Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Digitale PCR-gebaseerde competitieve index voor high-throughput analyse van de geschiktheid in salmonella

doi: 10.3791/59630 Published: May 13, 2019

Summary

Deze moleculair gebaseerde aanpak voor het bepalen van bacteriële fitness vergemakkelijkt nauwkeurige en nauwkeurige detectie van micro-organismen met behulp van unieke genomische DNA-barcodes die worden gekwantificeerd via digitale PCR. Het protocol beschrijft de berekening van de concurrerende index voor salmonella stammen; de technologie is echter gemakkelijk aan te passen aan protocollen die absolute kwantificering van enig genetisch-smeedbaar organisme vereisen.

Abstract

Een concurrerende index is een gemeenschappelijke methode die wordt gebruikt om bacteriële conditie en/of virulentie te beoordelen. Het nut van deze aanpak wordt geïllustreerd door haar gemak om uit te voeren en haar vermogen om de geschiktheid van vele stammen te standaardiseren tot een wild-type organisme. De techniek is echter beperkt door beschikbare fenotypische markers en het aantal stammen dat tegelijkertijd kan worden beoordeeld, waardoor een groot aantal replicaatexperimenten nodig is. Gelijktijdig met grote aantallen experimenten zijn de arbeids-en materiaalkosten voor het kwantificeren van bacteriën op basis van fenotypische markers niet onbelangrijk. Om deze negatieve aspecten te overwinnen met behoud van de positieve aspecten, hebben we een moleculaire benadering ontwikkeld om micro-organismen direct te kwantificeren na technische genetische markers op bacteriële chromosomen. Unieke, 25 basepaar DNA-barcodes werden ingebracht op een onschadelijke locus op het chromosoom van wild-type en Mutant stammen van salmonella. In vitro competitie experimenten werden uitgevoerd met behulp van entmateriaal bestaande uit gepoolde stammen. Na de competitie werden de absolute aantallen van elke stam gekwantificeerd met behulp van digitale PCR en werden de concurrerende indices voor elke stam berekend uit die waarden. Uit onze gegevens blijkt dat deze aanpak voor het kwantificeren van salmonella uiterst gevoelig, nauwkeurig en nauwkeurig is voor het opsporen van zowel zeer overvloedige (High fitness) als zeldzame (Low fitness) micro-organismen. Bovendien is deze techniek gemakkelijk aan te passen aan bijna elk organisme met chromosomen dat kan worden gewijzigd, evenals aan verschillende experimentele ontwerpen die absolute kwantificering van micro-organismen vereisen.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Het beoordelen van de geschiktheid en virulentie van pathogene organismen is een fundamenteel aspect van microbiologie onderzoek. Hiermee kunnen vergelijkingen worden gemaakt tussen stammen of tussen gemuleerde organismen, waardoor onderzoekers het belang van bepaalde genen onder specifieke omstandigheden kunnen bepalen. Traditioneel gebruikt virulentie beoordeling een dierlijk model van infectie met verschillende bacteriële stammen en het observeren van de uitkomst van het besmette dier (bijv. infectieuze dosis50, letale dosis50, tijd tot overlijden, ernst van het symptoom, gebrek aan symptomen, enz.). Deze procedure biedt waardevolle beschrijvingen van virulentie, maar het vereist stammen om aanzienlijke verschillen in uitkomsten te veroorzaken om variaties van wild type te detecteren. Bovendien zijn de resultaten semi-kwantitatief, omdat, terwijl ziekteprogressie en symptoom ernst in de loop van de tijd subjectief kunnen worden gekwantificeerd, de interpretatie van virulentie vergeleken met wild-type meer kwalitatief is (d.w.z. meer, minder of even virulent). Een gemeenschappelijk alternatief voor het uitvoeren van dierlijke infectiviteit assays is het genereren van concurrerende indices (CIs), waarden die direct vergelijken fitness of virulentie van een stam aan een wild-type tegenhanger in een gemengde infectie1. Deze techniek heeft tal van voordelen ten opzichte van een traditioneel diermodel van infectie door de virulentie te standaardiseren tot een wild type stam en het bepalen van een kwantificeerbare waarde om de mate van verzwakking weer te geven. Deze techniek kan ook worden aangepast om geninteracties in bacteriën te analyseren door het bepalen van een geannuleerde concurrerende index (COI)2. Het berekenen van een COI voor een groep gemuleerde organismen stelt onderzoekers in staat te bepalen of twee genen zelfstandig bijdragen aan pathogenese of als ze betrokken zijn bij dezelfde virulentie route en afhankelijk van elkaar. Bovendien vereist het berekenen van een CI inventarisatie van bacteriën die waardevolle inzichten kunnen geven in de pathogenese van organismen. CIs en COIs stellen onderzoekers ook in staat om Avirulente stammen te onderzoeken die geen klinische ziekte veroorzaken, maar nog steeds verschillen in geschiktheid. Deze techniek wordt beperkt door het gebruik van traditionele antibioticaresistentie markers om stammen te identificeren, waardoor het aantal ingangs stammen beperken tot slechts één of twee tegelijk. Vanwege deze beperking zijn grote aantallen experimentele groepen en replicaten vereist, die naast het toevoegen aan arbeids-en materiaalkosten ook de mogelijkheden voor variabiliteit in experimentele omstandigheden en onnauwkeurige resultaten vergroot. (Voor een grondige beoordeling van de voordelen en toepassingen van het gebruik van gemengde infecties om virulentie, fitness en geninteracties te bestuderen, zie C.R. Beuzón en D.W. Holden 1)

Er zijn pogingen ondernomen om deze beperking te overwinnen, zoals het gebruik van fluorescently gelabelde cellen gekwantificeerd via flow flowcytometrieonderzoeken3,4,5. Deze techniek kwantificeert cellen met behulp van ofwel 1) gelabelde antilichamen tegen fenotypische markers of 2) endogeen geproduceerde fluorescerende eiwitten. Het gebruik van gelabelde antilichamen heeft een aantoonbaarheidsgrens van 1.000 cellen/mL en vereist daarom een groot aantal cellen om3te analyseren. Cellen die fluorescerende eiwitten uitdrukken hebben een veranderde fysiologie en zijn vatbaar voor fitness veranderingen als gevolg van hoge eiwit expressie6. Beide methoden worden beperkt door het aantal fluorescerende markers detecteerbaar met behulp van flow cytometrie. Een vooruitgang in moleculaire kwantificatie werd bereikt door de ontwikkeling van een microarray-techniek die verzwakking ontdekte in 120 stammen van een initiële gemengde infectie van meer dan 1.000 stammen in een Murine model7. Deze techniek gebruikt een microarray analyse van RNA van gemuleerde stammen, wat leidde tot een aanzienlijke variabiliteit in de uitkomst.  Niettemin stelde het dat grote groepen van gemengde infecties een nuttig hulpmiddel kunnen zijn en dat met behulp van gevoelige detectietechnieken verschillen in bacteriële virulentie kunnen worden geïdentificeerd. Met de ontwikkeling van de volgende generatie sequencing, breidde TN-SEQ het nut van transposon mutaties uit, wat een krachtige methode mogelijk maakt voor het kwantificeren van bacteriën die willekeurig werden gemuleerd8,9,10, 11. Onlangs is een alternatief protocol ontwikkeld dat de noodzaak van transposons elimineert en in plaats daarvan DNA-barcodes gebruikt om de genomische veranderingen en hun impact op fitness12gemakkelijker te identificeren en bij te houden. Deze technologie is een belangrijke vooruitgang, maar het inbrengen van de genomische barcodes is nog steeds een willekeurig proces. Om de willekeurigheid van eerdere experimenten te overwinnen, ontwikkelde Yoon et al. een methode om het CIs van salmonella stammen te berekenen met behulp van unieke DNA-barcodes die op precieze locaties op de chromosomen van bacteriën13zijn geplaatst. Unieke met stammen werden gedetecteerd met behulp van een qPCR-gebaseerde methode met sybr Green en primers specifiek voor elke unieke barcode. De techniek werd beperkt door de door qPCR opgelegde beperkingen, waaronder verschillen in primer-efficiëntie en lage gevoeligheid, wat blijkt uit de noodzaak van geneste PCR voorafgaand aan qPCR. Niettemin heeft deze benadering aangetoond dat gerichte genomische modificaties kunnen worden benut voor het opsporen en mogelijk kwantificeren van Pools van meerdere bacteriële stammen.

In het volgende protocol beschrijven we een nieuwe methodologie om bacteriële concurrentie experimenten uit te voeren met grote Pools van gemengde entmateriaal, gevolgd door nauwkeurige kwantificering met behulp van een zeer gevoelige digitale PCR-techniek. Het protocol omvat het genetisch labelen van bacteriële stammen met een unieke DNA-Barcode ingevoegd op een onschadelijke regio van het chromosoom. Deze modificatie maakt het mogelijk om stammen snel en nauwkeurig te kwantificeren met behulp van moderne moleculaire technologie in plaats van traditionele seriële verdunningen, replica plating, en tellen kolonie vormende eenheden die afhankelijk zijn van fenotypische markers (d.w.z. antibioticaresistentie ). De wijzigingen maken gelijktijdige beoordeling van vele stammen in één gegroepeerd entmateriaal mogelijk, waardoor de mogelijkheid van experimentele variabiliteit aanzienlijk wordt verminderd, omdat alle stammen aan exact dezelfde voorwaarden worden blootgesteld. Bovendien, terwijl deze techniek werd ontwikkeld in salmonella heliobacter Serovar typhimurium, het is zeer aanpasbaar aan een genetisch smeedbaar organisme en bijna elk experimenteel ontwerp waar nauwkeurige bacteriële tellingen zijn vereist, het verstrekken van een nieuwe tool om de nauwkeurigheid en doorvoer in microbiologie laboratoria te verhogen zonder de beperkingen opgelegd door eerdere methoden.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Integreer unieke DNA-barcodes op een plasmide met de nodige componenten voor allelic Exchange

Opmerking: Een nieuw plasmide, genaamd pskap, met een hoog Kopieer nummer en een verhoogde transformatie-efficiëntie in vergelijking met de bestaande pKD13 allel Exchange plasmide werd gecreëerd. Dit wordt beschreven in de stappen 1.1-1.12 (Figuur 1). De gefinaliseerde plasmiden met unieke DNA barcodes en componenten voor allel Exchange zijn beschikbaar via een plasmide repository (tabel van materialen).

  1. Met behulp van een commerciële plasmide miniprep Kit, zuiveren pKD1314 en ppcr script cam SK+ van nachtelijke bacteriële culturen geteeld in Luria-Bertani (lb) Bouillon aangevuld met 50 μg/ml kanamycine of 25 μg/ml chlooramfenicol (voor pKD13 en ppcr script cam SK +, respectievelijk) (tabel 1).
  2. Voer op beide plasmiden met behulp van commerciële beperkings enzymen HindIII en BamHI op basis van de specificaties van de fabrikant restrictie-digestonen uit.
  3. Verwijder restrictie enzymen en het DNA van de pPCR script cam SK+ reactie en reinig de 3.370-base pair (BP) plasmide backbone met behulp van een in de handel verkrijgbare DNA Cleanup Kit volgens de specificaties van de fabrikant.
  4. Scheid de fragmenten van de pKD13 beperking vertering op een 1% agarose gel met behulp van een elektroforese kamer.
  5. Visualiseer bands met een blauw licht transverlichter en accijns het 1.333 BP fragment uit de gel (figuur 1c).
    Opmerking: Dit fragment bevat de FRT-geflankeerd kanamycine weerstand gen vereist voor chromosomale allel vervanging.
  6. Reinig het uitblinkte DNA uit stap 1,5 met behulp van een commerciële gel-extractie Kit.
  7. Om pSKAP te maken, ligate het gezuiverde fragment van pKD13 (van stap 1,6) in pPCR script cam SK+ (vanaf stap 1,3) met behulp van een commerciële T4 DNA ligase volgens de specificaties van de fabrikant.
  8. Transformeer chemisch competente DH5α cellen met het geligeerd pskap plasmide volgens het Protocol van de fabrikant (tabel 1).
  9. Verspreid transformanten op LB agar platen aangevuld met 50 μg/mL kanamycine en inincuberen bij 37 °C 's nachts.
  10. Kies een kolonie van de plaat en streep het op een nieuwe LB agar-plaat aangevuld met 50 μg/mL kanamycine en incuberen bij 37 °C 's nachts. Kies een kolonie van deze plaat en gebruik om te beënten LB Bouillon aangevuld met 50 μg/mL kanamycine. Incuberen de cultuur 's nachts bij 37 ° c met constante opwinding.
  11. Gebruik een commerciële plasmide miniprep Kit om pSKAP te zuiveren van de nachtelijke bacteriële cultuur.
  12. Voer een diagnostische restrictie uit de vertering van het plasmide uit stap 1,11 met behulp van Hind III en BAM HI volgens de specificaties van de fabrikant. Visualiseer fragmenten op een 1% agarose gel zoals in stappen 1.4-1.5.
    Opmerking: De pSKAP totale grootte moet 4.703 BP. fragmenten na stap 1,12 moeten 3.370 en 1.333 BP.
  13. Ontwerp PCR-primers voor insertiongestuurde mutagenese (SDM) (tabel 2 en S1) op zodanige wijze dat een unieke 25-base pair DNA-sequentie wordt ingevoegd op positie 725 van pSKAP (Figuur 2).
    Opmerking: De barcode DNA wordt ingebracht in de plasmide net buiten het FRT-geflankeerd kanamycine weerstand gen, zodat de barcode niet verloren gaat bij latere verwijdering van de kanamycine weerstands cassette. Als u nieuwe barcode sequenties genereert, gebruik dan online tools om ervoor te zorgen dat de fluorescently-gelabelde doelspecifieke PCR-sondes (hierna simpelweg "probes" genoemd) efficiënt aan de nieuwe sequentie zullen binden. In de tabellen 2 en S1vindt u de plaatsings volgorde die tot op heden is ontworpen, samen met de benodigde primers om deze te maken.
  14. Bereid SDM-reacties voor met behulp van een commerciële High-Fidelity DNA-polymerase, de gewenste primer paren (tabel 2) en pSKAP-sjabloon. Stel de Thermocycler in om het volgende uit te voeren: 1) 98 °C voor 30 s, 2) 98 °C voor 10 s, 56 °C gedurende 15 sec., 72 °C gedurende 2 min, 3) Herhaal stap 2, 24 maal, 4) 72 °C gedurende 5 min, 5) vasthouden bij 4 °C.
  15. Na voltooiing van de PCR, afbrekende pSKAP sjabloon door toevoeging van het restrictie enzym DPN I aan de reactie. Inincuberen bij 37 °C gedurende 20 min.
    Opmerking: Producten van PCR moeten worden gevisualiseerd op een agarose-gel om de grootte en zuiverheid van het product te controleren. Een controle DPN I vertering bestaande uit de ongewijzigde pSKAP template kan worden uitgevoerd en gebruikt in volgende stappen om ervoor te zorgen dat template DNA volledig wordt verteerd.
  16. Gebruik 5 μL van het product uit stap 1,15 om 100 μL commerciële chemisch bevoegde DH5α cellen om te zetten volgens de aanbevelingen van de fabrikant.
  17. Verspreid transformanten op LB agar platen aangevuld met 25 μg/mL chlooramfenicol en incuberen bij 37 °C 's nachts.
  18. Selecteer een kolonie (of kolonies) van de nachtelijke platen en streak op individuele LB agar-platen aangevuld met 25 μg/mL chlooramfenicol en inincuberen bij 37 °C 's nachts. Selecteer een kolonie van 's nachts platen en gebruik om te inoculeren 5 mL LB Bouillon aangevuld met 25 μg/mL chlooramfenicol. Incubate cultuur (s) 's nachts bij 37 °C met constante opwinding.
  19. Gebruik een commerciële plasmide miniprep Kit om plasmiden te zuiveren van de nachtelijke cultuur (en).
  20. Sanger sequentie gezuiverde plasmiden met behulp van de M13 forward sequencing primer (tabel 2). Vergelijk gemuteerde Region met de originele plasmide en beoordeel voor SDM insertionele nauwkeurigheid.
  21. Nadat u de barcode invoeging en nauwkeurigheid hebt bevestigd, wijst u elke barcode en plasmide een naam toe.
    Opmerking: Barcodes gegenereerd tot-datum zijn toegewezen aan een tweeletterige benaming: AA, AB, AC,..., BA, BB, BC, enz. Barcoded plasmiden worden aangeduid als pSKAP_AA, pSKAP_AB, pSKAP_AC,..., pSKAP_BA, pSKAP_BB, pSKAP_BC, enz.
  22. Herhaal stap 1.14-1.21 om het gewenste aantal DNA-barcodes te genereren.

2. DNA-Barcode introduceren op het chromosoom van S. Typhimurium

Opmerking: Het inbrengen van DNA-barcodes op de S. Tyhimuriumchromosoom wordt bereikt door gebruik te maken van een allel-uitwisselings methode die wordt beschreven door datsenko en wanner14 en die is aangepast voor gebruik in S. Typhimurium.

  1. Bepaal de Locus op de S. Typhimurium genoom waar de DNA-streepjescode moet worden ingevoegd (Figuur 3).
    Opmerking: Selecteer een grote, intergene regio van het chromosoom. Vermijd gebieden die niet-coderen RNA produceren. Deze studie gebruikte een Locus stroomafwaarts van put P tussen residuen 1.213.840 en 1.213.861 (bepaald door genoom assemblage GCA_ 000022165.1). Deze regio is eerder genetisch gemanipuleerd voor de trans-complementatie van genen15. Als alternatief kan een DNA-Barcode worden geïntroduceerd terwijl tegelijkertijd een gen van belang wordt verstoord. Dit protocol vereist minimale wijzigingen en stroomlijnt de Mutante creatie.
  2. Ontwerp PCR-primers om het unieke barcode-en FRT-geflankeerd kanamycineweerstandsgen uit de gewenste pSKAP-barcode met plasmide uit stap 1,21 (tabel 2) te versterken. Voeg 40-nucleotide-extensies toe die homoloog zijn voor de regio die is geselecteerd in stap 2,1 tot en met het 5 ' einde van elke primer (tabel 2).
  3. Voer de versterking uit met behulp van een commerciële High-Fidelity polymerase, de primers uit stap 2,2, en de gewenste pSKAP barcode-bevattende plasmide als sjabloon. Stel de Thermocycler in om het volgende uit te voeren: 1) 98 °C voor 30 s, 2) 98 °C voor 10 s, 3) 56 °C gedurende 15 s, 4) 72 °C voor 60 s, herhaal stappen 2-4 29 keer, 5) 72 °C gedurende 5 min, 6) vasthouden bij 4 °C.
  4. Na voltooiing van de PCR, afbrekende template DNA met behulp van DpnI zoals beschreven in stap 1,15. Reinig en concentreer het DNA met behulp van een commerciële DNA Cleanup Kit volgens de specificaties van de fabrikant.
  5. Raadpleeg het eerder gepubliceerde protocol voor het genereren van mutanten in S. Typhimurium stam 14028s van PCR-producten14,16,17,18.
    Opmerking: Het is niet essentieel dat het kanamycine-resistentie-gen uit het chromosoom wordt weggesneden. Excisie van het gen is echter minimaal storend voor het bacteriële chromosoom, omdat het resulteert in een 129 BP litteken dat potentiële downstream genen in-frame zou achterlaten. Het wordt aanbevolen dat de stam die het kanamycine-resistentie-gen bevat, wordt behouden omdat het kan worden gebruikt om barcodes tussen stammen te verplaatsen via P22-gemedieerde transductie.
  6. Herhaal de stappen 2,3 – 2,5 om de gewenste stammen te maken met de juiste streepjescodes.
    Opmerking: Barcodes kunnen worden geïntroduceerd in wild-type S. Typhimurium dat vervolgens kan worden onderworpen aan verdere genetische manipulatie, of barcodes kunnen worden geïntroduceerd in stammen die eerder genetisch gewijzigd zijn.

3. bacteriële groeiomstandigheden en in vitro wedstrijd testen

  1. Van bacteriën voorraad, streak desired S. Typhimurium stammen die elke haven een unieke DNA barcode op LB agar platen. Incuberen de platen 's nachts bij 37 °C.
  2. Selecteer een enkele kolonie van elke stam en inoculeren 5 mL LB Bouillon. Inincuberen gedurende 20 uur bij 37 °C met constante opwinding.
    Opmerking: Gebruik de nachtelijke cultuur, ga verder naar stap 3,5 om zuivere genomisch DNA (gDNA) te verzamelen van elke bargecodeerde stam. Dit is noodzakelijk voor de daaropvolgende validatie-en controle experimenten in sectie 6.
  3. Breng voor elke wedstrijd test een gelijk volume van elke overnachtings cultuur over in een steriel buisje met gepaste grootte. Meng de stammen grondig door elkaar krachtig voor minstens 5 sec.
    Opmerking: Het volume van elke nachtelijke cultuur om over te dragen moet voldoende zijn voor elke toestand en repliceren, evenals voor het isoleren van gDNA om invoer te kwantificeren. Hoewel het niet geheel noodzakelijk is om de optische dichtheden van culturen te meten, omdat het absolute aantal micro-organismen zal worden gekwantificeerd met behulp van digitale PCR, moet het aantal ingangs bacteriën voor elke stam ongeveer gelijk zijn om knelpunten te voorkomen of de ongelijke concurrentie in het begin van het experiment. Representatieve competitie testen in dit protocol vergeleken groeipercentages van 8 stammen tegelijkertijd. Er kunnen extra of minder stammen nodig zijn voor individuele experimentele ontwerpen.
  4. Breng 100 μL van het gemengde entmateriaal over in 4,9 mL steriele LB Bouillon. Inincuberen bij 37 °C voor de gewenste tijd of op een gewenste optische dichtheid.
  5. Oogst 500 μL van het entmateriaal door centrifugeren bij > 12000 x g gedurende 1 minuut. Verwijder het supernatant en gooi het weg. Ga onmiddellijk naar sectie 4 met de cellen.
  6. Verwijder op gewenste tijdstippen 500 μL van de kweek en oogst cellen door centrifugeren bij > 12000 x g gedurende 1 minuut. Verwijder en gooi supernatant weg.
    Opmerking: Als u aliquots verzamelt op meerdere tijdspunten, Vries dan pellets bij-20 °C of ga onmiddellijk naar stap 4,1 na elke verzameling.

4. het verzamelen en kwantificeren van gDNA van S. Typhimurium (uit de stappen 3,5 en 3,6)

  1. Oogst gDNA uit cellen met behulp van een commerciële gDNA zuiverings pakket. Indien beschikbaar, voer de optionele RNA depletie stap uit.
    Opmerking: RNA-uitputting is niet nodig; de aanwezigheid van RNA zal de DNA-concentratie echter kunstmatig verhogen, wat leidt tot afwijkende berekeningen in de daaropvolgende stappen. Als u een commerciële gDNA-zuiverings pakket gebruikt, volgt u de aanbevelingen van de fabrikant om er zeker van te zijn dat de kolom niet overladen is met DNA. Er is geen minimale DNA-concentratie nodig als het monster in de daaropvolgende stappen kwantificeerbaar is.
  2. Gebruik een spectrofotometer om het DNA in elk monster te kwantificeren.
    Opmerking: DNA kan worden gekwantificeerd met elke betrouwbare methode.
  3. Bereken het gDNA-Kopieer nummer op basis van de bacteriële genoom grootte met behulp van de volgende vergelijking: X is de hoeveelheid DNA in ng en N is de lengte van een dubbel-streng DNA-molecuul (de grootte van het genoom).
    Equation 1
    Opmerking: 660 g/mol wordt gebruikt als de gemiddelde massa van 1 DNA-BP. er kunnen kleine variaties bestaan, afhankelijk van de nucleotide-samenstelling van het organisme. Talrijke rekenmachines zijn online beschikbaar om de berekening uit te voeren.

5. ontwerp primers en voelers voor kwantitatieve detectie van DNA-barcodes via dDigital PCR

  1. Ontwerp primers om de met regio van de Ste versterken. Tyhimuriumchromosoom stroomafwaarts van Putp (figuur 3c en tabel 2).
    Opmerking: Primer en sonde ontwerpen kunnen worden vergemakkelijkt door tal van online programma's (tabel van materialen). Als barcodes allemaal op dezelfde loci worden geplaatst, is een enkele set versterkings primers universeel voor alle barcodes.
  2. Ontwerp 6-carboxyfluorescein (FAM)-gebaseerde en/of hexachlorofluorescein (HEX)-gebaseerde sondes die specifiek zijn voor elke streepjescode (tabel 2 en S1).
    Opmerking: De druppel-lezer die in dit experiment wordt gebruikt, kan zowel fam-als hex-sondes tegelijk in een multiplex reactie detecteren. Ontwerp 1/2 van de sondes om gebruik te maken van FAM en 1/2 om HEX te gebruiken. Dit is geen noodzakelijke stap, maar zal het reagens gebruik en de experimentele kosten verminderen indien geïmplementeerd.
  3. Maak 20x primer-probe Master mixen met 1) 20 mM van elke voorwaartse en omgekeerde versterkings primer, 2) 10 mM van een enkele FAM-sonde, en 3) 10 mM van een enkele HEX-sonde (indien multiplexing).

6. Valideer de gevoeligheid en specificiteit van elke Pprimer-probe-set voor elke genomische streepjescode met digitale PCR-

Opmerking: Dit protocol maakt gebruik van acht unieke barcodes met acht unieke sondes als voorbeeld. Het aantal gebruikte barcodes kan worden verhoogd of verlaagd om verschillende experimentele ontwerpen tegemoet te komen.

  1. Maak een pool van gDNA die elke streepjescode bevat, behalve één. Gebruik deze pool als het verdunningsmiddel om een verdunningsreeks uit te voeren met gDNA die de enige resterende streepjescode bevat (bemonsterings verdunnings schema is beschikbaar in Figuur 4).
    Opmerking: Het gebruik van gepoolde gDNA als verdunningsmiddel zorgt voor een consistente achtergrond terwijl de gevoeligheid wordt nagegaan. Verdun met behulp van de in stap 4,3 bepaalde Kopieer nummers gDNA naar een kopie nummer binnen het aanbevolen digitale PCR-bereik (1-100.000 kopieën per 20 μL-reactie). Houd er rekening mee dat het bereik is ingesteld voor elk uniek doel (streepjescode), niet het totale aantal gDNA.
  2. Bereid reacties voor op digitale PCR in tweevoud volgens de aanbevelingen van de fabrikant voor het gebruik van een digitale PCR Supermix ontworpen voor sonde-gebaseerde chemie. Gebruik de mengsels uit stap 6,1 als template-DNA. Gebruik de 20 x primer-probe Master Mix uit stap 5,3 die de sonde bevat voor de verdunde streepjescode in stap 6,1.
  3. Bereid replicaatcontrolereacties voor op digitale PCR volgens de aanbevelingen van de fabrikant voor het gebruik van een digitale PCR-Supermix die is ontworpen voor op sonde gebaseerde chemie. Controle reacties voor elke sonde mix moeten bestaan uit 1) geen sjabloon besturingselementen (Ntc's), 2) negatieve controles, en 3) positieve controles.
    Opmerking: Het minimum aantal replicaatcontrolereacties is twee. In dit voorbeeld protocol worden vier Ntc's, zes negatieve besturingselementen en zes positieve besturingselementen voor elke streepjescode gebruikt. Negatieve controles moeten gDNA met elke streepjescode bevatten, behalve de streepjescode die overeenkomt met de test die wordt getest. Dit zal de specificiteit van elke sonde valideren.
  4. Herhaal stap 6.1-6.3 om digitale PCR-reacties te maken voor elk met een barcode gecodeerd gDNA-monster. Een monster plaat opstelling wordt weergegeven in Figuur 5.
    Opmerking: Deze en volgende stappen worden beschreven op basis van een specifiek digitaal PCR-platform dat druppeltjes en flow-gebaseerde technologie gebruikt. Alternatieve digitale PCR-platforms die gebruikmaken van chip-gebaseerde technologie kunnen gemakkelijk worden vervangen door kleine wijzigingen in dit protocol. Stap 6,4 kan meer dan 1 96-goed plaat nodig hebben om alle primer sets te valideren. In tegenstelling tot qPCR kunnen afzonderlijke platen geanalyseerd met digitale PCR gemakkelijk worden vergeleken zonder de noodzaak van gestandaardiseerde referentie putten tussen platen.
  5. Genereer druppels voor elke reactie aandoening met behulp van een druppel Generator volgens de instructies van de fabrikant.
  6. Breng nieuw gecreëerde druppels over in de juiste 96-goed plaat. Gebruik pipetpunten van 200 μL op een multikanaalspipet van 5-50 μL.
    Opmerking: Pipetteer druppeltjes, langzaam en soepel pipetten! De fabrikant van de digitale PCR-apparatuur raadt aan om alleen pipetten en pipetpunten van een bepaalde fabrikant (bijv. Ranin) te gebruiken. Deze pipetpunten hebben een soepele opening zonder microscopische kunststof fragmenten die druppels kunnen vernietigen of de microfluïdica van de druppel lezer beschadigen. Talrijke merken van tips werden onderzocht en waargenomen om een spectrum van productiekwaliteit. Gelijkwaardige resultaten zijn behaald met behulp van alternatieven voor pipetpunt; echter, voorzichtigheid moet worden gebruikt bij het afwijken van de aanbevelingen van de fabrikant.
  7. Nadat alle druppels zijn gegenereerd en overgebracht, verzegelen de plaat met een folie plaat sealer.
  8. Gebruik de door de fabrikant aanbevolen Thermocycler om de volgende fiets condities uit te voeren: 1) 94 °C gedurende 10 min; 2) 94 °C gedurende 1 minuut, helling snelheid ingesteld op 1 °C/s; 3) 55 °C gedurende 2 minuten, helling snelheid ingesteld op 1 °C/s; 4) Herhaal stappen 2 en 3 49 keer; 5) 98 °C gedurende 10 min; 6) Houd bij 4 °C tot 24 uur vast.
    Opmerking: Thermische overdracht in een druppel reactie is niet hetzelfde als de standaard PCR. Reactieomstandigheden kunnen wijziging vereisen.
  9. Terwijl thermocyclen wordt uitgevoerd, programmeer de data-analyse software met de plaat instellingsinformatie zoals monster naam, experiment type (absolute kwantificering), Supermix gebruikt, target 1 naam (fam barcode naam), target 1 type (NTC, positieve controle, negatieve controle, of onbekend), Target 2 naam (HEX barcode naam), Target 2 type (blanco, positieve controle, negatieve controle, of onbekend). De informatie over de laatste plaat installatie wordt weergegeven in Figuur 5.
  10. Nadat thermocyclen is voltooid, zet u de voltooide reacties over op de druppel lezer en start u het leesproces volgens de instructies van de fabrikant.

7. Kwantificeer het aantal bacteriën in een competitieve index-experiment

  1. GDNA geïsoleerd en gekwantificeerd uit punt 4 verdunnen tot een passende concentratie zoals hierboven beschreven.
  2. Bereid reacties voor op digitale PCR volgens de aanbevelingen van de fabrikant voor het gebruik van de juiste Supermix. Gebruik DNA uit stap 7,1 als sjabloon. Gebruik een 20 x primer-probe Master mix met de sonde (of sondes bij het opsporen van zowel FAM als HEX) voor mogelijke barcodes die aanwezig zijn in het experiment.
  3. Bereid extra digitale PCR-reacties voor zoals in stap 7,2 met behulp van verschillende 20x primer-probe Master mixen totdat alle barcodes gebruikt in het experimentele ontwerp kunnen worden gedetecteerd.
  4. Inclusief besturingselementen voor elke voorwaarde, zoals beschreven in 6,3. Dit omvat 1) geen sjabloon besturingselementen (Ntc's), 2) negatieve besturingselementen en 3) positieve controles.
  5. Ga verder met het protocol zoals beschreven in stappen 6.5-6.10.

8. Analyseer digitale PCR-gegevens en bereken de absolute Kopieer nummers

  1. Wanneer alle putjes zijn gelezen en de uitvoering is voltooid, opent u het. QLP-gegevensbestand met behulp van de gegevensanalyse software.
    Opmerking: De hier beschreven bestandstypen en gegevensanalyse procedures zijn specifiek voor één digitale PCR-fabrikant. Bij gebruik van alternatieve digitale PCR-platformen zullen bestandstypen en gegevensanalyse procedures specifiek zijn voor het gebruikte platform en moeten worden uitgevoerd volgens de aanbevolen specificaties van de fabrikant.
  2. Selecteer alle putten die gebruikmaken van dezelfde primer-probe Master Mix.
  3. Op de drup pels tab, onderzoek het aantal druppels geanalyseerd in elk goed (zowel positieve als negatieve druppels). Uitsluiten van analyse elke goed dat heeft minder dan 10.000 totale druppels.
  4. Ga naar het tabblad 1d amplitude en Bekijk de amplitudes van positieve en negatieve druppels. Zorg ervoor dat ze bestaan uit twee verschillende populaties.
  5. Gebruik binnen de software de drempel functie om een cutoff te maken tussen positieve en negatieve druppels voor elke sonde die werd gebruikt (Figuur 6).
    Opmerking: Alle putjes die dezelfde primer-probe Master Mix uit stap 5,3 gebruiken, moeten dezelfde drempels hebben.
  6. Zodra passende drempels zijn toegepast op alle putten, zal de software het aantal DNA-kopieën in elke reactie berekenen. Exporteer gegevens naar een spreadsheet om verdere analyse mogelijk te maken.
    Opmerking: De gegevensanalyse software gebruikt het aantal positieve en negatieve druppels die geschikt zijn voor een Poisson-verdeling om het kopie nummer te bepalen.
  7. Bereken met behulp van de waarden uit stap 8,6 het aanvankelijke kopie nummer van elke unieke genomische streepjescode in het voorbeeld. Bepaal het gemiddelde vals-positieve percentage van de negatieve controle reacties en trek deze waarde af van de waarden die zijn verkregen in experimentele reacties. Vermenigvuldig de waarden zo nodig op basis van de verdunningen die zijn uitgevoerd bij het instellen van elk experiment (tabel 3).

9. Bepaal de relatieve geschiktheid van een organisme door de CI of COI te berekenen op basis van digitale PCR-gebaseerde kwantificering van Bargecodeerde stammen

  1. Bereken de CI van een barcode stam met behulp van de volgende formules, waarbij: eenoutput is de absolute kwantificering van de met stam op een bepaald tijdpunt, WToutput is de absolute kwantificering van met wild-type bacteriën in dezelfde tijdpunt, eeninput is de absolute kwantificering van het ingangs entmateriaal van de gebarcodeerde stam, WT-ingang is de absolute kwantificering van het input-entmateriaal van bargecodeerde wilde bacteriën, X-uitgang is de som van alle stammen op hetzelfde tijdspunt, X-ingang is de som van het totale ingangs entmateriaal van alle bargecodeerde stammen.

Equation 2
Equation 3
Opmerking: Zie de discussie voor voordelen, nadelen en het meest geschikte gebruik van elke formule.

  1. Herhaal stap 9,1 voor elke gebarcodeerde stam op alle tijdpunten.
  2. Indien van toepassing, bereken de coi met behulp van de volgende formules: eenuitvoer is de absolute kwantificering van een met stam met gemuleerd gen a op een bepaald tijdpunt, ABoutput is de absolute kwantificering van een met stam met gemuleerde genen a en B op hetzelfde tijdpunt, is eeninput de absolute kwantificering van het ingangs entmateriaal van de bargecodeerde stam met gemuleerd gen a, AB-input is de absolute kwantificering van het entmateriaal van de input van een barcode stam met gemuleerde genen a en b, is b-uitgang de absolute kwantificering van een met stam met gemuleerd gen b op een bepaald tijdpunt, en b-input is de absolute kwantificering van de input entmateriaal van de gebarcodeerde stam met gemuleerd gen B.

Equation 4
Of
Equation 5

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Het gebruik van deze methodologie vereist dat er passende controle reacties worden uitgevoerd om de gevoeligheid en specificiteit van elke sonde die wordt gebruikt om het doel-DNA te identificeren, te valideren. In dit representatieve experiment hebben we acht unieke DNA-barcodes gevalideerd met de acht bijbehorende sondes voor identificatie. Alle acht sondes hadden een laag percentage valse positieven in zowel NTC-als negatieve controle Reacties (tabel 3), waarbij hun specificiteit werd benadrukt, zelfs bij sterk VERGELIJKbare DNA-sequenties. Om de gevoeligheid van elke aandoening te beoordelen, werd gDNA die een unieke streepjescode bevat, op een seriële wijze verdund in een constante achtergrond van gDNA die elk van de zeven resterende streepjescode sequenties bevat. Met de hierboven uiteengezette aanpak kon digitale PCR slechts 2 kopieën van gDNA in een achtergrond van bijna 2.000.000 vergelijkbare DNA-sequenties onderscheiden (tabel 3).

Naast het bepalen van de gevoeligheid en specificiteit van elke sonde en DNA Barcode sequentie, lieten de verdunningen uitgevoerd in het valideringsonderzoek ons toe om een gesimuleerde concurrerende index uit de resulterende gegevens te berekenen. Hoewel er geen echte invoer of uitvoer voor dit experiment, kunnen de gegevens worden geanalyseerd alsof er een experiment met de concurrentie is uitgevoerd. Om dit te doen, beschouwen we elk mengsel in de seriële verdunning als een output (eenoutput) voor de verdunde streepjescode, terwijl de totale output (x-uitgang), input (eeningang) en de totale input (x-ingang) van elke stam wordt berekend op basis van de kwantificering van de positieve controles waarbij alle barcodes zijn opgenomen. Met behulp van de verdunningsfactor voor elk mengsel werd de theoretische CI bepaald en gerapporteerd in tabel 3. In elk van de verdunnings reeksen die voor elke streepjescode is uitgevoerd, wordt de gemiddelde gesimuleerde CI gerapporteerd, samen met de standaarddeviaties voor elke duplicaat verdunningsreeks. In alle gevallen is de gesimuleerde CI die is berekend vergelijkbaar met de theoretische CI. Het merendeel van de berekende CIs wijkt af van het theoretische CIs met minder dan 25%. In het geval van een lagere theoretische CIs was de afwijking van de berekende waarde omhoog van 2-voudige. Dit betekende bijvoorbeeld een verandering van een theoretische CI van 0,000625 naar een berekende CI van 0,001220. Deze gegevens benadrukken dat de beschreven methode is zeer nauwkeurig en zeer nauwkeurig. De combinatie van hoge gevoeligheid, specificiteit, nauwkeurigheid en precisie stelt dit systeem in staat om op betrouwbare wijze verschillen in fitness te detecteren die anders onopgemerkt kunnen blijven.

Na het valideren dat genomische barcodes nauwkeurig konden worden opgespoord en gekwantificeerd, voerden we in-vitro competitie experimenten uit (tabel 4). De eerste competitie experiment gebruikt acht wild-type S. Typhimurium stammen die elk een unieke DNA Barcode bevatten. Elke stam werd 's nachts geteeld en de acht culturen werden in gelijke hoeveelheden met elkaar vermengd. 100 μL van dit gemengde entmateriaal werd gebruikt voor het inenten van 4,9 mL steriele LB Bouillon en de resulterende kweek werd geïncubeerd bij 37 °C met constante opwinding. gDNA werd geoogst uit het entmateriaal om de exacte invoer van elke stam te berekenen. De groei van de kweek werd gemonitord door meting van de extinctie bij 600 nm (OD600). Bij OD600 = 0,5 (logaritmische fase) werd een monster van elke cultuur verzameld en werd gdna geoogst. De overgebleven kweek werd teruggebracht tot 37 °C met constante opwinding tot 8 uur na de inoculatie wanneer een eindmonster werd verzameld en gDNA werd geoogst (stationair). De resultaten werden berekend met behulp van de CI-formule aangepast voor gepoolde infecties. Zoals verwacht hadden alle wild-type stammen CI-waarden die bijna gelijk waren aan 1 (tabel 4). Een soortgelijk competitie experiment werd uitgevoerd met acht Mutant S. Typhimurium stammen die elk unieke barcodes hadden naast een single-, double-, of triple-transketolase deficiëntie18. Zoals eerder getoond, de stammen allemaal op dezelfde manier gegroeid in LB Bouillon, met slechts een lichte vertraging waargenomen in de Triple-transketolase-deficiënte stam. Echter, wanneer de groei van elke stam werd beoordeeld door het analyseren van de CI, een veel meer diepgaande defect werd waargenomen voor de transketolase-deficiënte stam (CI werd vergeleken met groeicurves in Shaw et al.18). Bovendien kon dit experiment ons in staat stellen om een kwantificeerbare waarde toe te wijzen aan de groei kenmerken van elke stam in plaats van het louter kwalitatief beschrijven van de groeipatronen. CIs voor elke stam werden berekend met behulp van zowel de traditionele formule waarbij elke stam werd vergeleken met wild-type en de gewijzigde formule waar alle input stammen werden overwogen. Terwijl de veranderingen waren klein, de CI van de Triple-transketolase-deficiënte stam was kunstmatig laag in de traditionele formule, omdat het geen rekening voor de andere zes concurrerende stammen die alle tentoongesteld in de buurt van-wild-type fitness.

Stammen Genotype Bron of referentie
S. typhimurium ATCC 14028s wild-type Atcc
TT22236 LT2 salmonella met pTP2223 27
DH5α F φ 80Laczδm15 Δ (Laczya-ARGF) U169 RECa1 eindea1 HSDR17 (rk, mk+) PhoA supE44 λ Thi-1 GYRA96 rela1 28
JAS18077 Putp::AA:: FRT Deze studie
JAS18080 Putp::ad:: FRT Deze studie
JAS18083 Putp::AG:: FRT Deze studie
JAS18088 Putp::al:: FRT Deze studie
JAS18091 Putp::ao:: FRT Deze studie
JAS18096 Putp::bij:: FRT Deze studie
JAS18099 Putp::AW:: FRT Deze studie
JAS18100 Putp::AX:: FRT Deze studie
JAS18122 ΔTkta:: FRT Putp::ad:: FRT Deze studie
JAS18130 ΔTktb:: FRT Putp::al:: FRT Deze studie
JAS18138 ΔTktc:: FRT Putp::bij:: FRT Deze studie
JAS18125 ΔTkta:: FRT Δtktb:: FRT putp::AG:: FRT Deze studie
JAS18133 ΔTkta:: FRT Δtktc:: FRT putp::ao:: FRT Deze studie
JAS18141 ΔTktb:: FRT Δtktc:: FRT putp::AW:: FRT Deze studie
JAS18142 ΔTkta:: FRT δtktb:: FRT δTktc:: FRT Putp::AX:: FRT Deze studie
Plasmiden
pKD13 bla FRT AHP FRT PS1 PS4 oriR6K 14
pPCR script cam SK + ColE1 ori; CmR Stratagene/Aligent
pTP2223 Plac lam bet Exo TetR 16
pCP20 bla Cat cI857 PRFLP pSC101 orits 29
pSKAP ColE1 ori; CmR; bla FRT AHP FRT Deze studie
pSKAP_AA ColE1 ori; CmR; bla FRT AHP FRT; AA Deze studie
pSKAP_AD ColE1 ori; CmR; bla FRT AHP FRT; Advertentie Deze studie
pSKAP_AG ColE1 ori; CmR; bla FRT AHP FRT; AG Deze studie
pSKAP_AL ColE1 ori; CmR; bla FRT AHP FRT; ALE Deze studie
pSKAP_AO ColE1 ori; CmR; bla FRT AHP FRT; Ao Deze studie
pSKAP_AT ColE1 ori; CmR; bla FRT AHP FRT; Tegen Deze studie
pSKAP_AW ColE1 ori; CmR; bla FRT AHP FRT; AW Deze studie
pSKAP_AX ColE1 ori; CmR; bla FRT AHP FRT; AX Deze studie

Tabel 1: stammen en plasmiden die in deze studie worden gebruikt.

Naam Sequentie (5 '-3 ')1, 2, 3
pSKAP SDM AA-F Een van de meest gekken op het bord EEN van de meest GEGE-
pSKAP SDM AA-R Actcaagcaccagcaggagacttct CTCAAGACGTGTAATGCTG
pSKAP SDM AD-F Aagagcacggtgaggtgatagtagg EEN van de meest GEGE-
pSKAP SDM AD-R Cctactatcacctcaccgtgctctt CTCAAGACGTGTAATGCTG
pSKAP SDM AG-F Agtagtgtcctggaggagcatgtga EEN van de meest GEGE-
pSKAP SDM AG-R De door Tcacatgctcctccaggacactact CTCAAGACGTGTAATGCTG
pSKAP SDM AL-F Geaglde , de CTCAAGACGTGTAATGCTG
pSKAP SDM AL-R Een van de meest bezigheid! EEN van de meest GEGE-
pSKAP SDM AO-F Een van de meest gekken CTCAAGACGTGTAATGCTG
pSKAP SDM AO-R Een van de meest gekken. EEN van de meest GEGE-
pSKAP SDM bij-F Een van de meest gekken EEN van de meest GEGE-
pSKAP SDM bij-R Gtctagccatgtcacggacactggt CTCAAGACGTGTAATGCTG
pSKAP SDM AW-F Een van de meest gekken EEN van de meest GEGE-
pSKAP SDM AW-R Cgtcacatccacatcactcagtcgt CTCAAGACGTGTAATGCTG
pSKAP SDM AX-F Een van de meest betacte EEN van de meest GEGE-
pSKAP SDM AX-R Een van de meest gekken CTCAAGACGTGTAATGCTG
M13-F GTAAAACGACGGCCAG
Putp Recombinatie-F TAGCGATGGGAGAGAGGACACGTTAATTATTCCATTTTAA
TGCAGCATTACACGTC
Putp Recombinatie-R Een van de meest GEKKEN van de GEAAKTE
CCTGCAGTTCGAAGTTCC
qPCR-streepjescode regio Amplify-F1 TGCAGCATTACACGTCTTG
qPCR-streepjescode regio Amplify-R2 TAGGAACTTCGAAGCAGC
Barcode AA probe-FAM 6-FAM/AGAAGTCTC/ZEN/CTGCTGGTGCTTGAGTC/IBFQ
Barcode AD probe-FAM 6-FAM/AAGAGCACG/ZEN/GTGAGGTGATAGTAGGC/IBFQ
Barcode AG probe-FAM 6-FAM/AGTAGTGTC/ZEN/CTGGAGGAGCATGTGAC/IBFQ
Barcode AL probe-FAM 6-FAM/AGAGCTAGT/ZEN/GCCTTCGATGTGTGGTC/IBFQ
Barcode AO probe-HEX HEX/AGTATCACT/ZEN/GAGTGTGGTTGTGGACC/IBFQ
Barcode bij probe-HEX HEX/ACCAGTGTC/ZEN/CGTGACATGGCTAGACC/IBFQ
Barcode AW probe-HEX HEX/ACGACTGAG/ZEN/TGATGTGGATGTGACGC/IBFQ
Barcode AX probe-HEX HEX/ACTATCGTG/ZEN/GTGTAACGACAGGCTGC/IBFQ
1 Onderstreepte nucleotiden wijzen op complementaire sequenties voor elke DNA-Barcode die na SDM op pSKAP wordt ingebracht.
2 Dubbel onderstreepte nucleotiden duiden op een complementaire regio op de S. Tyhimurium-chromosoom gebruikt voor allel-vervanging.
3 Primetime qPCR-sondes zijn hybridisatie oligos gelabeld met een 5 ' fluorescerende kleurstof, ofwel 6-carboxyfluorescein (6-fam) of hexachloorloelescein (hex), een interne dorstlesser (Zen), en de 3 ' quencer Iowa Black® FQ (ibfq).

Tabel 2: primers en sondes die in deze studie worden gebruikt.

Kwantificering (kopieën/20μL reactie)
Beschrijving Aa Ad Ag Al Ao Op Aw Ax
Ntc N/a 0,000 0,000 3,510 N/a 0,000 0,000 0,000
Ntc 3,600 0,000 0,000 0,000 0,000 0,000 0,000 0,000
Ntc 3,510 0,000 1,280 1,180 2,340 0,000 0,000 0,000
Ntc 2,290 0,000 0,000 1,200 1,150 1,160 0,000 0,000
Bedoel 3,133 0,000 0,320 1,473 1,163 0,290 0,000 0,000
Negatieve 5,130 1,156 0,000 1,124 3,745 1,281 7,354 7,142
Negatieve 5,270 0,000 0,000 1,087 1,666 1,643 7,746 2,269
Negatieve 2,660 0,000 1,361 1,451 8,974 0,000 N/a 0,000
Negatieve 6,090 0,000 0,000 2,251 0,000 2,531 8,700 3,495
Negatieve 1,740 0,000 1,086 2,130 4,171 0,000 7,113 5,522
Negatieve 6,220 3,581 0,000 4,022 1,175 1,341 N/a 5,950
Bedoel 4,518 0,789 0,408 2,011 3,288 1,133 7,728 4,063
Positieve 22281,540 42673,039 46442,242 45359,180 47885,625 15708,027 45325,906 20810,559
Positieve 23989,676 44625,523 47356,438 45790,660 47456,973 15096,601 47929,840 22455,234
Positieve 17846,824 38980,133 45633,809 44174,820 33875,039 15156,063 42536,270 21467,840
Positieve 21047,588 40140,848 41672,648 46028,496 47426,527 16718,000 46978,664 19876,473
Positieve 20218,238 44660,602 41718,707 45799,375 46495,602 14590,264 54741,023 22011,938
Positieve 18531,740 41620,801 N/a 48082,313 35645,199 15341,382 48950,992 21117,559
Bedoel 20652,601 42116,824 44564,769 45872,474 43130,827 15435,056 47743,783 21289,934
Lege aftrekken 20648,083 42116,035 44564,361 45870,463 43127,539 15433,923 47736,054 21285,871
Onverdund A 23024,961 44448,875 58897,510 51120,948 55450,191 18155,305 62844,068 27567,828
Onverdund B 18278,174 35252,586 54409,510 66022,396 43101,148 15732,609 60761,328 26581,979
1/50 een 521,670 755,035 1066,898 1287,187 1053,339 181,324 1278,336 580,961
1/50 B 435,326 634,215 1168,087 1383,537 991,040 165,443 1180,445 596,461
1/100 een 228,028 598,848 603,911 631,116 507,956 258,405 665,647 331,590
1/100 B 256,330 585,834 583,325 670,875 459,325 289,207 638,916 307,948
1/200 een 121,283 305,293 258,247 346,965 234,774 114,163 169,055 172,553
1/200 B 114,638 313,040 253,685 297,216 191,637 179,895 280,989 147,297
1/400 een 42,829 141,343 127,337 163,605 N/a 71,241 157,697 85,976
1/400 B 59,544 180,543 162,080 162,108 115,508 104,682 151,141 87,804
1/800 een 34,304 67,934 65,939 83,857 66,134 31,784 82,722 45,616
1/800 B 20,390 80,222 81,453 85,325 53,102 38,034 55,460 29,660
1/1600 een 15,405 44,505 47,672 39,613 33,027 18,006 37,655 20,988
1/1600 B 22,091 48,828 46,781 37,388 30,245 30,138 34,553 19,795
1/3200 een 12,333 22,104 16,850 18,403 11,460 10,535 21,245 9,218
1/3200 B 6,796 32,555 15,742 26,249 15,111 9,908 23,393 10,175
Lege aftrekken
Onverdund A 23020,443 44448,086 58897,103 51118,937 55446,903 18154,172 62836,339 27563,765
Onverdund B 18273,655 35251,797 54409,103 66020,385 43097,860 15731,477 60753,600 26577,916
1/50 een 517,152 754,246 1066,490 1285,176 1050,051 180,192 1270,607 576,898
1/50 B 430,808 633,426 1167,679 1381,526 987,751 164,311 1172,717 592,398
1/100 een 223,509 598,059 603,503 629,105 504,668 257,272 657,918 327,527
1/100 B 251,812 585,044 582,918 668,864 456,036 288,074 631,187 303,885
1/200 een 116,765 304,503 257,840 344,954 231,486 113,030 161,327 168,490
1/200 B 110,120 312,251 253,277 295,205 188,348 178,762 273,261 143,234
1/400 een 38,310 140,554 126,929 161,594 N/a 70,108 149,968 81,913
1/400 B 55,026 179,753 161,672 160,097 112,219 103,549 143,413 83,741
1/800 een 29,786 67,145 65,531 81,847 62,846 30,651 74,994 41,553
1/800 B 15,872 79,433 81,045 83,314 49,813 36,901 47,732 25,596
1/1600 een 10,886 43,716 47,264 37,602 29,739 16,874 29,927 16,925
1/1600 B 17,573 48,039 46,373 35,377 26,957 29,005 26,825 15,732
1/3200 een 7,815 21,314 16,442 16,392 8,172 9,402 13,517 5,155
1/3200 B 2,278 31,765 15,334 24,238 11,822 8,776 15,664 6,112
Gesimuleerde CI
Onverdund A 1,114895 1,055372 1,321619 1,114419 1,285650 1,176251 1,316329 1,294932
Onverdund B 0,885005 0,837016 1,220911 1,439279 0,999312 1,019279 1,272698 1,248618
1/50 een 0,025046 0,017909 0,023931 0,028018 0,024348 0,011675 0,026617 0,027102
1/50 B 0,020864 0,015040 0,026202 0,030118 0,022903 0,010646 0,024567 0,027831
1/100 een 0,010825 0,014200 0,013542 0,013715 0,011702 0,016669 0,013782 0,015387
1/100 B 0,012195 0,013891 0,013080 0,014582 0,010574 0,018665 0,013222 0,014276
1/200 een 0,005655 0,007230 0,005786 0,007520 0,005367 0,007323 0,003380 0,007916
1/200 B 0,005333 0,007414 0,005683 0,006436 0,004367 0,011582 0,005724 0,006729
1/400 een 0,001855 0,003337 0,002848 0,003523 N/a 0,004542 0,003142 0,003848
1/400 B 0,002665 0,004268 0,003628 0,003490 0,002602 0,006709 0,003004 0,003934
1/800 een 0,001443 0,001594 0,001470 0,001784 0,001457 0,001986 0,001571 0,001952
1/800 B 0,000769 0,001886 0,001819 0,001816 0,001155 0,002391 0,001000 0,001203
1/1600 A 0,000527 0,001038 0,001061 0,000820 0,000690 0,001093 0,000627 0,000795
1/1600 B 0,000851 0,001141 0,001041 0,000771 0,000625 0,001879 0,000562 0,000739
1/3200 A 0,000378 0,000506 0,000369 0,000357 0,000189 0,000609 0,000283 0,000242
1/3200 B 0,000110 0,000754 0,000344 0,000528 0,000274 0,000569 0,000328 0,000287
Gemiddelde CI (theoretisch)
Onverdund (1) 0,999950 0,946194 1,271265 1,276849 1,142481 1,097765 1,294514 1,271775
1/50 (0,02) 0,022955 0,016474 0,025067 0,029068 0,023625 0,011161 0,025592 0,027466
1/100 (0,01) 0,011510 0,014046 0,013311 0,014148 0,011138 0,017667 0,013502 0,014832
1/200 (0,005) 0,005494 0,007322 0,005735 0,006978 0,004867 0,009453 0,004552 0,007322
1/400 (0,0025) 0,002260 0,003803 0,003238 0,003507 0,00260 * 0,005626 0,003073 0,003891
1/800 (0,00125) 0,001106 0,001740 0,001645 0,001800 0,001306 0,002188 0,001285 0,001577
1/1600 (0,000625) 0,000689 0,001089 0,001051 0,000795 0,000657 0,001486 0,000594 0,000767
1/3200 (0,000313) 0,000244 0,000630 0,000357 0,000443 0,000232 0,000589 0,000306 0,000265
Standaarddeviatie
Onverdund 0,11494 0,10918 0,05035 0,16243 0,14317 0,07849 0,02182 0,02316
1/50 0,00209 0,00143 0,00114 0,00105 0,00072 0,00051 0,00103 0,00036
1/100 0,00069 0,00015 0,00023 0,00043 0,00056 0,00100 0,00028 0,00056
1/200 0,00016 0,00009 0,00005 0,00054 0,00050 0,00213 0,00117 0,00059
1/400 0,00040 0,00047 0,00039 0,00002 0 0,00108 0,00007 0,00004
1/800 0,00034 0,00015 0,00017 0,00002 0,00015 0,00020 0,00029 0,00037
1/1600 0,00016 0,00005 0,00001 0,00002 0,00003 0,00039 0,00003 0,00003
1/3200 0,00013 0,00012 0,00001 0,00009 0,00004 0,00002 0,00002 0,00002
* Vertegenwoordigt resultaten van één experiment.

Tabel 3: absolute kwantificering en gesimuleerde CI-berekening.

Voorwaarde Concurrerende index1
Experiment 1
WTAA WTad WTAG WTal WTao WTbij WTAW WTAX
Logaritmische 0,927 ± 0,033 0,992 ± 0,031 1,068 ± 0,025 0,921 ± 0,02 1,044 ± 0,03 1,051 ± 0,057 1,094 ± 0,027 0,929 ± 0,005
Stationaire 1,1 ± 0,021 1,071 ± 0,053 1,079 ± 0,065 0,948 ± 0,02 0,98 ± 0,02 0,873 ± 0,044 0,97 ± 0,056 1,021 ± 0,007
Experiment 2
CI (traditioneel) WTAA ΔAad ΔBal ΔCbij ΔABAG ΔACao ΔBCAW ΔABCAX
Logaritmische 1 ± 0 0,802 ± 0,084 0,957 ± 0,02 0,989 ± 0,073 0,581 ± 0,153 0,86 ± 0,053 0,995 ± 0,011 0,695 ± 0,061
Stationaire 1 ± 0 0,97 ± 0,063 1,043 ± 0,058 0,99 ± 0,036 1,625 ± 0,589 0,835 ± 0,051 0,912 ± 0,047 0,477 ± 0,049
CI (gegroepeerd entmateriaal)
Logaritmische 1,114 ± 0,039 0,864 ± 0,074 1,073 ± 0,032 1,1 ± 0,068 0,633 ± 0,152 0,938 ± 0,056 1,111 ± 0,043 0,746 ± 0,06
Stationaire 1,078 ± 0,039 1,039 ± 0,049 1,166 ± 0,093 1,066 ± 0,01 1,735 ± 0,613 0,876 ± 0,035 0,97 ± 0,045 0,49 ± 0,047
1 Waarden vertegenwoordigen gemiddelde CI ± standaarddeviatie voor drie of vier replicaatexperimenten.

Tabel 4: representatieve resultaten van in-vitro-concurrentie tussen S. Typhimurium stammen.

Tabel S1. Optionele primers voor het maken van extra barcode sequenties en bijbehorende fluorescentie sondes voor hun detectie. Klik hier om dit bestand te downloaden.

Figure 1
Figuur 1. Generatie van pSKAP. A) gezuiverde pKD13 werd onderworpen aan een beperking van de spijsvertering met HindIII en bamhi. (B, C) De 1.333 BP fragment van belang dat een FRT-geflankeerd kanamycine resistentie-gen bevat, werd gezuiverd. (D) Ppcr script cam SK + werd ook verteerd met HindIII en bamhi en het fragment uit PKD13 (B) werd geligeerd om (E) pskap te genereren. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Figuur 2: doorsnede van de door de plaats geleide mutagenese aan pSKAP. A) het inbrengen van 25 BP DNA-barcodes op positie 725 werd uitgevoerd met behulp van PCR. Forward en reverse primers specifiek voor die locatie zijn ontworpen met complementaire 25-nucleotide 5 ' extensies (aangeduid in de primer als kleine letters "a"). B) een generieke pSKAP_Barcode plasmide als gevolg van SDM wordt weergegeven met de locatie van de ingevoegde DNA-streepjescode oranje gemarkeerd. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 3
Figuur 3: chromosomale omlegging stroomafwaarts van Putp. A) na λ-rode gemedieerde recombinatie wordt het te selecteren kanamycine resistentie-gen (donker paars) geflankeerd door FRT-plaatsen (grijs) ingevoegd op het chromosoom tussen de aangegeven loci (chromosomale recombinatie plaats, rood). De unieke DNA Barcode (oranje) wordt net buiten de FRT plaats geplaatst. B) het kanamycine-resistentie-gen wordt verwijderd door FRT-gemedieerde excisie, waarbij een restant van ingebracht DNA op het chromosoom (totaal ingebracht DNA, blauw) dat bestaat uit de DNA-streepjescode en een FRT litteken. C) de gemodificeerde chromosomale DNA-sequentie rond het ingevoegde DNA wordt getoond, samen met de versterkings plaatsen (licht paars) die worden gebruikt voor digitale PCR. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 4
Figuur 4: verdunnings schema voor het valideren van de gevoeligheid en specificiteit van de fluorescentie sonde. A) gezuiverde gdna uit zeven bargecodeerde stammen worden in gelijke hoeveelheden met elkaar vermengd om het verdunningsmiddel te creëren voor het verdunen van de weggelaten met gdna (AX in het bovenstaande voorbeeld). B) Voer een seriële verdunning uit van de weggelaten met gdna (AX in het bovenstaande voorbeeld) met behulp van het eerder beschreven verdunningsmiddel. Meng de inhoud van elke buis grondig voordat u de volgende buis overbrengt. Figuur 4 is gemaakt met BioRender. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 5
Afbeelding 5: plaat indeling voor het analyseren van de gevoeligheid en specificiteit van de primer-probe-sets 1 en 2. Het digitale PCR-experiment omvat Ntc's, positieve controles, negatieve controles en de verdunnings schema's voor elk van de geteste barcodes. De plaat voor het valideren van de primer-probe-sets 3 en 4 wordt in hetzelfde patroon ingedeeld met behulp van de juiste barcode gDNA. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 6
Figuur 6: representatieve digitale PCR-resultaten van VERDUNDE AA-Barcoded gDNA. gdna met de AA-streepjescode werd verdund in een achtergrond van alle andere met gdna zoals beschreven in Figuur 4. Kanaal 1 staat voor de FAM-sonde voor de AA-streepjescode (bovenste deelvensters) terwijl kanaal 2 de HEX-sonde voor de AO-streepjescode (onderste deelvensters) vertegenwoordigt. De resultaten van elke sonde worden gepresenteerd als zowel individuele druppel fluorescentie amplitude (linkerpanelen) als een histogram dat de frequentie van de fluorescerende intensiteit van alle druppels in de geselecteerde putjes (rechter panelen) weergeeft. Voor elke aandoening moeten positieve (hoge fluorescentie) en negatieve (lage fluorescentie) druppeltjes twee verschillende populaties vormen. In het geval van AA die werd verdund, en de meeste druppels waren negatief, het histogram (rechtsboven paneel) lijkt slechts een enkele populatie weer te geven. Dit komt omdat positieve druppels aanzienlijk worden overtroffen door negatieve druppels; echter, twee verschillende populaties zijn nog steeds zichtbaar door het onderzoeken van druppel fluorescerende amplitude in de linker panelen.  De populaties moeten worden gescheiden met behulp van de drempel functie om positieve en negatieve druppels te definiëren (gevisualiseerd door de roze lijn). Drempelwaarden zijn afhankelijk van de tests die zijn gebruikt, maar alle putjes die gebruikmaken van dezelfde testmix moeten identieke drempels hebben. Omdat de AA-Barcoded gDNA werd verdund, is er een afname van positieve (hoog fluorescerende) druppeltjes, terwijl het aantal positieve AO druppeltjes constant op de achtergrond blijft. Klik hier om een grotere versie van dit cijfer te bekijken.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Het vermogen om micro-organismen nauwkeurig te kwantificeren is van het allergrootste belang voor microbiologie onderzoek, en het vermogen om unieke stammen van een eerste gemengde populatie te inventariseren is een waardevol instrument gebleken voor het beoordelen van de eigenschappen van fitness en virulentie in Bacteriën. De technieken om dit te verwezenlijken zijn echter niet in tempo gevorderd met de moderne ontwikkelingen in de moleculaire biologie. De technologie om de chromosomen van vele bacteriën gemakkelijk aan te passen, waaronder S. Typhimurium, is beschikbaar voor bijna twee decennia14, maar dit vermogen is zelden gebruikt voor moleculair tagging stammen met unieke DNA-sequenties. Door het benutten van de mogelijkheid om gemakkelijk identificeerbare stammen te creëren op basis van unieke, minimaal verstorende DNA-barcodes die op het bacteriële chromosoom zijn ingebracht, in combinatie met de meest State-of-the-art technologie om deze moleculaire identificatoren te detecteren en te kwantificeren ( d.w.z. digitale PCR), hebben we een systeem gecreëerd dat een uitstekende gevoeligheid, specificiteit, nauwkeurigheid en precisie biedt voor het eenvoudig kwantificeren van individuele stammen binnen een gevarieerde populatie bacteriën.

Het berekenen van CIs en COIs, zoals hierboven beschreven, berust op de mogelijkheid om nauwkeurig de juiste wijzigingen aan bacteriële chromosomen te maken. Alle wijzigingen moeten worden geverifieerd door Sanger-sequencing om ervoor te zorgen dat er geen willekeurige mutaties hebben plaatsgevonden. Het gebruik van een high-fidelity polymerase zal deze fouten minimaliseren, maar dergelijke mutaties die zich voordoen, zullen het vermogen om de stam te detecteren aantasten, wat een ander kritisch aspect van dit protocol is. Hoewel we hebben aangetoond dat digitale PCR maar liefst twee gDNA-kopieën kan detecteren op een achtergrond van bijna 2.000.000, kunnen stammen buiten dit bereik extra verdunningen vereisen voor hun nauwkeurige kwantificering. Bovendien moeten DNA-Barcode sequenties worden ontworpen om het gebruik van kwalitatief hoogwaardige sonde sequenties te vergemakkelijken. Sonde sequenties moeten worden geanalyseerd voor tendensen om zelf te dimeriseren, vormen haarspelden, of ineffectief binden hun doelen. Het belang van het gebruik van kwaliteits sequenties en sondes kan niet worden geminimaliseerd, een feit dat wordt bewezen door de zorgvuldige validatie experimenten die moeten worden uitgevoerd met elke sonde. Inspanningen om optimale DNA-barcodes te creëren zullen optimale digitale PCR-kwantificerings resultaten creëren.

Hoewel zorgvuldig ontworpen moleculaire Tags belangrijk zijn voor het verkrijgen van kwaliteitsresultaten, is het interpreteren van de resultaten een ander kritisch aspect van dit protocol. De CI wordt gedefinieerd als de verhouding tussen de Mutante stam en de wild-type stam in de output gedeeld door de verhouding van de twee stammen in de ingang1,19,20. Deze traditionele CI in rubriek 9 is nuttig wanneer de gemengde infectie bestaat uit slechts één stam versus wild type. Echter, bij het gebruik van grote Pools van stammen te beënten media of dieren, stammen zijn niet alleen concurreren tegen wild-type, maar ook tegen elke andere stam aanwezig in het entmateriaal. Eerdere studies die competitie experimenten uitgevoerd met behulp van meerdere infecterende stammen hebben nagelaten om dit in aanmerking te nemen in hun berekeningen7,13. Om rekening te kunnen maken met deze functie van gemengde infecties, hebben we een formule geïntroduceerd om CIs te berekenen die zijn aangepast voor gepoolde infecties. Het is onwaarschijnlijk dat alle stammen hetzelfde concurrentieniveau zullen bieden als een wild type stam. Echter, omdat de meeste bacteriële genen hebben weinig invloed op virulentie, als het aantal stammen gebruikt in competitieve index experiment toeneemt, de kans dat de algehele virulentie zal de neiging om de wild-type stam toeneemt. Dit kan niet noodzakelijkerwijs het geval zijn voor bepaalde experimentele ontwerpen met behulp van zwembaden van vele stammen allemaal met bekende virulentie gebreken. Dit wordt echter verantwoord in de gewijzigde vergelijking, omdat minder overvloedige stammen (minder Fit) in het resultaat een kleiner effect op X-uitvoerzullen hebben. Afhankelijk van het specifieke experimentele ontwerp, kunnen er gevallen zijn waarin een of de andere formule de voorkeur heeft. In de meeste gevallen waarbij gepoolde infecties, echter, het is belangrijk om te overwegen dat in een gemengde infectie, alle stammen concurreren tegen elkaar, niet alleen tegen wild-type. Bij het analyseren van de resultaten is het van cruciaal belang dat de logica achter elke formule goed wordt begrepen om de meest accurate interpretaties van strain fitness te maken. Bij het rapporteren van resultaten is het even belangrijk om nauwkeurig te onthullen hoe gegevens werden geanalyseerd.

Sectie 9 van het protocol bevat ook formules om te helpen bij het bepalen van geninteracties met behulp van een COI. Met deze analyse kunnen voorspellingen worden gedaan om te bepalen of twee virulentie genen zelfstandig of samenwerken. COI wordt gedefinieerd als de verhouding tussen de dubbele Mutant en de enkelvoudige Mutante stam in de output gedeeld door de verhouding van de twee stammen in de ingang1. De formule is ontworpen om fenotypische additiviteit van genverstoringen op te sporen. Als genen onafhankelijk functioneren om virulentie te verbeteren, zou een verstoring van beide genen een grotere afname van de conditie moeten veroorzaken in vergelijking met een enkele verstoring van ofwel gen alleen. Als genen samenwerken om virulentie te verbeteren (zoals genen die twee enzymen in een traject coderen), zou een verstoring van ofwel gen hetzelfde effect op virulentie moeten hebben als het verstoren van beide genen. Het opsporen van fenotypische additiviteit kan moeilijk zijn in gevallen waarin het niveau van verzwakking veroorzaakt door een enkel gen zeer hoog of zeer laag is. Niettemin biedt directe vergelijking van stammen binnen hetzelfde dier systeem minder variabiliteit en een betrouwbaardere rekening van de functionele relatie tussen genen, en deze berekening kan worden uitgevoerd vanuit twee stammen binnen een grotere gemengde populatie.

Een laatste kritisch aspect voor het interpreteren van de resultaten is om de effecten van de populatiedynamiek te overwegen. In sommige gemengde infecties die meerdere stammen hebben, een enkele stam kan ontstaan als ofwel meer dominant of minder Fit vanwege willekeurige populatie drift. Dit fenomeen kan worden versterkt wanneer knelpunt gebeurtenissen optreden. Dit kan worden veroorzaakt door het gebruik van een zeer groot aantal ingangs stammen, een zeer klein aantal totale bacteriën in het entmateriaal, of een combinatie van beide. Een ander interfereren aspect dat voortvloeit uit gemengde infecties is de mogelijkheid van in de trans-complementatie. Dit gebeurt wanneer een fit stam, zoals het wild-type, kunstmatig verbetert de virulentie van een minder Fit stam. Een hypothetisch voorbeeld hiervan is het vergelijken van de geschiktheid van een S. Pathogeniteit van tyhimurium eiland 2 (SPI2)-Knockout stam met gelijktijdige besmetting met een wild type stam. SPI2 stelt S. Typhimurium om intracellulair te overleven door Effectors te scheiden in de gastheer cytosol die de fagosome binnen een macrofaag wijzigt. Verstoring van dit systeem maakt S. Tyhimurium vatbaar voor intracellulaire moord. Echter, omdat macrofagen in staat zijn om twee of meer bacteriën tegelijk te overspoelt, kan de SPI2-Knockout een aanzienlijke toename van de geschiktheid krijgen als deze in dezelfde macrofaag als een wild-type Sverblijft.  Typhimurium dat is afscheidende Effectors in de gastheer cytosol. Willekeurige bevolkings dynamiek en de mogelijkheid van in trans-complementatie is een beperking van een vergelijkend experiment. Als in de trans -complementatie wordt vermoed, moeten fenotypes worden bevestigd met behulp van andere complementaire methoden om de geschiktheid te beoordelen. Om willekeurige populatiedynamiek te overwinnen, verhoogt het aantal replicaatexperimenten de kans op het identificeren van uitschieters in resultaten. Gelukkig maakt het hierboven beschreven protocol het gemakkelijker om een groter aantal identieke replicaatexperimenten te hebben, omdat het aantal experimentele omstandigheden drastisch wordt verlaagd.

Een belangrijk element van de hierboven beschreven CI-techniek is het vermogen om te worden aangepast aan bijna elk organisme en elk experimenteel ontwerp dat nauwkeurige kwantificering van micro-organismen vereist. Het vereist echter de genetische manipulatie van een organisme om een unieke DNA-sequentie op het chromosoom op te nemen. Het aanpassingsvermogen van de techniek vereist dat de soort genetisch smeedbaar is en zal vertrouwen op het genereren van alternatieve protocollen voor het wijzigen van het genoom (stap 1 en 2). De in tabel 2 en S1 vermelde DNA-barcodes moeten voldoende zijn voor de meeste bacteriën; zoals in alle kwantitatieve PCR-experimenten is het echter relevant om het bacteriële genoom te analyseren om een minimaal potentieel voor het binden van primers en sondes te voorkomen door een eenvoudige BLAST-analyse. De DNA Barcode sequenties gebruikt in deze studie verschillen door slechts 3-4 basissen in sommige gevallen, het benadrukken van de exquise specificiteit van de sondes die het potentieel voor niet-specifieke binding minimaliseert. Ongeacht de specificiteit van de fluorescerende sondes, moeten alle nieuwe streepjescode sequenties op passende wijze worden gevalideerd voor gevoeligheid en specificiteit zoals beschreven in stap 6. Na het creëren van met stammen, is het mogelijk om dit protocol aan te passen aan vele soorten experimenten naast in vitro competitie testen zoals hierboven beschreven. De stammen zijn geschikt voor in vivo competitie testen in muizen of andere diermodel systemen. Alleen minimale wijzigingen zijn vereist om gDNA uit dierlijke organen en weefsels te extraheren, en deze wijzigingen worden goed beschreven door fabrikanten van kits voor dergelijke doeleinden. Verder, grote Pools van gemengde infecties voor in vivo competitie zijn met succes gebruikt eerder7, het aanbieden van het potentieel om het aantal dieren nodig voor een enkel experiment te verminderen, die niet alleen verlaagt de kosten van die experimenten maar vermindert ook het potentieel voor de variabiliteit van dieren naar dieren. Evenzo kunnen met stammen worden gebruikt in andere in vitro testen die de gevoeligheid van stammen voor verschillende behandelings condities onderzoeken (bijv. antibiotica, zure gevoeligheid, doden door reactieve zuurstof of stikstof soorten, enz.). Voor deze experimenten, beoordeling van remming van de groei kan worden bereikt door de gewenste chemische stof toe te voegen aan het groeimedium in stap 3,4 en verder te gaan zoals beschreven. Om de bacteriële dood te beoordelen, kan een grote pool van stammen worden gemengd, en de input gekwantificeerd zoals hierboven beschreven. Na blootstelling aan de gewenste behandeling kunnen de levende cellen selectief worden gekwantificeerd door de digitale PCR-kwantificerings procedure te koppelen aan een leefbaarheids PCR om onderscheid te maken tussen levende en dode cellen21,22,23 , 24 , 25 , 26. de doorvoer voor dergelijke experimenten zou drastisch toenemen, omdat verdunningen en replica platen voor elke stam worden vervangen door meer gestroomlijnde moleculaire technieken. Tot slot, hoewel het analyseren van evolutionaire biologie en populatiegenetica buiten de reikwijdte van dit papier valt, zijn bargecodeerde organismen zeer aanpasbaar voor dergelijke studies.  Uiteindelijk was het doel van dit protocol om een krachtige techniek te ontwikkelen voor het kwantificeren van bacteriën die zeer aanpasbaar zijn voor het gebruik ervan in vele verschillende soorten en in vele soorten experimenten.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Het onderzoek dat in deze uitgave werd gerapporteerd, werd gesteund door het onderzoeksfonds George F. Haddix president en het National Institute of General Medical Science van de National Institutes of Health (NIH) onder het awardnummer GM103427. De inhoud is uitsluitend de verantwoordelijkheid van de auteurs en vertegenwoordigt niet noodzakelijkerwijs de officiële standpunten van de National Institutes of Health.

Materials

Name Company Catalog Number Comments
1.5 mL microcentrifuge tubes Eppendorf 22600028 Procure from any manufacturer
16 mL culture tubes MidSci 8599 Procure from any manufacturer
5-200 μL pipette tips RAININ 30389241 Procure alternative tip brands with caution based on manufacturing quality
5-50 μL multichannel pipette RAININ 17013804 Use alternative multichannel pipettes with caution
Agarose ThermoFisher Scientific BP160-500 Procure from any manufacturer
BLAST Analysis NCBI N/A https://blast.ncbi.nlm.nih.gov/Blast.cgi
C1000 Touch Thermocycler with 96-Deep Well Reaction Module Bio Rad 1851197 Must procure ddPCR supplies from Bio Rad. Alternatives are not yet available.
Chemically competent DH5α Invitrogen 18258012 Procure from any manufacturer or prepare yourself
Chloramphenicol ThermoFisher Scientific BP904-100 Procure from any manufacturer
Cytation5 Microplate reader BioTek CYT5MF Procure from any manufacturer, use any system capable of accurately quantifying DNA
Data Analysis Software (QuantaSoft and QuantaSoft Data Analysis Pro) Bio Rad N/A Must procure ddPCR supplies from Bio Rad. Alternatives are not yet available.
ddPCR 96-Well Plates Bio Rad 12001925 Must procure ddPCR supplies from Bio Rad. Alternatives are not yet available.
ddPCR Droplet Reader Oil Bio Rad 1863004 Must procure ddPCR supplies from Bio Rad. Alternatives are not yet available.
ddPCR Supermix for Probes (No dUTP) Bio Rad 1863024 Must procure ddPCR supplies from Bio Rad. Alternatives are not yet available.
DG8 Cartridges for QX200/QX100 Droplet Generator Bio Rad 1864008 Must procure ddPCR supplies from Bio Rad. Alternatives are not yet available.
DG8 Gaskets for QX200/QX100 Droplet Generator Bio Rad 1863009 Must procure ddPCR supplies from Bio Rad. Alternatives are not yet available.
Droplet Generation Oil for Probes Bio Rad 1863005 Must procure ddPCR supplies from Bio Rad. Alternatives are not yet available.
Kanamycin ThermoFisher Scientific BP906-5 Procure from any manufacturer
Luria-Bertani agar ThermoFisher Scientific BP1425-2 Procure from any manufacturer or make it yourself from agar, tryptone, yeast digest, and NaCl
Luria-Bertani broth ThermoFisher Scientific BP1426-2 Procure from any manufacturer or make it yourself from tryptone, yeast digest, and NaCl
PCR Plate Heat Seal, foil, pierceable Bio Rad 1814040 Must procure ddPCR supplies from Bio Rad. Alternatives are not yet available.
PCR Tubes Eppendorf 951010022 Procure from any manufacturer
Petri dishes ThermoFisher Scientific FB0875712 Procure from any manufacturer
pPCR Script Cam SK+ Stratagene/Agilent 211192 No longer available commercially
Primer/Probe Design IDT N/A https://www.idtdna.com/Primerquest/Home/Index
pSKAP and pSKAP_Barcodes Addgene Plasmid numbers 122702-122726 www.addgene.org
PX1 PCR Plate Sealer Bio Rad 1814000 Must procure ddPCR supplies from Bio Rad. Alternatives are not yet available.
QX200 Droplet Generator Bio Rad 1864002 Must procure ddPCR supplies from Bio Rad. Alternatives are not yet available.
QX200 Droplet Reader Bio Rad 1864003 Must procure ddPCR supplies from Bio Rad. Alternatives are not yet available.
Salmonella typhimurium strain ATCC 14028s ATCC ATCC 14028s www.atcc.org
Take3 Micro-Volume Plate BioTek TAKE3 Procure from any manufacturer, use any system capable of accurately quantifying DNA
Thermo Scientific FastDigest BamHI ThermoFisher Scientific FERFD0054 Procure from any manufacturer
Thermo Scientific FastDigest DpnI ThermoFisher Scientific FERFD1704 Procure from any manufacturer
Thermo Scientific FastDigest HindIII ThermoFisher Scientific FERFD0504 Procure from any manufacturer
Thermo Scientific GeneJet Gel Extraction and DNA Cleanup Micro Kit ThermoFisher Scientific FERK0832 Procure from any manufacturer
Thermo Scientific GeneJet Miniprep Kit ThermoFisher Scientific FERK0503 Procure from any manufacturer
Thermo Scientific Phusion High-Fidelity DNA Polymerase ThermoFisher Scientific F534L Procure from any manufacturer
Thermo Scientific T4 DNA Ligase ThermoFisher Scientific FEREL0011 Procure from any manufacturer
Thermocycler Bio Rad 1861096 Procure from any manufacturer
UVP Visi-Blue Transilluminator ThermoFisher Scientific UV95043301 Or other transiluminator that allows visualization of DNA
Water, Molecular Biology Grade ThermoFisher Scientific BP28191 Procure from any manufacturer

DOWNLOAD MATERIALS LIST

References

  1. Beuzón, C. R., Holden, D. W. Use of mixed infections with Salmonella strains to study virulence genes and their interactions in vivo. Microbes and Infection. 3, (14-15), 1345-1352 (2001).
  2. Bäumler, A. J., Tsolis, R. M., Valentine, P. J., Ficht, T. A., Heffron, F. Synergistic effect of mutations in invA and lpfC on the ability of Salmonella typhimurium to cause murine typhoid. Infection and Immunity. 65, (6), 2254-2259 (1997).
  3. Vital, M., Hammes, F., Egli, T. Competition of Escherichia coli O157 with a drinking water bacterial community at low nutrient concentrations. Water Research. 46, (19), 6279-6290 (2012).
  4. Schellenberg, J., Smoragiewicz, W., Karska-Wysocki, B. A rapid method combining immunofluorescence and flow cytometry for improved understanding of competitive interactions between lactic acid bacteria (LAB) and methicillin-resistant S. aureus (MRSA) in mixed culture. Journal of Microbiological Methods. 65, (1), 1-9 (2006).
  5. Becker, D., et al. Robust Salmonella metabolism limits possibilities for new antimicrobials. Nature. 440, (7082), 303 (2006).
  6. Rang, C., Galen, J. E., Kaper, J. B., Chao, L. Fitness cost of the green fluorescent protein in gastrointestinal bacteria. Canadian Journal of Microbiology. 49, (9), 531-537 (2003).
  7. Santiviago, C. A., et al. Analysis of pools of targeted Salmonella deletion mutants identifies novel genes affecting fitness during competitive infection in mice. PLoS Pathogens. 5, (7), e1000477 (2009).
  8. Ahmer, B. M., Gunn, J. S. Interaction of Salmonella spp. with the intestinal microbiota. Frontiers in Microbiology. 2, 101 (2011).
  9. Gallagher, L. A., Shendure, J., Manoil, C. Genome-scale identification of resistance functions in Pseudomonas aeruginosa using Tn-seq. MBio. 2, (1), (2011).
  10. Van Opijnen, T., Bodi, K. L., Camilli, A. Tn-seq: high-throughput parallel sequencing for fitness and genetic interaction studies in microorganisms. Nature Methods. 6, (10), 767 (2009).
  11. van Opijnen, T., Lazinski, D. W., Camilli, A. Genome‐wide fitness and genetic interactions determined by Tn‐seq, a high‐throughput massively parallel sequencing method for microorganisms. Current Protocols in Microbiology. 36, (1), (2017).
  12. Mutalik, V. K., et al. Dual-barcoded shotgun expression library sequencing for high-throughput characterization of functional traits in bacteria. Nature Communications. 10, (1), 308 (2019).
  13. Yoon, H., Gros, P., Heffron, F. Quantitative PCR-based competitive index for high-throughput screening of Salmonella virulence factors. Infection and Immunity. 79, (1), 360-368 (2011).
  14. Datsenko, K. A., Wanner, B. L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proceedings of the National Academy of Sciences. 97, (12), 6640-6645 (2000).
  15. Henard, C. A., Bourret, T. J., Song, M., Vázquez-Torres, A. Control of redox balance by the stringent response regulatory protein promotes antioxidant defenses of Salmonella. Journal of Biological Chemistry. 285, (47), 36785-36793 (2010).
  16. Poteete, A. R., Fenton, A. C. λ red-dependent growth and recombination of phage P22. Virology. 134, (1), 161-167 (1984).
  17. McCollister, B. D., Bourret, T. J., Gill, R., Jones-Carson, J., Vázquez-Torres, A. Repression of SPI2 transcription by nitric oxide-producing, IFNγ-activated macrophages promotes maturation of Salmonella phagosomes. Journal of Experimental Medicine. 202, (5), 625-635 (2005).
  18. Shaw, J. A., et al. Salmonella enterica serovar Typhimurium has three transketolase enzymes contributing to the pentose phosphate pathway. Journal of Biological Chemistry. 293, (29), 11271-11282 (2018).
  19. Freter, R., O'Brien, P., Macsai, M. S. Role of chemotaxis in the association of motile bacteria with intestinal mucosa: in vivo studies. Infection and immunity. 34, (1), 234-240 (1981).
  20. Taylor, R. K., Miller, V. L., Furlong, D. B., Mekalanos, J. J. Use of phoA gene fusions to identify a pilus colonization factor coordinately regulated with cholera toxin. Proceedings of the National Academy of Sciences. 84, (9), 2833-2837 (1987).
  21. Nogva, H. K., Dromtorp, S., Nissen, H., Rudi, K. Ethidium monoazide for DNA-based differentiation of viable and dead bacteria by 5'-nuclease PCR. Biotechniques. 34, (4), 804-813 (2003).
  22. Nocker, A., Camper, A. K. Novel approaches toward preferential detection of viable cells using nucleic acid amplification techniques. FEMS Microbiology Letters. 291, (2), 137-142 (2009).
  23. Nocker, A., Cheung, C. -Y., Camper, A. K. Comparison of propidium monoazide with ethidium monoazide for differentiation of live vs. dead bacteria by selective removal of DNA from dead cells. Journal of Microbiological Methods. 67, (2), 310-320 (2006).
  24. Nocker, A., Mazza, A., Masson, L., Camper, A. K., Brousseau, R. Selective detection of live bacteria combining propidium monoazide sample treatment with microarray technology. Journal of Microbiological Methods. 76, (3), 253-261 (2009).
  25. Nocker, A., Sossa, K. E., Camper, A. K. Molecular monitoring of disinfection efficacy using propidium monoazide in combination with quantitative PCR. Journal of Microbiological Methods. 70, (2), 252-260 (2007).
  26. Nocker, A., Sossa-Fernandez, P., Burr, M. D., Camper, A. K. Use of propidium monoazide for live/dead distinction in microbial ecology. Applied and Environmental Microbiology. 73, (16), 5111-5117 (2007).
  27. Price-Carter, M., Tingey, J., Bobik, T. A., Roth, J. R. The Alternative Electron Acceptor Tetrathionate Supports B12-Dependent Anaerobic Growth ofSalmonella enterica Serovar Typhimurium on Ethanolamine or 1, 2-Propanediol. Journal of Bacteriology. 183, (8), 2463-2475 (2001).
  28. Taylor, R. G., Walker, D. C., McInnes, R. E. coli host strains significantly affect the quality of small scale plasmid DNA preparations used for sequencing. Nucleic Acids Research. 21, (7), 1677 (1993).
  29. Cherepanov, P. P., Wackernagel, W. Gene disruption in Escherichia coli: Tc R and Km R cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene. 158, (1), 9-14 (1995).
Digitale PCR-gebaseerde competitieve index voor high-throughput analyse van de geschiktheid in <em>salmonella</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Shaw, J. A., Bourret, T. J. Digital PCR-based Competitive Index for High-throughput Analysis of Fitness in Salmonella. J. Vis. Exp. (147), e59630, doi:10.3791/59630 (2019).More

Shaw, J. A., Bourret, T. J. Digital PCR-based Competitive Index for High-throughput Analysis of Fitness in Salmonella. J. Vis. Exp. (147), e59630, doi:10.3791/59630 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter