Driedimensionaal, serumvrij kweeksysteem voor traanklierstamcellen
Summary
De driedimensionale, serumvrije kweekmethode voor volwassen traanklier (LG) stamcellen is goed ingeburgerd voor de inductie van LG organoïde vorming en differentiatie in acinaire of ductaal-achtige cellen.
Abstract
Traanklier (LG) stamcel-gebaseerde therapie is een veelbelovende strategie voor traanklieraandoeningen. Het ontbreken van een betrouwbare, serumvrije kweekmethode om een voldoende aantal LG-stamcellen (LGSC’s) te verkrijgen, is echter een obstakel voor verder onderzoek en toepassing. De driedimensionale (3D), serumvrije kweekmethode voor LGSC’s voor volwassen muizen is goed ingeburgerd en wordt hier getoond. De LGSC’s kunnen continu worden gepasseerd en geïnduceerd om te differentiëren tot acinaire of ductaalachtige cellen.
Voor de LGSC primaire cultuur werden de PG’s van 6-8 weken oude muizen verteerd met dispase, collagenase I en trypsine-EDTA. Een totaal van 1 × 104 enkele cellen werden gezaaid in 80 μL matrix gel-lacrimal gland stem cell medium (LGSCM) matrix in elke put van een 24-well plaat, vooraf gecoat met 20 μL matrix gel-LGSCM matrix. Het mengsel werd gestold na incubatie gedurende 20 minuten bij 37 °C en 600 μL LGSCM toegevoegd.
Voor LGSC-onderhoud werden LGSC’s die gedurende 7 dagen werden gekweekt, uitgesplitst in afzonderlijke cellen door dispase en trypsine-EDTA. De afzonderlijke cellen werden geïmplanteerd en gekweekt volgens de methode die werd gebruikt in de primaire cultuur van LGSC. LGSC’s kunnen meer dan 40 keer worden gepasseerd en continu stam/ voorlopercelmarkers Krt14, Krt5, P63 en nestin uitdrukken. LGSC’s gekweekt in LGSCM hebben zelfvernieuwingscapaciteit en kunnen in vitro en in vivo differentiëren in acinaire of ductaalachtige cellen.
Introduction
Traanklier stamcellen (LGSCs) onderhouden traanklier (LG) celvernieuwing en zijn de bron van acinaire en ductale cellen. Daarom wordt LGSC-transplantatie beschouwd als een alternatieve benadering voor de behandeling van ernstige ontstekingsschade en waterig-deficiënte droge ogenziekte (ADDED)1,2,3. Verschillende kweekmethoden zijn toegepast om LGSC’s te verrijken. Tiwari et al. scheidden en kweekten primaire LG-cellen met behulp van collageen I en matrixgel aangevuld met verschillende groeifactoren; de LG-cellen konden echter niet continu worden gekweekt4. Met behulp van tweedimensionale (2D) cultuur werden van LG afgeleide stamcellen van muizen geïsoleerd door You et al.5 en Ackermann et al. 6, gevonden om de stam / voorlopercelmarkergenen, Oct4, Sox2, Nanog en nestin, tot expressie te brengen en kan worden gesubcultureerd. Er zijn echter geen duidelijke aanwijzingen dat deze cellen kunnen differentiëren in acinaire of ductale cellen, en er is geen transplantatie-experiment om het differentiatiepotentieel in vivo te verifiëren.
Onlangs werden c-kit + dim / EpCAM + / Sca1–/ CD34–/CD45-cellen geïsoleerd uit muis-PG’s door flowcytometrie, bleken LG-voorlopercelmarkers tot expressie te brengen, zoals Pax6 en Runx1, en gedifferentieerd in kanalen en acini in vitro. Bij muizen met ADDED kan orthotopische injectie met deze cellen beschadigde PG’s herstellen en de secretoire functie van PG’s2 herstellen. Het aantal stamcellen dat door deze methode werd geïsoleerd, was echter klein en er zijn geen geschikte kweekomstandigheden voor het uitbreiden van de geïsoleerde LGSC’s. Samenvattend moet een passend kweeksysteem worden opgezet om volwassen LGSC’s effectief te isoleren en te kweken met stabiele en continue uitbreiding voor de studie van LGSC’s bij de behandeling van ADDED.
Organoïden afgeleid van stamcellen of pluripotente stamcellen zijn een groep cellen die histologisch vergelijkbaar zijn met de verwante organen en hun eigen vernieuwing kunnen behouden. Nadat de darmorganoïde van de muis in 2009 met succes werd gekweekt door Sato et al.7, werden organoïden uit andere organen achtereenvolgens gekweekt, op basis van het kweeksysteem van Sato, zoals galblaas8, lever9, pancreas10, maag11, borst12, long13, prostaat14 en speekselklier15 . Vanwege het hoge aandeel volwassen stamcellen vóór celdifferentiatie in organoïde cultuur, wordt de driedimensionale (3D) organoïde kweekmethode als optimaal beschouwd voor de isolatie en kweek van volwassen stamcellen van LG.
Een LGSC-kweeksysteem voor volwassen muizen werd in deze studie opgezet door de 3D, serumvrije kweekmethode te optimaliseren. Het is bewezen dat de LGSC’s gekweekt uit zowel normale als TOEGEVOEGDE muizen een stabiel vermogen tot zelfvernieuwing en proliferatie vertoonden. Na transplantatie in de ADD-muis-PG’s koloniseerden LGSCs de aangetaste PG’s en verbeterden ze de traanproductie. Bovendien werden rode fluorescerende LGSC’s geïsoleerd uit ROSA26mT/mG-muizen en gekweekt. Dit werk biedt een betrouwbare referentie voor LGSC-verrijking in vitro en LGSC-autograft in klinische toepassing voor TOEGEVOEGDE therapie.
Protocol
Representative Results
Discussion
Er zijn gevestigde methoden voor de isolatie en in vitro kweek van traanstamcellen voor traanstamcelkweek en LG-letselherstel. Shatos et al.17 en Ackermannet al. 6 succesvol gekweekte en subculturele traanstamcellen van ratten en muizen door respectievelijk 2D-kweekmethoden, waardoor het mogelijk is om traanstamcellen te transplanteren voor de behandeling van ADDED. Studies op stamcellen18 en mesenchymale stamcellen<sup class="xref"…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Dit werk werd ondersteund door een subsidie van de National Natural Science Foundation of China (nr. 31871413) en twee programma’s van Guangdong Science and Technology (2017B020230002 en 2016B030231001). We zijn de onderzoekers die ons hebben geholpen tijdens het onderzoek en de medewerkers die in het dierencentrum werken echt dankbaar voor hun steun in de dierverzorging.
Materials
| Animal(Mouse) | |||
| Bal B/C | Model Animal Research Center of Nanjing University | ||
| C57 BL/6J | Laboratory Animal Center of Sun Yat-sen University | ||
| NOD/ShiLtJ | Model Animal Research Center of Nanjing University | ||
| ROSA26mT/mG | Model Animal Research Center of Nanjing University | ||
| Equipment | |||
| Analytical balance | Sartorius | ||
| Automatic dehydrator | Thermo | ||
| Blood counting chamber | BLAU | ||
| Cell Counter | CountStar | ||
| CO2 constant temperature incubator | Thermo | ||
| ECL Gel imaging system | GE healthcare | ||
| Electric bath for water bath | Yiheng Technology | ||
| Electrophoresis apparatus | BioRad | ||
| Fluorescence quantitative PCR instrument | Roche | ||
| Frozen tissue slicer | Lecia | ||
| Horizontal centrifuge | CENCE | ||
| Inverted fluorescence microscope | Nikon | ||
| Inverted microscope | Olympus | ||
| Laser lamellar scanning micrograph | Carl Zeiss | ||
| Liquid nitrogen container | Thermo | ||
| Low temperature high speed centrifuge | Eppendorf | ||
| Micropipettor | Gilson | ||
| Microwave oven | Panasonic | ||
| Nanodrop ultraviolet spectrophotometer | Thermo | measure RNA concentration | |
| Paraffin slicing machine | Thermo | ||
| PCR Amplifier | Eppendorf | ||
| pH value tester | Sartorius | ||
| 4 °C Refrigerator | Haier | ||
| Thermostatic culture oscillator | ZHICHENG | ||
| Tissue paraffin embedding instrument | Thermo | ||
| -80°C Ultra-low temperature refrigerator | Thermo | ||
| -20°C Ultra-low temperature refrigerator | Thermo | ||
| Ultra pure water purification system | ELGA | ||
| Reagent | |||
| Animal Experiment | |||
| HCG | Sigma | 9002-61-3 | |
| PMSG | Sigma | 14158-65-7 | |
| Pentobarbital Sodium | Sigma | 57-33-0 | |
| Cell Culture | |||
| B27 | Gibco | 17504044 | |
| Collagenase I | Gibco | 17018029 | |
| Dispase | BD | 354235 | |
| DMEM | Sigma | D6429 | |
| DMEM/F12 | Sigma | D0697 | |
| DMSO | Sigma | 67-68-5 | |
| EDTA | Sangon Biotech | A500895 | |
| Foetal Bovine Serum | Gibco | 04-001-1ACS | |
| GlutaMax | Gibco | 35050087 | |
| Human FGF10 | PeproTech | 100-26 | |
| Matrigel (Matrix gel) | BD | 356231 | |
| Murine Noggin | PeproTech | 250-38 | |
| Murine Wnt3A | PeproTech | 315-20 | |
| Murine EGF | PeproTech | 315-09 | |
| NEAA | Gibco | 11140050 | |
| N2 | Gibco | 17502048 | |
| R-spondin 1 | PeproTech | 120-38 | |
| Trypsin Inhibitor (TI) | Sigma | T6522 | Derived from Glycine max; can inhibit trypsin, chymotrypsin, and plasminase to a lesser extent. One mg will inhibit 1.0-3.0 mg of trypsin. |
| Trypsin | Sigma | T4799 | |
| Y-27632 | Selleck | S1049 | |
| HE staining & Immunostaining | |||
| Alexa Fluor 488 donkey anti-Mouse IgG | Thermo | A-21202 | Used dilution: IHC) 2 μg/mL, (IF) 0.2 μg/mL |
| Alexa Fluor 488 donkey anti-Rabbit IgG | Thermo | A-21206 | Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL |
| Alexa Fluor 568 donkey anti-Mouse IgG | Thermo | A-10037 | Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL |
| Alexa Fluor 568 donkey anti-Rabbit IgG | Thermo | A-10042 | Used dilution: (IHC) 2 μg/mL, (IF) 4 μg/mL |
| Anti-AQP5 rabbit antibody | Abcam | ab104751 | Used dilution: (IHC) 1 μg/mL, (IF) 0.1 μg/mL |
| Anti-E-cadherin Rat antibody | Abcam | ab11512 | Used dilution: (IF) 5 μg/mL |
| Anti-Keratin14 rabbit antibody | Abcam | ab181595 | Used dilution: (IHC) 1 μg/mL, (IF) 2 μg/mL |
| Anti-Ki67 rabbit antibody | Abcam | ab15580 | Used dilution: (IHC) 1 μg/mL, (IF) 1 μg/mL |
| Anti-mCherry mouse antibody | Abcam | ab125096 | Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL |
| Anti-mCherry rabbit antibody | Abcam | ab167453 | Used dilution: (IF) 2 μg/mL |
| C6H8O7 | Sangon Biotech | A501702-0500 | |
| Citric Acid | Sangon Biotech | 201-069-1 | |
| DAB Kit (20x) | CWBIO | CW0125 | |
| DAPI | Thermo | 62248 | |
| Eosin | BASO | 68115 | |
| Fluorescent Mounting Medium | Dako | S3023 | |
| Formalin | Sangon Biotech | A501912-0500 | |
| Goat anti-Mouse IgG antibody (HRP) | Abcam | ab6789 | Used dilution: 2 μg/mL |
| Goat anti-Rabbit IgG antibody(HRP) | Abcam | ab6721 | Used dilution: 2 μg/mL |
| Hematoxylin | BASO | 517-28-2 | |
| Histogel (Embedding hydrogel) | Thermo | HG-400-012 | |
| 30% H2O2 | Guangzhou Chemistry | KD10 | |
| 30% Hydrogen Peroxide Solution | Guangzhou Chemistry | 7722-84-1 | |
| Methanol | Guangzhou Chemistry | 67-56-1 | |
| Na3C6H5O7.2H2O | Sangon Biotech | A501293-0500 | |
| Neutral balsam | SHANGHAI YIYANG | YY-Neutral balsam | |
| Non-immunized Goat Serum | BOSTER | AR0009 | |
| Paraffin | Sangon Biotech | A601891-0500 | |
| Paraformaldehyde | DAMAO | 200-001-8 | |
| Saccharose | Guangzhou Chemistry | 57-50-1 | |
| Sodium citrate tribasic dihydrate | Sangon Biotech | 200-675-3 | |
| Sucrose | Guangzhou Chemistry | IB11-AR-500G | |
| Tissue-Tek O.T.C. Compound | SAKURA | SAKURA.4583 | |
| Triton X-100 | DINGGUO | 9002-93-1 | |
| Xylene | Guangzhou Chemistry | 128686-03-3 | |
| RT-PCR & qRT-PCR | |||
| Agarose | Sigma | 9012-36-6 | |
| Alcohol | Guangzhou Chemistry | 64-17-5 | |
| Chloroform | Guangzhou Chemistry | 865-49-6 | |
| Ethidium Bromide | Sangon Biotech | 214-984-6 | |
| Isopropyl Alcohol | Guangzhou Chemistry | 67-63-0 | |
| LightCycler 480 SYBR Green I Master Mix | Roche | 488735200H | |
| ReverTra Ace qPCR RT Master Mix | TOYOBO | – | |
| Taq DNA Polymerase | TAKARA | R10T1 | |
| Goldview (nucleic acid stain) | BioSharp | BS357A | |
| TRIzol | Magen | R4801-02 | |
| Vector Construction & Cell Transfection | |||
| Agar | OXID | – | |
| Ampicillin | Sigma | 69-52-3 | |
| Chloramphenicol | Sigma | 56-75-7 | |
| Endotoxin-free Plasmid Extraction Kit | Thermo | A36227 | |
| Kanamycin | Sigma | 25389-94-0 | |
| Lipo3000 Plasmid Transfection Kit | Thermo | L3000015 | |
| LR Reaction Kit | Thermo | 11791019 | |
| Plasmid Extraction Kit | TIANGEN | DP103 | |
| Trans5α Chemically Competent Cell | TRANSGEN | CD201-01 | |
| Trytone | OXID | – | |
| Yeast Extract | OXID | – | |
| Primers and Sequence | Company | ||
| Primer: AQP5 Sequence: F: CATGAACCCAGCCCGATCTT R: CTTCTGCTCCCATCCCATCC |
Synbio Tech | ||
| Primer: β-actin Sequence: F: AGATCAAGATCATTGCTCCTCCT R: AGATCAAGATCATTGCTCCTCCT |
Synbio Tech | ||
| Primer: Epcam Sequence: F: CATTTGCTCCAAACTGGCGT R: TGTCCTTGTCGGTTCTTCGG |
Synbio Tech | ||
| Primer: Krt5 Sequence: F: AGCAATGGCGTTCTGGAGG R: GCTGAAGGTCAGGTAGAGCC |
Synbio Tech | ||
| Primer: Krt14 Sequence: F: CGGACCAAGTTTGAGACGGA R: GCCACCTCCTCGTGGTTC |
Synbio Tech | ||
| Primer: Krt19 Sequence: F: TCTTTGAAAAACACTGAACCCTG R: TGGCTCCTCAGGGCAGTAAT |
Synbio Tech | ||
| Primer: Ltf Sequence: F: CACATGCTGTCGTATCCCGA R: CGATGCCCTGATGGACGA |
Synbio Tech | ||
| Primer: Nestin Sequence: F: GGGGCTACAGGAGTGGAAAC R: GACCTCTAGGGTTCCCGTCT |
Synbio Tech | ||
| Primer: P63 Sequence: F: TCCTATCACGGGAAGGCAGA R: GTACCATCGCCGTTCTTTGC |
Synbio Tech | ||
| Vector | |||
| pLX302 lentivirus no-load vector | Addgene | ||
| pENRTY-mCherry | Xiaofeng Qin laboratory, Sun Yat-sen University |
References
- Zoukhri, D., Macari, E., Kublin, C. L. A single injection of interleukin-1 induces reversible aqueous tear deficiency, lacrimal gland inflammation, and acinar and ductal cell proliferation. Experimental Eye Research. 84 (5), 894-904 (2007).
- Gromova, A., et al. Lacrimal gland repair using progenitor cells. Stem Cells Translational Medicine. 6 (1), 88-98 (2016).
- Buzhor, E., et al. Cell-based therapy approaches: the hope for incurable diseases. Regenerative Medicine. 9 (5), 649-672 (2014).
- Tiwari, S., et al. Establishing human lacrimal gland cultures with secretory function. PLoS One. 7 (1), 29458 (2012).
- You, S., Kublin, C. L., Avidan, O., Miyasaki, D., Zoukhri, D. Isolation and propagation of mesenchymal stem cells from the lacrimal gland. Investigative Ophthalmology & Visual Science. 52 (5), 2087-2094 (2011).
- Ackermann, P., et al. Isolation and investigation of presumptive murine lacrimal gland stem cells. Investigative Ophthalmology & Visual Science. 56 (8), 4350-4363 (2015).
- Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459 (7244), 262-265 (2009).
- Lugli, N., et al. R-spondin 1 and noggin facilitate expansion of resident stem cells from non-damaged gallbladders. EMBO Reports. 17 (5), 769-779 (2016).
- Huch, M., et al. Long-term culture of genome-stable bipotent stem cells from adult human liver. Cell. 160 (1), 299-312 (2015).
- Boj, S. F., et al. Organoid models of human and mouse ductal pancreatic cancer. Cell. 160 (1), 324-338 (2015).
- Barker, N., et al. Lgr5+(ve) stem cells drive self-renewal in the stomach and build long-lived gastric units in vitro. Cell Stem Cell. 6 (1), 25-36 (2010).
- Linnemann, J. R., et al. Quantification of regenerative potential in primary human mammary epithelial cells. Development. 142 (18), 3239-3251 (2015).
- Rock, J. R., et al. Basal cells as stem cells of the mouse trachea and human airway epithelium. Proceedings of the National Academy of Sciences of the United States of America. 106 (31), 12771-12775 (2009).
- Chua, C. W., et al. Single luminal epithelial progenitors can generate prostate organoids in culture. Nature Cell Biology. 16 (1), 951-961 (2014).
- Maimets, M., et al. Long-term in vitro expansion of salivary gland stem cells driven by Wnt signals. Stem Cell Reports. 6 (1), 150-162 (2016).
- Xiao, S., Zhang, Y. Establishment of long-term serum-free culture for lacrimal gland stem cells aiming at lacrimal gland repair. Stem Cell Research & Therapy. 11 (1), 20 (2020).
- Shatos, M. A., Haugaard-Kedstrom, L., Hodges, R. R., Dartt, D. A. Isolation and characterization of progenitor cells in uninjured, adult rat lacrimal gland. Investigative Ophthalmology & Visual Science. 53 (6), 2749-2759 (2012).
- Mishima, K., et al. Transplantation of side population cells restores the function of damaged exocrine glands through clusterin. Stem Cells. 30 (9), 1925-1937 (2012).
- Aluri, H. S., et al. Delivery of bone marrow-derived mesenchymal stem cells improves tear production in a mouse model of sjögren’s syndrome. Stem Cells International. 2017, 1-10 (2017).
- Dietrich, J., Schrader, S. Towards lacrimal gland regeneration: current concepts and experimental approaches. Current Eye Research. 45 (3), 230-240 (2020).
- Sato, T., Clevers, H. SnapShot: growing organoids from stem cells. Cell. 161 (7), 1700 (2015).
- Kleinman, H. K., Martin, G. R. Matrigel: basement membrane matrix with biological activity. Seminars in Cancer Biology. 15 (5), 378-386 (2005).
- Arnaoutova, I., George, J., Kleinman, H. K., Benton, G. Basement membrane matrix (BME) has multiple uses with stem cells. Stem Cell Reviews and Reports. 8 (1), 163-169 (2012).
