ziekte, zoals Th1, Th17 en B-cellen 43,44. Hoe beter het begrip van de ontstekings- en immunologische processen voor de ontwikkeling van MS en de processen die bevorderen en het oplossen van de laesies, hoe waarschijnlijker het is dat nieuwe behandelingsstrategieën kunnen worden ontwikkeld.

Toch is de EAE model hier beschreven heeft alleen maar een aantal kenmerken gemeen met MS, en is voorzien van een paar duidelijke verschillen ten opzichte van de ziekte bij de mens. Het voornaamste verschil is dat MS-patiënten variëren sterk ziekte presentatie, die niet is opgenomen in het EAE model. Dit kan te wijten zijn aan verschillende laesiepatronen in MS en EAE muizen en het feit dat muizen zijn inteelt stammen. In EAE muizen, homogene letsels zijn het meest prominent in het ruggenmerg, terwijl bij MS-patiënten, voornamelijk heterogene laesiesgevonden in de hersenen 45,46. Bovendien, MS en EAE delen van de belangrijke bijdrage van Th1-cellen en Th17 cellen voor hun ontwikkeling, maar in tegenstelling tot MS, CD8 + T-cellen spelen een ondergeschikte rol in EAE pathologie 33. Kortom, de EAE model richt zich vooral op de gecombineerde effecten van auto-immuniteit, ontstekingen en neurodegeneratie terwijl demyeliniserende processen zijn minder vatbaar voor selectieve beoordeling. Derhalve kunnen andere diermodellen zoals cuprizone model worden gebruikt voor de afzonderlijke studie van demyeliniserende 47 verwerkt. De EAE model is onvolmaakt, maar toch, een bruikbaar model van MS-33.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
ABI Prism 7500 Sequence Detection System  Applied Biosystems, Austin, USA quantitative PCR system
Accutase Sigma Aldrich Munich, Germany A6964 cell detachment solution
CD3-PE-CF594 BD, Heidelberg, Germany 562286
CD4-V500 BD, Heidelberg, Germany 560782
CD8-eFluor650 eBioscience, Frankfurt, Germany 95-0081-42
CD11b-eFluor605 eBioscience, Frankfurt, Germany 93-0112-42
CD11c-AlexaFluor700 BD, Heidelberg, Germany 560583
CD19-APC-H7  BD, Heidelberg, Germany 560143
CD45-Vioblue  Miltenyi Biotec, Bergisch Gladbach, Germany 130-092-910
CompBeads BD, Heidelberg, Germany 552843 compensation beads
Collagenase A Sigma Aldrich Munich, Germany C0130
Cytometric absolute count standard  Polyscience, Eppelheim, Germany BLI-580-10
Cytometer Setup and Tracking beads  BD, Heidelberg, Germany 642412
DNase I Sigma Aldrich Munich, Germany D5025
EAE Kit Hooke Laboratories, Lawrence, USA EK2110
F4/80-PE-Cy7  BioLegend, Fell, Germany 123114
First Strand cDNA-Synthesis kit  Thermo Scientific, Schwerte, Germany K1612
Fc receptor-1 blocking buffer  Miltenyi Biotec, Bergisch Gladbach, Germany 130-092-575
Flow cytometric absolute count standard Polyscience, Eppelheim, Germany 580
FlowJo software v10  Treestar, Ashland, USA flow cytometry software
LSRII/Fortessa  BD, Heidelberg, Germany flow cytometer
Ly6G-APC-Cy7  BD, Heidelberg, Germany 560600
Lysing solution  BD, Heidelberg, Germany 349202
Maxima SYBR Green  Thermo Scientific, Schwerte, Germany K0221 fluorescent DNA binding dye 
RNeasy Mini Kit  Qiagen, Hilden, Germany 74104 RNA extraction kit

DOWNLOAD MATERIALS LIST

References

  1. McFarland, H. F., Martin, R. Multiple sclerosis: a complicated picture of autoimmunity. Nat Immunol. 8, 913-919 (2007).
  2. Proudfoot, A. E. Chemokine receptors: multifaceted therapeutic targets. Nat Rev Immunol. 2, 106-115 (2002).
  3. Mihara, M., Hashizume, M., Yoshida, H., Suzuki, M., Shiina, M. IL-6/IL-6 receptor system and its role in physiological and pathological conditions. Clin Sci (Lond). 122, 143-159 (2012).
  4. Strydom, N., Rankin, S. M. Regulation of circulating neutrophil numbers under homeostasis and in disease. J Innate Immun. 5, 304-314 (2013).
  5. Kerstetter, A. E., Padovani-Claudio, D. A., Bai, L., Miller, R. H. Inhibition of CXCR2 signaling promotes recovery in models of multiple sclerosis. Exp Neurol. 220, 44-56 (2009).
  6. Kolaczkowska, E., Kubes, P. Neutrophil recruitment and function in health and inflammation. Nat Rev Immunol. 13, 159-175 (2013).
  7. Fan, X., et al. Murine CXCR1 is a functional receptor for GCP-2/CXCL6 and interleukin-8/CXCL8. J Biol Chem. 282, 11658-11666 (2007).
  8. Hartl, D., et al. Infiltrated neutrophils acquire novel chemokine receptor expression and chemokine responsiveness in chronic inflammatory lung diseases. J Immunol. 181, 8053-8067 (2008).
  9. Barcelos, L. S., et al. Role of the chemokines CCL3/MIP-1 alpha and CCL5/RANTES in sponge-induced inflammatory angiogenesis in mice. Microvasc Res. 78, 148-154 (2009).
  10. Wojkowska, D. W., Szpakowski, P., Ksiazek-Winiarek, D., Leszczynski, M., Glabinski, A. Interactions between neutrophils, Th17 cells, and chemokines during the initiation of experimental model of multiple sclerosis. Mediators Inflamm. 590409 (2014).
  11. Bose, S., Cho, J. Role of chemokine CCL2 and its receptor CCR2 in neurodegenerative diseases. Arch Pharm Res. 36, 1039-1050 (2013).
  12. Mony, J. T., Khorooshi, R., Owens, T. Chemokine receptor expression by inflammatory T cells in EAE. Front Cell Neurosci. 8, 187 (2014).
  13. Katschke, K. J. Jr, et al. Differential expression of chemokine receptors on peripheral blood, synovial fluid, and synovial tissue monocytes/macrophages in rheumatoid arthritis. Arthritis Rheum. 44, 1022-1032 (2001).
  14. Trebst, C., et al. CCR1+/CCR5+ mononuclear phagocytes accumulate in the central nervous system of patients with multiple sclerosis. Am J Pathol. 159, 1701-1710 (2001).
  15. Karin, N., Wildbaum, G. The role of chemokines in adjusting the balance between CD4+ effector T cell subsets and FOXp3-negative regulatory T cells. Int Immunopharmacol. (2015).
  16. Rottman, J. B., et al. Leukocyte recruitment during onset of experimental allergic encephalomyelitis is CCR1 dependent. Eur J Immunol. 30, 2372-2377 (2000).
  17. Izikson, L., Klein, R. S., Charo, I. F., Weiner, H. L., Luster, A. D. Resistance to experimental autoimmune encephalomyelitis in mice lacking the CC chemokine receptor (CCR)2. J Exp Med. 192, 1075-1080 (2000).
  18. Kuwabara, T., et al. CCR7 ligands are required for development of experimental autoimmune encephalomyelitis through generating IL-23-dependent Th17 cells. J Immunol. 183, 2513-2521 (2009).
  19. Liu, L., et al. Myelin repair is accelerated by inactivating CXCR2 on nonhematopoietic cells. J Neurosci. 30, 9074-9083 (2010).
  20. Matsui, M., et al. Treatment of experimental autoimmune encephalomyelitis with the chemokine receptor antagonist Met-RANTES. J Neuroimmunol. 128, 16-22 (2002).
  21. Liu, L., et al. Severe disease, unaltered leukocyte migration, and reduced IFN-gamma production in CXCR3-/- mice with experimental autoimmune encephalomyelitis. J Immunol. 176, 4399-4409 (2006).
  22. Lee, M., Suk, K., Kang, Y., McGeer, E., McGeer, P. L. Neurotoxic factors released by stimulated human monocytes and THP-1 cells. Brain Res. 1400, 99-111 (2011).
  23. Gage, G. J., Kipke, D. R., Shain, W. Whole animal perfusion fixation for rodents. J Vis Exp. (2012).
  24. O'Connor, R. A., et al. Adjuvant immunotherapy of experimental autoimmune encephalomyelitis: immature myeloid cells expressing CXCL10 and CXCL16 attract CXCR3+CXCR6+ and myelin-specific T cells to the draining lymph nodes rather than the central nervous system. J Immunol. 188, 2093-2101 (2012).
  25. Olesch, C., et al. MPGES-1-derived PGE2 suppresses CD80 expression on tumor-associated phagocytes to inhibit anti-tumor immune responses in breast cancer. Oncotarget. 6, 10284-10296 (2015).
  26. Chomczynski, P., Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 162, 156-159 (1987).
  27. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, 402-408 (2001).
  28. Barthelmes, J., et al. Lack of ceramide synthase 2 suppresses the development of experimental autoimmune encephalomyelitis by impairing the migratory capacity of neutrophils. Brain Behav Immun. 46, 280-292 (2015).
  29. Schiffmann, S., et al. Ceramide synthase 6 plays a critical role in the development of experimental autoimmune encephalomyelitis. J Immunol. 188, 5723-5733 (2012).
  30. Schiffmann, S., et al. PGE2/EP4 signaling in peripheral immune cells promotes development of experimental autoimmune encephalomyelitis. Biochem Pharmacol. 87, 625-635 (2014).
  31. Giglio, S., Monis, P. T., Saint, C. P. Demonstration of preferential binding of SYBR Green I to specific DNA fragments in real-time multiplex PCR. Nucleic Acids Res. 31, e136 (2003).
  32. Vesterinen, H. M., et al. Improving the translational hit of experimental treatments in multiple sclerosis. Mult Scler. 16, 1044-1055 (2010).
  33. 't Hart, B. A., Gran, B., Weissert, R. EAE: imperfect but useful models of multiple sclerosis. Trends Mol Med. 17, 119-125 (2011).
  34. Serada, S., et al. IL-6 blockade inhibits the induction of myelin antigen-specific Th17 cells and Th1 cells in experimental autoimmune encephalomyelitis. Proc Natl Acad Sci U S A. 105, 9041-9046 (2008).
  35. Berer, K., et al. Commensal microbiota and myelin autoantigen cooperate to trigger autoimmune demyelination. Nature. 479, 538-541 (2011).
  36. Shetty, A., et al. Immunodominant T-cell epitopes of MOG reside in its transmembrane and cytoplasmic domains in EAE. Neurol Neuroimmunol Neuroinflamm. 1, 22-22 (2014).
  37. Schmitz, K., et al. R-flurbiprofen attenuates experimental autoimmune encephalomyelitis in mice. EMBO Mol Med. 6, 1398-1422 (2014).
  38. Procaccini, C., De Rosa, V., Pucino, V., Formisano, L., Matarese, G. Animal models of Multiple Sclerosis. Eur J Pharmacol. 759, 182-191 (2015).
  39. Pollinger, B., et al. Spontaneous relapsing-remitting EAE in the SJL/J mouse: MOG-reactive transgenic T cells recruit endogenous MOG-specific B cells. J Exp Med. 206, 1303-1316 (2009).
  40. Rodriguez, M., Oleszak, E., Leibowitz, J. Theiler's murine encephalomyelitis: a model of demyelination and persistence of virus. Crit Rev Immunol. 7, 325-365 (1987).
  41. Lipton, H. L. Theiler's virus infection in mice: an unusual biphasic disease process leading to demyelination. Infect Immun. 11, 1147-1155 (1975).
  42. Matsushima, G. K., Morell, P. The neurotoxicant, cuprizone, as a model to study demyelination and remyelination in the central nervous system. Brain Pathol. 11, 107-116 (2001).
  43. El-behi, M., Rostami, A., Ciric, B. Current views on the roles of Th1 and Th17 cells in experimental autoimmune encephalomyelitis. J Neuroimmune Pharmacol. 5, 189-197 (2010).
  44. Mann, M. K., Ray, A., Basu, S., Karp, C. L., Dittel, B. N. Pathogenic and regulatory roles for B cells in experimental autoimmune encephalomyelitis. Autoimmunity. 45, 388-399 (2012).
  45. Lassmann, H., Bruck, W., Lucchinetti, C. F. The immunopathology of multiple sclerosis: an overview. Brain Pathol. 17, 210-218 (2007).
  46. Simmons, S. B., Pierson, E. R., Lee, S. Y., Goverman, J. M. Modeling the heterogeneity of multiple sclerosis in animals. Trends Immunol. 34, 410-422 (2013).
  47. Praet, J., Guglielmetti, C., Berneman, Z., Vander Linden, A., Ponsaerts, P. Cellular and molecular neuropathology of the cuprizone mouse model: clinical relevance for multiple sclerosis. Neurosci Biobehav Rev. 47, 485-505 (2014).
Inductie van experimentele auto-immune Encefalomyelitis in Muizen en evaluatie van de ziekte-afhankelijke Verdeling van immuuncellen in verschillende weefsels
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Barthelmes, J., Tafferner, N., Kurz, J., de Bruin, N., Parnham, M. J., Geisslinger, G., Schiffmann, S. Induction of Experimental Autoimmune Encephalomyelitis in Mice and Evaluation of the Disease-dependent Distribution of Immune Cells in Various Tissues. J. Vis. Exp. (111), e53933, doi:10.3791/53933 (2016).More

Barthelmes, J., Tafferner, N., Kurz, J., de Bruin, N., Parnham, M. J., Geisslinger, G., Schiffmann, S. Induction of Experimental Autoimmune Encephalomyelitis in Mice and Evaluation of the Disease-dependent Distribution of Immune Cells in Various Tissues. J. Vis. Exp. (111), e53933, doi:10.3791/53933 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter