Inverser levure système à deux hybrides pour identifier les mammifères Nuclear Receptor résidus qui interagissent avec des ligands et / ou antagonistes

1Department of Genetics, Albert Einstein College of Medicine, 2Shanghai Key Laboratory of Complex Prescription and MOE Key Laboratory for Standardization of Chinese Medicines, Institute of Chinese Materia Medica, Shanghai University of Traditional Chinese Medicine
* These authors contributed equally
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Kétoconazole se lie à et antagonise Pregnane X Receptor (RPX) activation. Levure haute écrans de débit de mutants PXR définissent une région unique pour la liaison kétoconazole. Cette méthode génétique à base de levure découvre interactions avec les récepteurs nucléaires de nouveaux avec des ligands qui s'associent avec les sites de liaison surface.

Cite this Article

Copy Citation | Download Citations

Li, H., Dou, W., Padikkala, E., Mani, S. Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists. J. Vis. Exp. (81), e51085, doi:10.3791/51085 (2013).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

En tant que régulateur essentiel du métabolisme des médicaments et de l'inflammation, Pregnane X Receptor (PXR), joue un rôle important dans la physiopathologie de la maladie reliant le métabolisme et l'inflammation (par exemple, de la stéatose hépatique) 1,2. Il a eu beaucoup de progrès dans l'identification des ligands agonistes pour PXR, cependant, il ya des descriptions limitées des antagonistes de la drogue comme et leurs sites de liaison sur PXR 3,4,5. Un obstacle majeur a été l'incapacité à purifier efficacement la protéine de longueur totale pour des études structurales avec des antagonistes malgré le fait que PXR a été clonée et caractérisée en 1998. Notre laboratoire a développé une nouvelle levure à haut débit à base de dosage à deux hybrides de définir un antagoniste, le kétoconazole de résidus de liaison sur PXR 6. Notre méthode consiste à créer des bibliothèques de mutation qui sauver l'effet des mutations simples sur la surface AF-2 de PXR prévu pour interagir avec le kétoconazole. Sauvetage ou «gain de fonction» second mutations peuvent être effectuées de telle sorte que des conclusions en ce qui concerne l'interaction génétique du kétoconazole et le résidu (s) de surface sur PXR sont réalisables. Ainsi, nous avons développé un haut débit écran de deux hybrides de levure de mutants PXR interagissant avec son coactivateur SRC-1. En utilisant cette approche, dans laquelle la levure a été modifié pour tenir compte de l'étude de la drogue antifongique, le kétoconazole, nous avons pu démontrer mutations spécifiques sur PXR enrichies en clones incapables de se lier au kétoconazole. Par la logique inverse, nous concluons que les résidus d'origine sont des résidus d'interaction directe avec le kétoconazole. Ce test représente un roman, essai génétique docile à l'écran pour les sites de liaison antagonistes sur les surfaces des récepteurs nucléaires. Cet essai peut être appliqué à n'importe quel médicament, indépendamment de son potentiel cytotoxique de la levure ainsi que de la protéine cellulaire (s) qui ne peut être étudiée en utilisant la biologie structurale standard ou les méthodes à base de protéomiques. Pièges potentiels incluent l'interprétation de données (méthodes complémentaires utiles), reliment sur la méthode unique de Y2H, expertise dans le traitement de levure ou d'effectuer des essais levure à deux hybrides, et l'optimisation des essais.

Introduction

La levure double hybride (Y2H) test est largement utilisé pour découvrir des interactions protéine-protéine et, plus récemment, à la découverte de nouvelles petites molécules qui perturbent les complexes protéine-protéine interaction 7, 8, 9, 10, 11. Cependant, les approches conventionnelles de ce test, utilisé pour la découverte de médicaments ou "hits", ne permettent pas la détection de résidus d'interaction allostériques de composés chimiques dans les surfaces protéine-protéine, que s'il est modifié encore interagir et de permettre l'interrogatoire des résidus modifiés 11 . En effet, un tel procédé (s), si possible de développer, permettrait un système de levure docile pour l'évaluation à haut débit de résidus d'interaction allostériques critiques pour interaction protéine-protéine perturbation. Dans le cadre de la découverte de médicaments, la façon la plus directe d'établir une interaction des composés avec des protéines impliquerait détermination de la structure (par exemple la cristallisation de la protéine complexe inhibiteur). Ces méthodes sont cumbersome, utiliser les ressources élaborées et il n'est pas techniquement possible de réaliser des études structurelles sur chaque protéine.

Systèmes de dépistage génétique de la drogue tractables ont été établis dans des bactéries 1, 2 et d'autres systèmes modèles comme mammifère double-hybride. Cependant, ces systèmes doivent optimisation et les systèmes alternatifs comme Y2H sont toujours les plus testés dans la découverte de médicaments. Il ya des limites qui comprennent une faible sensibilité et la fiabilité des interactions à l'aide de méthodes singulières 13, cependant, un essai de Y2H unique peut être modifié pour répondre à des questions spécifiques concernant les résidus d'interaction. Dans le domaine de la recherche sur le récepteur nucléaire, Y2H a été utilisé pour définir des protéines qui interagissent 14, cependant, ces interactions protéiques ont rarement été utilisé pour définir la nature, dans lequel les ligands / antagonistes interagissent avec des complexes récepteur-protéine nucléaire. Ainsi, notre laboratoire a concentré ses efforts sur la définition d'une méthode, en particulier pour les protéines réceptrices qui ne sont pasprête facilement à des méthodes basées protéomique, ce serait déterrer nouveau ligand / antagoniste interaction résidus en utilisant un Y2H à base plate-forme de découverte inversée.

Sur la base de notre conclusion précédente selon laquelle le kétoconazole perturbe PXR et son activateur SRC-1, nous avons développé un nouveau système de Y2H inverse qui nous permettent de définir interroger et résidus de kétoconazole interagir sur PXR 6. Notre procédé est basé sur les propriétés de la protéine GAL4 de levure qui se compose de domaines séparables responsables de l'activation de la liaison à l'ADN et la transcription. La protéine PXR LBD est exprimé comme une fusion au domaine LexA liaison à l'ADN (DNA-BD), tandis que la longueur des co-activateurs pleins SRC-1 (coactivateurs de récepteur de stéroïde 1) les protéines sont exprimées sous forme de fusions au domaine d'activation de GAL4 (AD ). L'interaction entre PXR et SRC-1 des protéines de fusion conduit à l'activation de la transcription GAL4 de sites de liaison contenant gène rapporteur Lac Z-β qui est intégré dans le génome de la levuree. Le kétoconazole, un antagoniste PXR, perturbe PXR et SRC-1 interaction 15, 16, 17 et on peut détecter l'interaction de PXR et SRC-1 en présence ou en l'absence de kétoconazole après coloration des colonies sur des filtres pour l'activité X-gal. Le principe de Y2H est illustré sur la figure 1 et la procédure expérimentale est résumée sur la figure 2.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Une. Construction de PXR et SRC-1 Fusions dans les vecteurs de levure

  1. Amplification par PCR de l'homme PXR LBD (107-434 acides aminés) et Human SRC-1 pleine longueur (1-1401 acides aminés).
    1. Utilisez pSG5-hPXR plasmide 8 comme PXR LBD modèle, utilisez plasmide pCMX-SRC1 que SRC-1 modèles.
    2. SuperMix PCR dégel, des matrices d'ADN et des amorces (voir Matériaux), gardez-les sur de la glace.
    3. Ajouter 0,25 pg / pl matrice d'ADN 1 pi, 10 mM paires d'amorces 2 pi chacun, SuperMix PCR 45 pi et ajouter H 2 O pour porter le volume total à 50 pi.
    4. Set PCR à un cycle de 94 ° C pendant 2 min, 20 cycles de 94 ° C pendant 30 s, 55 ° C pendant 30 sec et 72 ° C pendant 2 min, puis un cycle de 72 ° C pendant 10 minutes pour l'extension. Voir les produits de PCR en exécutant sur gel d'agarose à 1%.
  2. Les produits de PCR clonage dans des vecteurs Y2H.
    1. Purifier les produits de PCR à partir de gel d'agarose à 1%. Digest PXR, LBD, PCR, et Y2H vecteur PSH2-1 avecBamHI et Sali; digérer SRC-1 PCR et Y2H vecteur pGADNOT avec NotΙ et SalΙ. Pour ce faire, ajouter 1 pg d'ADN, 3 ul de tampon de réaction 10 x, 1 ul d'enzymes de restriction et finalement H 2 O pour amener le volume total à 30 ul.
    2. Placer les échantillons dans de digestion à 37 ° C bain d'eau pendant 1 heure. Vérifier la digestion en exécutant sur gel d'agarose à 1%.
    3. Purifier les échantillons de digestion de gel d'agarose à 1%, ligaturer digéré les produits de PCR et des vecteurs Y2H et à transformer des cellules compétentes DH5a.
    4. Choisissez les colonies et isoler l'ADN plasmidique.
  3. Identifier l'ADN plasmidique PSH2-1-PXR par BamHI / Sall digestion, identifier pGADNOT-SRC-1 ADN plasmidique par Notl / Sall digestion. Vérifiez tout l'ADN plasmidique positif par séquençage.

2. Yeast Two-hybrid dosages

  1. Inoculer la souche de levure dans 5 ml YPAD et incuber pendant une nuit par une agitation constante (220 rpm à 30 ° C). Remarque: La souche Saccharomyces cerevisiae était CTY10-5d(MAT une ade2 trp 1-901 leu2-3, 112 his3-200 ga l4 - GAL80 - URA3 :: lexA-lacZ) qui contient un gène intégré GAL1-lacZ avec lexA opérateur 10. Pour obtenir des cellules de levure viables résistantes au kétoconazole, mais ceux qui ne portent pas des altérations de transporteur en tant que cause de la résistance azole 18 à 20, de nouvelles souches de levure CTY10-5d ont été obtenus selon la première erg 3 de suppression (erg 3 de Δ) et en introduisant ensuite la suppression supplémentaire en ERG11 (erg 3 Δ / erg11 Δ) gènes par recombinaison homologue. Les détails de construction ont été décrits dans un manuscrit déjà publié 6.
  2. Le lendemain (le matin), ensemencer la levure (01h20) dans 5 ml YAPD et incuber à obtenir une DO 600 ~ 0,2 par agitation constante (220 rpm à 30 ° C).
  3. Sédimenter les cellules à 2.000 tours par minute dans une microcentrifugeuse pendant 2 minutes et éliminer le surnageant. Laver ensuite la pellet deux fois avec de l'eau autoclave et une fois avec 0,1 M LiAc.
  4. Après le dernier lavage, éliminer le surnageant et ajouter les réactifs suivants au culot cellulaire: 240 ul de PEG 3500 à 50% p / v, 36 pi de 1 M de LiAc, 50 pi de 2 mg / ml de bouillie ADNsb de sperme de saumon, H 2 O 34 ul. Vortex à mélanger, ajouter 1 pg PSH-PXR et 1 pg pGADNOT-SRC-1 ADN et mélanger.
  5. Transférer le mélange de polystyrène tube rond-bas, agiter la transformation, mélanger (220 rpm à 30 ° C) pendant 30 min. Déplacer le tube à 42 ° C bain d'eau et incuber pendant 30 min supplémentaires.
  6. Centrifuger le tube à 2000 tours par minute pendant 2 min et éliminer le surnageant. Laver culot fois à l'eau autoclave.
  7. Ajouter 100 pi d'eau stérile dans le tube, remettre en suspension les cellules par le doigt doux tapant et pipetage, puis la plaque sur des plaques de -His/-Leu Dropout moyen (Formulation par litre -His/-Leu Dropout moyen: 20 g de dextrose, YNB 1,7 g, 0,67 g CSM-His/-Leu, 5 g de sulfate d'ammonium, 1,5% de gélose) et incUbate à 30 ° C pendant 3-4 jours pour isoler les transformants.

3. X-gal Filtre Assay

  1. Couper une membrane de nitrocellulose à la taille d'une partie de boîte de Pétri. Étiqueter la membrane de nitrocellulose pour marquer l'orientation.
  2. Placer une membrane de nitrocellulose de rupture en colonies de levure, de s'assurer que la membrane est en contact avec la surface du support de plaque.
  3. Retirer la membrane, le placer côté colonie vers le haut sur un papier filtre de 3 mm, et placer la membrane et le papier-filtre à -80 ° C pendant 15 min.
  4. Préparer une solution X-gal. Ajouter 50 ul de 20 mg / ml de X-gal et 15 ul de β-mercaptoéthanol à 5 ml de tampon Z (1 L de tampon contient 16,1 g de Na 2 HPO 4, 7H 2 O, 5,5 g de NaH 2 PO 4 H 2 O, 0,75 g KCl, 0,25 g MgSO 4 7H 2 O •). Si Z tampon a été maintenu à 4 ° C, l'amener à la température ambiante avant l'addition de ces réactifs.
  5. Placer deux cercles de papier filtre de 3 mmdans une boîte de Pétri et les faire tremper avec 5 ml de solution X-gal. Drainer l'excès de tampon à partir de la boîte de Pétri et placer la membrane de nitrocellulose avec la colonie côté vers le haut.
  6. Fermez le couvercle, s'assurer que la membrane est en contact avec le papier filtre et il est complètement humide. Enveloppez la boîte de Petri dans une feuille et incuber à 37 ° C pendant 30 min à la nuit.

4. Liquide β-gal Assay

  1. Cultivez levure dans un milieu liquide -His/-Leu Dropout à DO 600 de 0,7.
  2. Transférer 1 ml de milieu dans un tube de 1,5 ml et centrifuger à 3000 rpm pendant 2 min. Jeter le surnageant.
  3. Ajouter 1 ml de tampon Z à remettre le culot, centrifuger à 3000 rpm à nouveau pendant 2 min. Jeter le surnageant.
  4. Ajouter 150 ul de tampon Z avec 2ME pour remettre en suspension le culot cellulaire, mélanger puis ajouter 50 ul de chloroforme et 20 pi de 0,1% de SDS. Vigoureusement vortex l'échantillon pendant 15 secondes.
  5. Ajouter 700 ul de solution ONPG (1 mg / ml dans Z buffer). Réglez la minuterie, incuber à 30 ° C assez longtemps pour permettre à la couleur jaune de développer et de noter le temps de réaction total.
  6. Ajouter 500 ul de 1 M de Na 2 CO 3 pour arrêter la réaction et déterminer l'absorbance à 420 nm. Le flan est une solution de 700 ul d'ONPG plus 500 ul de 1 M de Na 2 CO 3.

Calculer unités Miller comme suit: Miller Unités = (A420 * 1000) / (A600 * min * ml)

A420: unités d'absorbance à 420 nanomètres; A600: unités d'absorbance à 600 nanomètres; min: le temps de réaction en minutes; ml: le volume en ml de la réaction

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Nous avons effectué un test pour voir si nous pouvions détecter une lecture colorimétrique de l'association de PXR et récepteur des stéroïdes coactivateur-1 (SRC-1). Etant donné que la levure a une production importante de stérol, il a été montré précédemment que l'expression de lacZ dans la levure peut être induite sans la nécessité d'un ligand exogène supplémentaire. Nous avons trouvé que l'expression de lacZ (colonies bleues) est également induite dans la souche de levure transformée avec PXR et SRC-1, mais il n'y a aucune induction de l'expression de LacZ (colonies blanches) dans la levure transformée avec des vecteurs vides, PXR ou SRC-1 individuel (Figure 3). Pour déterminer si le kétoconazole (25 M) perturbé PXR et SRC-1 interaction dans la levure, répliques de plaques contenant du kétoconazole étaient trempés de nitrocellulose et le filtre X-gal, ascenseur, et les analyses de liquides β-galactosidase ont été effectués. Nous montrons que le kétoconazole perturbe PXR et SRC-1 interactions dans la levure depuis toutes les colonies du filtre de réplique sont maintenant blanc (qui étaitégalement montré par l'activité β-galactosidase significativement réduite par des dosages enzymatiques liquides) (Figure 4A). Nous avons déjà montré dans des essais de mammifères que le mutant de PXR (T248E/K277Q) peut être activé par un ligand fort (par exemple rifampicine) mais est à l'abri des effets antagonistes de kétoconazole 1 7. De même, lorsque nous avons conçu le PXR double mutant (T248E/K277Q) dans le plasmide de levure, puis effectué des transformations de levure avec SRC-1, nous avons pu montrer que les colonies exposées au kétoconazole conservent LacZ expression (figure 4B).

Figure 1
Figure 1. Schématique illustrant les principes de la levure à deux hybrides (Y2H) dosage. L'essai de levure a été établi comme un dosage fonctionnel qui permet l'isolement de mutants qui sont PXR résistant de kétoconazole inhibition médiée par l'interaction de SRC-1. A, une interaction double-hybride induite par la rifampicine de LexA-DB-hPXR protéine de fusion avec SRC-1 fusionnée au domaine d'activation GAL4-(GAL4AC-SRC-1). Les résultats de l'interaction dans les colonies bleues dans un test X-gal en raison de la rapporteur LacZ. B, présence de kétoconazole, perturbe l'interaction induite par la rifampicine de hPXR avec SRC-1. Résultats de l'essai X-gal dans les colonies blanches. C, la présence d'une mutation (indiqués par un astérisque) dans hPXR qui rend l'abri de l'action du kétoconazole donnera une colonie bleue. D, une autre modification de notre analyse à l'avenir pourrait intégrer deuxième place mutations suppresseurs supplémentaires (illustrés par des demi-lune) annuler l'effet de la première mutation qui pourrait entraîner la rupture de hPXR-SRC-1 interaction et donc une colonie blanche dans l'essai X-gal. LexAop, LexA opéron; Galp, promoteur Gal4, Lac Z, bêta-glalactosidase; DB, LexAop domaine de liaison à l'ADN Galp, AC, actedomaine de Ivation; *, mutation (s). (D'après la référence 6). Cliquez ici pour agrandir la figure .

Figure 2
Figure 2. Expérimentale organigramme.

Figure 3
Figure 3. X-gal, essai de levage, et le dosage de liquide β-gal. Levure a été transformée avec les plasmides indiqués et colonies plaqués soumis à essai X-gal ascenseur (à gauche) et le dosage de liquide β-gal (panneau de droite). PSH vecteur vide + pGADNOT vecteur vide (voie 1); PSH-PXR + pGADNOT vecteur vide (ligne 2); PSH vecteur vide + pGADNOT-SRC-1 (piste 3); PSH-PXR + pGADNOT-SRC-1 (voie 4 </ Em>); 5. PSH-INI-1 + pGADNOT-c-Myc (contrôle positif; piste 5). (Reproduit à partir de la référence 6).

Figure 4
Figure 4. Kétoconazole perturbe de type sauvage mais pas mutant association PXR avec coactivateur, colonies SRC-1 levures étaient réplique en plaques contenant véhicule. (0,2% de DMSO; voie 1) ou le kétoconazole (25 uM; piste 2). Test X-gal ascenseur (à gauche) et le dosage de liquide β-gal (panneau de droite) ont ensuite été réalisées. Type PXR sauvage (A, ligne B 1 et 2) et de kétoconazole T248E/K277Q mutant muet (ligne B 3 et 4) ont été représentés sur cette figure. (Reproduit à partir de la référence 6).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Dans notre analyse de Y2H modifié, nous avons identifié des résidus importants pour les interactions de kétoconazole sur PXR 6. Etant donné que SRC-1 est un co-activateur (et a été clone dans le vecteur d'pGADNot), nous avons également testé si SRC-1 pouvait activer l'expression de lacZ lorsque clone dans le système de vecteur PSH et si cela modifie le profil d'activation et / ou affecter la perméabilité de la levure de dosage à deux hybrides. Grâce à nos plasmides redessinés nous avons effectué des essais à deux hybrides dans erg 3 Δ / erg11 Δ levure. Comme précédemment, nous montrons que l'expression de lacZ (colonies bleues) est également induite dans erg 3 Δ / erg11 souche Δ de levure transformée par PXR et SRC-1, mais il n'y a pas induction de l'expression de LacZ (colonies blanches) dans la levure transformée avec des vecteurs vides , PXR ou individuellement SRC-1 (données non présentées). Notre approche fournit une nouvelle méthode puissante pour l'isolement des résidus ligand-protéine allostérique interaction génétique pour les protéines ne se prêtent pas à conventiobiologie et / ou protéomique structurale nal approches 5,21.

Le protocole décrit a plusieurs pièges qui doivent être reconnus. Premièrement, la sensibilité de détection, en particulier les effets antagonistes partiels sur les résidus d'interaction protéine-protéine peut limiter la résolution de l'analyse. Balayage colorimétrique peut aider à résoudre certains de la détection émet 21. Deuxièmement, la présence de colonies bleu peut ne pas toujours indiquer kétoconazole mutations PXR résistants (faux positifs). L'expression de lacZ peut être sauvée en présence de kétoconazole en raison de mutation (s) dans PXR qui rend la protéine constitutivement actif ou actif indépendante de l'interaction de SRC-1. Ces mutants de PXR peut distinguer des vrais mutants résistants kétoconazole en testant la capacité de la LexA-DB-PXR pour activer l'expression de lacZ soi, c'est à dire ces mutants vont donner des colonies bleues en l'absence de GAL4AC-SRC-1. En corollaire, les mutants peuvent aldonc introduit dans la levure en utilisant le plasmide GAL4AC en l'absence de DB-LexA-SRC-1 pour décrire une preuve supplémentaire de l'auto-activation de LacZ. Troisièmement, il reste inconnu si le même résultat serait obtenu si d'autres protocoles de Y2H / vecteurs ont été utilisés 13. Quatrièmement, l'étude des mutants de réversion intramoléculaires (mutants suppresseurs deuxième site de mutants résistant kétoconazole) peut ajouter à la compréhension de la liaison par la définition des résidus voisins qui influent sur la pharmacophore liaison antagoniste. Avec une modification de la banque de mutants, on peut définir avec plus de précision la présente en utilisant un mutant de kétoconazole résistant en tant que matrice de mutagenèse.

Ce procédé peut être modifié pour incorporer un médicament de sorte que la cible cytotoxique dans une levure est bien établie ou à un médicament (s) qui ne présente aucune toxicité potentielle vers levure. La levure peut être modifié, comme nous l'avons montré 6, et être encore viable pour les essais de Y2H. La puissance de cette méthode repose également sur accessoire informeration d'autres essais (par exemple d'accueil moléculaire) qui informent interactions spécifiques au site. En outre, les interactions récepteur nucléaire / corégulateur spécifiques (par exemple nurr77/LKB1; AR/PELP1) peuvent être étudiés 22,23. La traçabilité de ce système est qu'il est portable, peut être effectuée en quelques jours de manière à haut débit et ne nécessite pas de réactifs ou méthodes coûteuses.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Aucun conflit d'intérêt déclaré.

Acknowledgments

Ce travail a été soutenu par les Instituts nationaux de la santé (NIH) Subventions CA127231 et la Fondation Damon Runyon Clinical Investigator Award (CI 1502) (SM). Nous tenons à remercier le professeur Zdenek Dvorak de Palacky University Olomouc, République tchèque pour ses renseignements utiles sur la portabilité discuter de cette technique à leur institution et standardisation du protocole.

Materials

Name Company Catalog Number Comments
Yeast Strain CTY10-5d erg3Δ/erg11Δ Our lab CTY10-5d yeast was double knocked out ERG3 and ERG11 (erg3Δ/erg11Δ) genes6 .
YPD Growth Medium BD Biosciences 630409
Difco Yeast Nitrogen Base (YNB) w/o Amino Acids and Ammonium Sulfate BD Biosciences 233520
Bacto Agar BD Biosciences 214010
CSM-His/-Leu Complete Supplement Mixture MP Biomedicals 4250-412
ONPG (o-Nitrophenyl Β-D- Galactopyranoside). Sigma-Aldrich N1127
2-Mercaptoethanol Sigma-Aldrich M6250
Luria Broth (LB) Sigma-Aldrich L3022
X-Gal Fisher BP-1615
Sonicated Salmon Sperm DNA boiled (10 mg/ml) Life Technology 156-017
Ampicillin Acros Organics 61177
Ketoconazole Sigma-Aldrich K1003
N,N-Dimethylformamide Acros Organics 326871000
Lithium Acetate Sigma-Aldrich L4158
50% PEG-3350 solution, filter-sterilized Sigma-Aldrich P-3640
Nitrocellulose Membrane Whatman 10402091
10 cm Petri Dish Fisher 875712
5'-ACCGGATCCCGATGAAGA AGGAGATGATCATGTCC-3' our lab PXR LBD forward primer for pSH2-1
5'-AGAGTCGACTCAGCTA CCTGTGATGCC -3' our lab PXR LBD reverse primer for pSH2-1
5'-TATAGC GGCCGCATGAGTG GCCTCGGGGACAGTTCATCC -3' our lab SRC-1 forward primer for pGADNOT
5'-GCGGTCGACTTATTCAGTCA GTAGCTG -3' our lab SRC-1 reverse primer for pGADNOT
Platinum PCR Supermix Invitrogen 11306-016
BamHI our lab R0136
SalI our lab R0138
NotI our lab R0189

DOWNLOAD MATERIALS LIST

References

  1. Kliewer, S. A., et al. An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway. Cell. 92, (1), 73-82 (1998).
  2. Blumberg, B., et al. a novel steroid and xenobiotic-sensing nuclear receptor. Genes Dev. 12, (20), 3195-3205 (1998).
  3. Biswas, A., Mani, S., Redinbo, M. R., Krasowski, M. D., Li, H., Ekins, S. Elucidating the 'Jekyll and Hyde' Nature of PXR: The Case for Discovering Antagonists. Pharm. Res. 26, (8), 1807-1815 (2009).
  4. Pondugula, S. R., Mani, S. Pregnane xenobiotic receptor in cancer pathogenesis and therapeutic response. Cancer Lett. 328, (1), 1-9 (2013).
  5. Mani, S., Dou, V., Redinbo, M. R. PXR antagonists and implications for drug metabolism. Drug Metab. Rev. 45, (1), 60-72 (2013).
  6. Li, H., et al. Novel Yeast-Based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR. J. Biol. Chem. 288, (19), 13655-13668 (2013).
  7. Hollenberg, S. M., et al. Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system. Mol. Cell. Biol. 15, (7), 3813-3822 (1995).
  8. Vojtek, A. B., Hollenberg, S. M., Cooper, J. A. Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell. 74, (1), 205-214 (1993).
  9. Wang, H., et al. The phytoestrogen coumestrol is a naturally occurring antagonist of the human pregnane X receptor. Mol. Endocrinol. 22, (4), 838-857 (2008).
  10. Kalpana, G. V., Goff, S. P. Genetic analysis of homomeric interactions of human immunodeficiency virus type 1 integrase using the yeast two-hybrid system. Proc. Natl. Acad. Sci. U.S.A. 90, (22), 10593-10597 (1993).
  11. Hamdi, A., Colas, P. Yeast two-hybrid methods and their applications in drug discovery. TiPS. 33, (2), 109-118 (2012).
  12. Battesti, A., Bouveret, E. The bacterial two-hybrid system based on adenylate cyclase reconstitution in Escherichia coli. Methods. 58, (4), 325-334 (2012).
  13. Caufield, J. H., Sakhawalkar, N., Uetz, P. A comparison and optimization of yeast two-hybrid systems. Methods. 58, (4), 317-324 (2012).
  14. Albers, M., et al. Automated yeast two-hybrid screening for nuclear receptor-interacting proteins. Mol. Cell Proteomics. 4, (2), 205-213 (2005).
  15. Takeshita, A., Taguchi, M., Koibuchi, N., Ozawa, Y. Putative role of the orphan nuclear receptor SXR (steroid and xenobiotic receptor) in the mechanism of CYP3A4 inhibition by xenobiotics. J. Biol. Chem. 277, (36), 32453-32458 (2002).
  16. Huang, H., et al. Inhibition of drug metabolism by blocking the activation of nuclear receptors by ketoconazole. Oncogene. 26, (2), 258-268 (2007).
  17. Wang, H., et al. Activated pregnenolone X- receptor is a target for ketoconazole and Its analogs. Clin. Cancer Res. 13, (8), 2488-2495 (2007).
  18. Ghannoum, M. A., Rice, L. B. Antifungal agents: mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance. Clin. Microbiol. Rev. 12, (4), 501-517 (1999).
  19. Kaur, R., Bachhawat, A. K. The yeast multidrug resistance pump, Pdr5p, confers reduced drug resistance in erg mutants of Saccharomyces cerevisiae. Microbiology. 145, 809-818 (1999).
  20. White, T. C., Marr, K. A., Bowden, R. A., cellular, Clinical, cellular, and molecular factors that contribute to antifungal drug resistance. Clin. Microbiol. Rev. 11, (2), 382-402 (1998).
  21. Serebriiskii, I. G., et al. Detection of peptides, proteins, and drugs that selectively interact with protein targets. Genome Res. 12, 1785-1791 (2002).
  22. Yang, L., et al. Central role for PELP1 in nonandrogenic activation of the androgen receptor in prostate cancer. Mol Endocrinol. 26, (4), 550-561 (2012).
  23. Zhan, Y. Y., et al. The orphan nuclear receptor Nur77 regulates LKB1 localization and activates AMPK. Nat Chem Biol. 8, (11), 897-904 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics