RESEARCH
Peer reviewed scientific video journal
Video encyclopedia of advanced research methods
Visualizing science through experiment videos
EDUCATION
Video textbooks for undergraduate courses
Visual demonstrations of key scientific experiments
BUSINESS
Video textbooks for business education
OTHERS
Interactive video based quizzes for formative assessments
Products
RESEARCH
JoVE Journal
Peer reviewed scientific video journal
JoVE Encyclopedia of Experiments
Video encyclopedia of advanced research methods
EDUCATION
JoVE Core
Video textbooks for undergraduates
JoVE Science Education
Visual demonstrations of key scientific experiments
JoVE Lab Manual
Videos of experiments for undergraduate lab courses
BUSINESS
JoVE Business
Video textbooks for business education
Solutions
Language
English
Menu
Menu
Menu
Menu
Research Article
Erratum Notice
Important: There has been an erratum issued for this article. View Erratum Notice
Retraction Notice
The article Assisted Selection of Biomarkers by Linear Discriminant Analysis Effect Size (LEfSe) in Microbiome Data (10.3791/61715) has been retracted by the journal upon the authors' request due to a conflict regarding the data and methodology. View Retraction Notice
Presented here is a protocol for efficient CRISPR/Cas9 ribonucleoprotein-mediated gene editing in mammalian cells using tube electroporation.
Gene editing nucleases, represented by CRISPR-associated protein 9 (Cas9), are becoming mainstream tools in biomedical research. Successful delivery of CRISPR/Cas9 elements into the target cells by transfection is a prerequisite for efficient gene editing. This protocol demonstrates that tube electroporation (TE) machine-mediated delivery of CRISPR/Cas9 ribonucleoprotein (RNP), along with single-stranded oligodeoxynucleotide (ssODN) donor templates to different types of mammalian cells, leads to robust precise gene editing events. First, TE was applied to deliver CRISPR/Cas9 RNP and ssODNs to induce disease-causing mutations in the interleukin 2 receptor subunit gamma (IL2RG) gene and sepiapterin reductase (SPR) gene in rabbit fibroblast cells. Precise mutation rates of 3.57%-20% were achieved as determined by bacterial TA cloning sequencing. The same strategy was then used in human iPSCs on several clinically relevant genes including epidermal growth factor receptor (EGFR), myosin binding protein C, cardiac (Mybpc3), and hemoglobin subunit beta (HBB). Consistently, highly precise mutation rates were achieved (11.65%-37.92%) as determined by deep sequencing (DeepSeq). The present work demonstrates that tube electroporation of CRISPR/Cas9 RNP represents an efficient transfection protocol for gene editing in mammalian cells.
CRISPR/Cas9 is the most commonly used programmable nuclease for gene editing. It works through single guide RNA (sgRNA)-mediated recognition of both target sequences and an adjacent protospacer adjacent motif (PAM) sequence in the genome. The Cas9 nuclease generates a double-stranded DNA break (DSB) located three nucleotides upstream of the PAM sequence1. The DSBs are repaired either through error-prone non-homologous end joining (NHEJ) or homology-directed repair (HDR) pathways. To achieve precise gene editing through the HDR pathway, donor templates are often provided in the format of plasmid DNA (pDNA) or single-stranded oligodeoxynucleotide (ssODN).
CRISPR/Cas9 and the sgRNA can be delivered to the cells in three formats: the ribonucleoprotein (RNP) complex of Cas9 protein and gRNA2,3; Cas9 mRNA and sgRNA4,5; or plasmid DNA (pDNA) that contains the necessary promoters, driven sgRNA, and Cas9 coding region6,7,8. Many groups have demonstrated that when CRISPR/Cas9 is delivered as RNP, the gene editing efficiency often outperforms those achieved in pDNA or mRNA formats, attributable to the much smaller size of RNP compared to the nucleic acids9. Furthermore, it has been previously shown that a novel tube electroporation (TE) machine is particularly effective in gene editing applications in several cell types9.
Presented in the present work is a step-by-step protocol in utilizing TE for the delivery of CRISPR/Cas9 RNP to mammalian cells of different species at several clinically relevant loci. This novel TE transfection technique and high HDR rate phenomenon may find broad applications in biomedical research.
All animal maintenance, care, and use procedures were reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Michigan.
1. Preparation of Cells
2. Design and Synthesis of gRNAs and Donor Oligos
3. Tube Electroporation of Cas9 RNP and ssODNs
4. Analysis of Gene Editing Events
TE of Cas9 RNP and ssODNs to rabbit fibroblast cells
The overall process of TE-mediated delivery of Cas9 RNP to mammalian cells is illustrated in Figure 1. First, C231Y and Q235X mutations were produced in the IL2RG gene, and the R150G mutation was produced in the SPR gene in rabbit fibroblast cells. Loss-of-function mutations in IL2RG and SPR genes are known to cause primary immunodeficiency11 and motor and cognitive deficits12, respectively.
The specific sgRNA designs are illustrated in Figure 2A. The primers used to amplify the targeted regions are listed in Table 3. Sequences of ssODNs are shown in Table 1. The gene editing rates were determined by bacterial TA cloning (Figure 2B). At the IL2RG C231 locus, out of the 28 clones that were sequenced, one (3.57%) carried the precise C231Y mutation, four (14.28%) carried insertion or deletion (indel) mutations, and the remaining 23 (82%) were wild-type. At the IL2RG Q235 locus, out of the 27 clones that were sequenced, two (7.41%) carried the precise Q235X mutation, three carried indel mutations (11.11%) and the remaining were wild-type. At the SPG R150 locus, of the 20 clones sequenced, five (25%) carried the precise R150G mutation, 10 (50%) carried indel mutations, and the remaining were wild-type.
TE of Cas9 RNP and ssODNs to human iPSCs
TE was then used to deliver Cas9 RNP and ssODNs to human iPSCs and target clinically relevant loci in EGFR, Mybpc3, and HBB genes. Point mutations in the EGFR T790 proximal region confer resistance to EGFR tyrosine kinase inhibitors in patients of non-small cell lung cancer (NSCLC) harboring activating mutations of EGFR13. A frameshift mutation in exon 16 in Mybpc3 is implicated in hypertrophic cardiomyopathy14. The E6V point mutation in the HBB gene leads to sickle cell disease15.
The specific sgRNA designs are illustrated in Figure 3A. The primers used to amplify the targeted regions are listed in Table 3. Sequences of ssODNs are shown in Table 1. The gene editing rates were determined by DeepSeq (Figure 3B). At the EGFR locus, 15.68% of alleles carried the precise point mutations (6,315 reads), 22.75% carried indel mutations (9,162 reads), and the remaining 61.57% were wild-type (24,797 reads). At the Mybpc3 locus, 37.92% carried the precise 4-bp TGAA deletion (11,654 reads), 2.24% carried indel mutations (410 reads) and the remaining 59.84% were wild-type (18,692 reads). At the HBB locus, 11.65% carried the precise E6V mutation (6,565 reads), 23.35% carried indel mutations (13,163 reads) and the remaining 65% were wild-type (36,644 reads).

Figure 1: Flow chart of tube electroporation of Cas9 RNP.

Figure 2: Gene editing of rabbit fibroblast cells. (A) Illustration of target sequences. Boxes indicate targeted loci. Underlined letters correspond to gRNA sequences. Red colored letters indicate PAM sequences. (B) TA cloning results of gene editing events. Boxes indicate precisely mutated loci. Indel sequence shown is only representative of one allele type. Other indel sequences are not shown. Please click here to view a larger version of this figure.

Figure 3: Gene editing of human iPSCs. (A) Illustration of target sequences. Boxes indicate targeted loci. Underlined letters correspond to gRNA sequence. Red colored letters indicate PAM sequences. (B) Deepseq results of gene editing events. Boxes indicate precisely mutated loci. Red colored letters indicate silent mutations that were introduced in the donor templates. Indel sequence shown is only representative of one allele type. Other indel sequences are not shown. Please click here to view a larger version of this figure.
| Locus | Oligo sequence |
| (targeted mutation) | |
| Rabbit IL2RG (C231Y) | AGCGTGGATGGGCAGAAACTCTACACGTTCCGAGTCCGGAGCCGTTTTAACCCTTTGTATGGGAGTGCTCAGCATTGGAGT GAATGGAGCCACCCGATCCACTGGGGGAGCAAAACTTCAAAGGGTAAAATGGGCCT |
| Rabbit IL2RG (Q235X) | AGCGTGGATGGGCAGAAACTCTACACGTTCCGAGTCCGGAGCCGTTTTAACCCTTTGTGTGGGAGTGCTTAGCATTGGAGT GAATGGAGCCACCCGATCCACTGGGGGAGCAAAACTTCAAAGGGTAAAATGGGCCT |
| Rabbit SPR | gacctccatgctctgcctgacctcctgcatcctgaaggcgtttcctgccagtcctggCctcagcgggactgtggtgaacatctcgtcgctgtgtgccctgcagcccttcaagggctggg cgctgtac |
| (R150G) | |
| Human EGFR | ACGTGATGGCCAGCGTGGACAACCCCCACGTGTGCCGCCTGCTGGGCATCTGCCTCACCTCTACAGTCCAACTGATTACCC AGCTCATGCCCTTCGGCTGCCTCCTGGACTATGTCCGGGAACACAAAGACAATATTGGCTCCCAGTAC |
| (Point mutations proximate to T790) | |
| Human Mybpc3 | GCCCCCTGTGCTCATCACGCGCCCCTTGGAGGACCAGCTGGTGATGGTGGGGCAGCGGGTGGAGTTTGCGAGGTATCGGA GGAGGGGGCGCAAGTCAAATGGTGAGTTCCAGAAGCACGGGGCATGGGTGTTGGGGGCAT |
| (4-bp deletion) | |
| Human HBB | TCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGTGGAGAAGTCTGCAGTTACTGCC CTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAG |
| (E6V) |
Table 1: Sequences of ssODNs.
| Step | Problem | Possible reasons | Solutions |
| 2.1 | Low indel rate | Poor guide RNA design, Guide RNA stocks >6 months, low guide RNA concentration | Redesign guide RNA, produce/order new guide RNA. |
| 2.3 | Low PGE efficiency | poor donor DNA design, low efficient guide RNA, incorrect amount of donor DNA or poor quality DNA | Increase homology arm length, introduce PAM mutation, introduce silent mutations to the donor DNA, use a more efficient guide RNA, Optimize the ratio of Cas9 protein over guide RNA. |
| 3.4 | Failed transfection | Air bubbles formed during transferring cells-buffer mixture to electroporation tube, incorrect voltage/duration setting | Try to avoid the formation of air bubbles, adjust the voltage/duration setting. |
| 3.6 | low cell viability after electroporation | Low survival of single human ipsc | Add ROCK inhibitor after electroporation, increase number of cells. |
| 4.1 | Failed PCR | High GC contents, or repetitive sequence | Optimize PCR condition, add DMSO to PCR system. |
Table 2: Troubleshooting guides for frequent problems.
| Primer name | sequence | note |
| Rb-IL2RG-F | CATGACAGTGACAGGGTCCC | For amplifying rabbit IL2RG DNA fragment |
| Rb-IL2RG-R | TGCCAGAGACACAAGCGAAC | |
| Rb-SPR-F | GTACTTTGGAGGGACAGAGG | For amplifying rabbit SPR DNA fragment |
| RB-SPR-R | CTCAGCACCCTGACACTGGG | |
| H-EGFR-F | TGATGGCCAGCGTGGACAAC | For amplifying human EGFR DNA fragment |
| H-EGFR-R | ACCAGTTGAGCAGGTACTGGG | |
| H-Mybpc3-F | ATGCCCCGTGCTTCTGGAAC | For amplifying human Mybpc3 DNA fragment |
| H-Mybpc3-R | TCAGGGGAGCCAACCCTCAT | |
| H-HBB-F | TAACCTTGATACCAACCTGC | For amplifying human HBB DNA fragment |
| H-HBB-R | CATTTGCTTCTGACACAACT |
Table 3: Primers used in step 4.3.
The tube electroporation method was effective in delivering CRISPR/Cas9 RNP and ssODNs to rabbit and human cells, leading to robust precise gene editing (PGE). The primary difference between TE and other conventional electroporation devices is the use of a tube, in which two electrodes are on the top and bottom of the tube and the sample is loaded in full then sealed upon electroporation (Figure 1). In contrast, in a conventional cuvette, the electrodes are on the sides and the sample is not fully sealed during electroporation. This new design reduces air bubble generation and compresses air bubble size, which consequently improves even distribution of electric voltage, and as a result leads to reduced cell death and high transfection efficiency9. In the present work, high PGE rates (15%-37%) were achieved targeting EGFR, Mybpc3 and HBB genes in human iPSCs. These results are consistent with a prior report in which high PGE rates were achieved in human stem cells9.
Disease-causing mutations were targeted in IL2RG and SPR genes in rabbit cells. Recently, IL2RG-knockout rabbits have been produced as models for human X-linked severe combined immunodeficiency (SCID-X1)16,17. The present work shows that patient IL2RG mutations (e.g., C231Y and Q235X) can be efficiently generated in rabbit cells, demonstrating the feasibility of creating SCID-X1 rabbit models carrying patient mutations. It was also demonstrated that SPR R150G mutations can be efficiently created in rabbit cells. This mutation causes motor and cognitive deficits in children12. These IL2RG and SPR mutation rabbit models, once generated, may serve as valuable preclinical models for translational studies. They may also be used to establish gene editing-based therapeutics for these monogenic diseases.
One concern for CRISPR/Cas9-mediated gene editing applications is the off-target editing events. Indel rates were analyzed at predicted top off-target sites for sgRNAs used in this study (Table S1), using methods previously described9. In total, seven potential top off-target loci were analyzed for sg-rb-IL2RG-01, five for sg-rb-SPR, seven for sg-hEGFR, five for sg-hMybpc3, and seven for sg-hHBB), using the primers listed in Table S2. No off-target indels were revealed by the T7E1 assays (Figure S1), indicating minimal off-target risks for CRISPR/Cas9-mediated gene editing using these sgRNAs. It also indicates that the tube electroporation method itself does not cause or increase off-target edits. Nevertheless, efforts should be dedicated to reduce or eliminate undesirable off-target edits. Whole-genome sequencing may be necessary to exclude such events for cells that are intended to be used in clinical applications.
At the technical level, the following are considered key factors to achieving efficient precise genome editing by CRISPR/Cas9 RNP tube electroporation. First, it is advised to select an efficient sgRNA with predicted low off-target potential. It is important to validate the indel efficiency of the selected sgRNA before using it for PEG applications. It is not rare that a software predicted good sgRNA fails at the validation step.
Second, to achieve high PGE, it is recommended to induce a PAM mutation to the ssODN donor whenever possible. The rationale is that by doing so, CRISPR/Cas9 re-cutting after donor template integration is prevented. In certain cases, the PGE itself introduces PAM mutations. In other cases, it is possible to introduce silent mutations to the PAM sequence. In the event that a PAM mutation is not possible, it is advised to try to include several silent mutations in the donor that corresponds to the sgRNA sequence.
Thirdly, particularly relevant to TE, it is important to avoid the formation of air bubbles when transferring cells and RNP mixture to the electroporation tube. While the design of a TE tube already minimizes air bubble formation, careful handling will further reduce and may even complete avoid air bubble formation. A trouble shooting guide for frequent problems that may be encountered in the application of tube electroporation for CRISPR/Cas9 ribonucleoprotein mediated precise gene editing is provided in Table 2.
In conclusion, it is demonstrated here that tube electroporation is an effective means for the delivery of CRISPR/Cas9 RNP and ssODNs to mammalian cells to achieve high PGE rates. This new TE transfection technique and its robust precise gene editing rate may facilitate the development of gene editing applications.
J. C. works at Celetrix LLC, manufacturer of the tube electroporator. L. M., L. J., J. S., D. Y., J. Z., Y. E. C., and J. X. declare no competing interests.
This work was supported by the National Institutes of Health (R21OD023194 to JX). This work utilized Core Services supported by Center for Advanced Models for Translational Sciences and Therapeutics (CAMTraST) at the University of Michigan Medical Center.
| Accutase | STEMCELL Technologies | 792 | Cell detachment solution for human iPSCs, first used in Step 1.1.2. |
| Cas9 Nuclease 3NLS | IDT | 1074182 | Cas9 protein, first used in Step 3.3. |
| DMEM | Thermo Fisher | 11965092 | For cell culture, first used in Step 1.2.3. |
| DPBS | Thermo Fisher | 1708075 | For preparing cell culture, first used in Step 1.2.2. |
| EDTA | Lonza | 51201 | For making lysis buffer, first used in Step 4.1. |
| Electroporation buffer | Celetrix | 13–0104 | The electroporation buffer, first used in Step 3.2. |
| Electroporation tubes | Celetrix | 20 μL: 12–0107; 120 μL: 12–0104 | The electroporation tube, first used in Step 3.4. |
| Electroporator | Celetrix | CTX-1500A LE | The tube electroporation machine, first used in Step 3.5 |
| Fetal bovine serum | Sigma Aldrich | 12003C | For cell culture, first used in Step 1.2.2. |
| Forma CO2 Incubators | Thermo Fisher | Model 370 | For cell culture, first used in Step 1.1. |
| Gel Extraction Kit | Qiagen | 28115 | For gel purification, first used in Step 4.3. |
| Human induced pluripotent stem cells | American Type Culture Collection | ACS-1030 | Human iPSCs, first used in Step 1.1. |
| Matrigel | Corning | 354277 | Artificial extracellular matrix; for precoating cell culture plate, first used in Step 1.1. |
| mTeSR 1 medium | STEMCELL Technologies | 85850 | Feeder-free cell culture medium for human iPSCs, first used in Step 1.1. |
| PCR SV mini | GeneAll | 103-102 | For PCR product purification, first used in Step 4.3. |
| Penicillin-Streptomycin | Thermo Fisher | 15140163 | For preparing cell culture, first used in Step 1.2.2. |
| Phenol-chloroform | Thermo Fisher | 15593031 | For DNA extraction, first used in Step 4.2. |
| Precision gRNA Synthesis Kit | Invitrogen | A29377 | For the generation of full length gRNA (guide RNA), first used in Step 2.4. |
| Proteinase K Solution | Thermo Fisher | AM2548 | For DNA extraction, first used in Step 4.1. |
| Q5 high-fidelity DNA polymerase | NEB | M0491 | For PCR amplification, first used in Step 4.3. |
| Sodium dodecyl sulfate | Sigma Aldrich | L3771 | For making lysis buffer, first used in Step 4.1. |
| TA Cloning Kit | Thermo Fisher | K457502 | For TA clone sequencing, first used in Step 4.4. |
| Tissue Culture Dish (10 cm) | FALCON | 353003 | For cell culture, first used in Step 1.2.3. |
| Tissue Culture Dish (12 well) | FALCON | 353043 | For cell culture, first used in Step 3.7. |
| Tissue Culture Dish (6 cm) | FALCON | 353004 | For cell culture, first used in Step 1.2.2. |
| Tris HCl | Thermo Fisher | BP1757-500 | For making lysis buffer, first used in Step 4.1. |
| Trypsin-EDTA | Thermo Fisher | 25200056 | For cell digestion, first used in Step 1.2. 4. |
| Universal Fit Pipette Tips | Celetrix | 14-0101 | For electroporation, first used in Step 3.4. |
| Y27632 | LC Labs | Y-5301 | The apoptosis inhibotor, first used in Step 1.1.1. |