Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs

Summary

Toeprinting aims to measure the ability of in vitro transcribed RNA to form translation initiation complexes with ribosomes under a variety of conditions. This protocol describes a method for toeprinting mammalian RNA and can be used to study both cap-dependent and IRES-driven translation.

Abstract

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation of protein synthesis is the key to cellular stress-response, and dysregulation is central to many disease states, such as cancer. For instance, although cellular stress leads to the inhibition of global translation by attenuating cap-dependent initiation, certain stress-response proteins are selectively translated in a cap-independent manner. Discreet RNA regulatory elements, such as cellular internal ribosome entry sites (IRESes), allow for the translation of these specific mRNAs. Identification of such mRNAs, and the characterization of their regulatory mechanisms, have been a key area in molecular biology. Toeprinting is a method for the study of RNA structure and function as it pertains to translation initiation. The goal of toeprinting is to assess the ability of in vitro transcribed RNA to form stable complexes with ribosomes under a variety of conditions, in order to determine which sequences, structural elements, or accessory factors are involved in ribosome binding—a pre-cursor for efficient translation initiation. Alongside other techniques, such as western analysis and polysome profiling, toeprinting allows for a robust characterization of mechanisms for the regulation of translation initiation.

Introduction

As translation consumes most cellular energy, it makes sense that translation is tightly regulated¹. Conversely, dysregulation of translation-and the consequent alterations in protein output-is often observed in stress-response and disease states, such as cancer^1,2. A major advantage of translational control is the speed with which cells can alter their protein output in order to respond to various stimuli³. Translation regulation thus represents an important mechanism that can influence cell survival and death^1,2,3. Of the steps of translation, initiation is the most highly regulated and complex³. Briefly, most eukaryotic mRNAs contain a 5' m⁷G cap that is almost always essential for their translation. Cap-dependent initiation requires eukaryotic initiation factors eIF4E, eIF4A, and eIF4G (the cap-recognition complex) to interact with the 5' end of the mRNA. The 43S preinitiation ribosome complex, which contains eIF2-bound initiator tRNA and eIF3, is recruited to the 5' end of the mRNA via an interaction of eIF4G with eIF3. The preinitiation complex is thought to scan mRNA, aided by eIF4A (an RNA helicase) until the start codon (AUG) is located. The 48S initiation complex is subsequently formed and tRNA is delivered into the P-site of the ribosome. Finally, the 60S and 40S ribosome subunits are united to form the 80S initiation complex, followed by translation elongation^1,3,4. In contrast, internal ribosome entry sites (IRESes) bypass the requirement for a 5' cap by recruiting the 40S ribosomal subunit directly to the initiation codon³. Physiological stress conditions attenuate global mRNA translation due to modifications of key general eukaryotic initiation factors (eIFs). However, non-canonical translation initiation mechanisms allow for selective translation of certain mRNAs which often encode stress-response proteins, and dysregulation of non-canonical translation initiation is implicated in disease states like cancer^1,2. Discreet RNA regulatory elements, such as cellular IRESes, allow for the translation of such mRNAs^2,3.

One particularly interesting aspect of translational control is to understand mechanisms of canonical versus non-canonical translation of a given mRNA. Toeprinting is a technique that allows the detailed mechanistic study of translation initiation of specific RNAs in vitro. The overall goal of toeprinting is to assess the ability of an RNA of interest to nucleate the formation of a translation initiation complex with the ribosome under a variety of conditions, in order to determine which sequences, structural elements, or accessory factors are required for efficient translation initiation. For instance, ribosome recruitment might be hindered in the absence of a 5' cap but stimulated by the presence of an IRES.

The principle of the technique is to in vitro transcribe an RNA of interest, incubate it in the presence of cellular extracts containing translation components (or the purified components) to allow initiation complexes to form, and to reverse transcribe the RNA with a specific primer. Stable RNA-ribosome complexes will cause reverse transcription to stall at the 3' edge of the ribosome-the so-called 'toeprint'^5,6,7.

In this protocol, the ribosomal subunits, eIFs, tRNAs, and IRES trans-acting factors (ITAFs) are conveniently contributed by rabbit reticulocyte lysate (RRL). Another advantage of this protocol is the use of a fluorescently-labeled primer and fluorescence gel-based imager, rather than a radiolabeled primer. This eliminates extra steps, including radiolabeling the primer, as well as drying the gel and exposing it to an intensifying screen. The fluorescent bands are recorded in real time, as the gel runs, allowing for greater resolution. Uncapped X-linked inhibitor of apoptosis protein (XIAP) IRES RNA is used as an example here, although capped mRNAs can also be analyzed by this technique⁸.

Unlike western analysis, which measures the final output of the translation process in cell lysates, toeprinting is an in vitro approach to measure translation initiation complex formation on an RNA. This reductionist approach allows for the highly detailed study of substrates or factors that regulate translation initiation (e.g., capped or un-capped mRNA, IRES structure, presence or absence of poly-A tail, provision of specific protein factors, etc.). Hence, toeprinting can be used to study different modes of translation⁸ or the effects of mRNA structures, such as IRESes, on protein synthesis^9,10.

Protocol

NOTE: RNA is highly susceptible to degradation by ribonucleases (RNases). Take standard precautions to keep the RNA intact. Change gloves frequently. Use filtered pipette tips, nuclease-free plasticware, and nuclease-free chemicals in all steps of the protocol. Use nuclease-free or diethyl pyrocarbonate (DEPC)-treated water for all solutions.

1. Preparation of Solutions

1. Prepare Toeprinting buffer: 20 mM Tris-HCl (pH 7.6), 100 mM KOAc, 2.5 mM Mg(OAc)₂, 5% (w/v) sucrose, 2 mM dithiothreitol (DTT), and 0.5 mM spermidine.
   1. Store DTT and spermidine in single-use aliquots at -20 °C to avoid repeated freeze-thaw cycles.
      NOTE: DTT and spermidine should be added to the toeprinting buffer immediately before use. A solution lacking DTT and spermidine can be stored at -20 °C.
2. Prepare aliquots of 85 mM 5'-guanylyl imidodiphosphate (GMP-PNP) and 91 mM adenosine triphosphate (ATP). Store the aliquots at -20 °C.
3. Prepare 450 mL of 6% polyacrylamide-7M urea gel mix: 67.5 mL of 40% acrylamide:bis-acrylamide (19:1), 189 g of urea, 112.5 mL of 5x TBE (Tris/borate/thylenediaminetetraacetic acid (EDTA)), and 120 mL of water. Dissolve the urea by warming in a 37 °C water bath or on a hot plate with stirring. Filter the solution (e.g., 0.2 μm nitrocellulose vacuum filter).
   NOTE: The solution can be stored at 4 °C for at least one month.
   Caution: Monomeric acrylamide is a neurotoxin which can be absorbed through the skin. Take great care to avoid skin contact (i.e., wear gloves, a lab coat, and eye protection). Polyacrylamide should also be handled with care, as polymerization may not proceed to 100% completion.
4. Prepare formamide loading dye: 95% formamide, 18 mM EDTA, 0.025% (w/v) sodium dodecyl sulfate (SDS), 0.025% (w/v) bromophenol blue, 0.025% (w/v) xylene cyanol. Store at -20 °C.
5. Dissolve 1 nmol of primer (5' CTCGATATGTGCATCTGTA; 5' end-labeled with IRDye 800) into 100 μL of water for a working concentration of 10 pmol/μL. Store at -20 °C in single-use aliquots (approximately 10 µL), protected from light.

2. Preparation of mRNA

1. Amplify DNA templates for the synthesis of mRNA by polymerase chain reaction (PCR) from appropriate templates (i.e., genomic DNA or plasmid DNA, as appropriate). Use a high-fidelity DNA polymerase according to the manufacturer's instructions, with the following reaction conditions (35 cycles): melt, 98 °C, 10 s; anneal, 53 °C, 20 s; extend, 72 °C, 30 s.
   NOTE: The forward primer (5' AAGCTTAATACGACTCACTATAG) incorporates the T7 promoter sequence to allow for RNA transcription; the reverse primer (5' T₅₁GAATTCGGATCCGACCGTGG) includes 51 thymine residues to provide a poly-A tail for the transcribed RNA. Note that RNA can also be in vitro transcribed from plasmid DNA.
2. Use an appropriate transcription kit to in vitro transcribe IRES-containing RNA or capped RNA from the DNA template. Follow the manufacturer's instructions. Prepare the RNA sample in standard 20 μL reaction volumes. Treat the newly-synthesized RNA with 2 units of RNase-free DNase for 30 min at 37 °C.
3. Dilute the DNase-treated RNA to 110 µL with nuclease-free water add 110 µL acid phenol, vortex 5 s and centrifuge for 3 min at 20,000 x g at room temperature. Remove 100 µL of the aqueous phase to a new 1.5 mL microfuge tube, add 10 µL of 3 M sodium acetate, and vortex 2 s. Add, 3 volumes of 100% ethanol, vortex 5 s, and precipitate the RNA at -20 °C overnight.
4. Centrifuge at >20,000 x g for 30 min at 4 °C and discard the supernatant. Wash the pellet with 500 µL of ice-cold 70% (v/v) ethanol and repeat the centrifugation. Aspirate as much of the supernatant as possible and air-dry the pellet for 5 - 10 min. Be careful not to dislodge the pellet.
5. Resuspend the RNA in the appropriate volume of nuclease-free water to yield a working concentration of 0.5 μg/μL. This can be stored at -80 °C or used immediately.

3. Toeprinting Reaction

1. Mix 15 μL of Rabbit Reticulocyte Lysate (RRL, not nuclease-treated), 1 μL (40 units) of RNase Inhibitor, 1 µL of 91 mM ATP (1.82 mM final) and 1 μL of 85 mM GMP-PNP (1.7 mM final) in a 1.5 mL microfuge tube. Incubate at 30 °C for 5 min.
   NOTE: The RRL should be aliquoted for single use to avoid repetitive freeze-thawing. A critical control is a reaction lacking RRL, in order to elucidate the natural pauses of reverse transcription due to the secondary structure of the RNA. Add toeprinting buffer to replace RRL for this control. 
2. Add 0.5 µg (1 µL) of RNA and incubate at 30 °C for 5 min.
3. Add 22 µL of Toeprinting buffer and incubate at 30 °C for 3 min.
4. Add 0.5 µL (5 pmol) of IRDye-labeled primer and incubate on ice for 10 min.
5. Add 2 µL of 25 mM dNTPs (final concentration: 1 mM each), 2 µL of 100 mM Mg(OAc)₂, 1 µL of Avian Myeloblastosis Virus Reverse Transcriptase (AMV-RT) and 3.5 µL of Toeprinting buffer. The final volume is 50 μL.
6. Incubate the reaction at 30 °C for 45 min.
7. Add 200 µL of nuclease-free water and immediately extract with 250 µL of 25:24:1 phenol:chloroform:isoamyl alcohol (pH approximately 8.0). Vortex 5 s and centrifuge at 20,000 x g for 3 min at room temperature. Remove the aqueous phase to a new 1.5 mL microfuge tube, add 3 volumes of 100% ethanol, vortex 5 s, and precipitate at -20 °C overnight.
8. Centrifuge at >20,000 x g for 30 min at 4 °C and discard the supernatant. Wash the DNA pellet with 500 µL of ice-cold 70% (v/v) ethanol. Centrifuge at >20,000 x g for 15 min at 4 °C. Aspirate as much supernatant as possible and air dry the pellet for 5 - 10 min. Be careful not to dislodge the pellet.
9. Dissolve the pellet in 6 μL of nuclease-free water and add 3 μL of formamide loading dye.

4. Sequencing Reactions

1. Use the DNA template from 2.1 and the IRDye-labeled primer from step 3.4 for standard sequencing reactions, using dideoxynucleotides (ddNTPs) as chain terminators. Use an appropriate DNA sequencing kit and follow the manufacturer's instructions.
2. Mix 6 μL of each sequencing reaction with 3 μL of formamide loading dye.

5. Preparation of Sequencing Gel and Electrophoresis

NOTE: This protocol uses a fluorescence gel-based imager and a 21 cm x 23 cm x 0.2 mm gel, but can be adapted for other sequencers or gel-sizes, if required.

1. Thoroughly clean the 0.2 mm spacers as well as the short (23 × 25 cm) and long (30 × 25 cm) glass plates with 100% ethanol. Air dry.
2. Mix 30 mL of 6% polyacrylamide-7M urea gel mix with 200 μL of 10% (w/v) ammonium persulfate (APS) and 20 μL of tetramethylethylenediamine (TEMED). Pour the gel, taking care to avoid bubbles, and insert the 'shark-tooth' gel comb. Allow the gel to polymerize for 1 h at room temperature.
3. Assemble the sequencing apparatus and fill the reservoirs with 1x TBE.
4. Pre-run for 15 min at 1500 V until the optimal temperature of 55 °C is achieved.
5. Heat the sample/loading dye mix (from steps 3.9 or 4.2) to 85 °C for 5 min. Load 1 μL onto the sequencing gel.
6. Run the gel at 1500 V for 8 h. The machine will read the bands in real time.
7. Disassemble the apparatus, and dispose the acrylamide gel and running buffer.

Results

We have previously described the ability of the XIAP IRES to support cap-independent translation initiation in vitro^8,10. Toeprinting was the key technique to interrogate the mechanistic details of the XIAP IRES initiation complex. A DNA construct encoding an mRNA containing the XIAP IRES (Figure 1A) was in vitro transcribed and subjected to toeprinting analysis. The...

Discussion

Toeprinting is a powerful technique to directly measure the ability of an RNA of interest to support the formation of translation initiation complexes under highly controlled circumstances. This protocol describes a simplified technique for toeprinting mammalian RNAs. Rabbit reticulocyte lysate (RRL) is used as a convenient source of ribosomes, eIFs, initiator tRNA, and IRES trans-acting factors (ITAFs). The experimenter provides their RNA of choice, and can also supplement the toeprinting reaction with specific...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
DEPC (Diethyl pyrocarbonate)	Sigma	D5758-100ML
TRIS base, Ultrapure	JT Baker	4109-01
KOAc (Potassium acetate)	Bio Basic	PB0438
Mg(OAc)2 (Magnesium acetate tetrahydrate)	Bio Basic	MB0326
Sucrose, molecular biology grade	Calbiochem	573113-1KG
Spermidine	Sigma	85558
GMP-PNP (Guanosine 5′-[β,γ-imido]triphosphate trisodium salt hydrate) 0.1 M solution	Sigma	G0635
ATP (Adenosine 5′-triphosphate) disodium salt, 100 mM solution	Sigma	A6559
19:1 Acrylamide:bis-acrylamide, 40%	Bio Basic	A0006
Urea	Bio Basic	UB0148
500mL bottle top filtration units, 0.2 µm	Sarstedt	83.1823.101
Formamide	Sigma	F9037-100ML
EDTA (disodium salt, dihydrate)	Bio Basic	EB0185
SDS	Bio Basic	SB0485
Bromophenol blue	Bio Basic	BDB0001
Xylene cyanol FF	Bio Basic	XB0005
MEGAshortscript T7 transcription kit	Ambion	AM1354
mMESSAGE mMACHINE T7 transcription kit	Ambion	AM1344
Acid Phenol:Chloroform (5:1)	Ambion	AM9722
25:24:1 Phenol:Chloroform:Isoamyl Alcohol	Invitrogen	15593-049
Rabbit Reticulocyte Lysate (RRL). Should NOT be nuclease-treated.	Green Hectares, USA		Contact Green Hectares, ask for 1:1 RRL:water
RiboLock RNase Inhibitor (40 U/µL)	Thermo Fisher	E00382
100 mM dNTPs	Invitrogen	56172, 56173, 56174, 56175	Mix equal parts for a stock of 25 mM each.
AMV-RT, 10 U/µL	Promega	M5101
Sequenase Version 2.0 DNA Sequencing Kit	Thermo Fisher	707701KT
Model 4200 IR2 DNA analyzer	LI-COR		Product has been discontinued
APS (Ammonium Persulfate)	Bio Basic	AB0072
TEMED	Bio Basic	TB0508
Phusion High Fidelity Polymerase	New England Biolabs	M0530
Turbo Dnase	Thermo Fisher	AM2238