Reverse Gist Twee-hybride systeem voor het identificeren van zoogdieren Nuclear Receptor Residuen die interageren met liganden en / of antagonisten

1Department of Genetics, Albert Einstein College of Medicine, 2Shanghai Key Laboratory of Complex Prescription and MOE Key Laboratory for Standardization of Chinese Medicines, Institute of Chinese Materia Medica, Shanghai University of Traditional Chinese Medicine
* These authors contributed equally
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Ketoconazol bindt aan en antagoniseert pregnaan X Receptor (PXR) activering. Gist high throughput screens van PXR mutanten definiëren een unieke regio voor ketoconazol bindend. Dit op basis van gist genetische methode ontdekt nieuwe nucleaire receptor interacties met liganden die associëren met oppervlakte bindingsplaatsen.

Cite this Article

Copy Citation | Download Citations

Li, H., Dou, W., Padikkala, E., Mani, S. Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists. J. Vis. Exp. (81), e51085, doi:10.3791/51085 (2013).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Als een kritische regulator van metabolisme en ontsteking, pregnaan X receptor (PXR), speelt een belangrijke rol bij de ziekte pathofysiologie koppelen metabolisme en ontsteking (bijvoorbeeld hepatische steatose) 1,2. Er is veel vooruitgang geboekt in het identificeren van agonist liganden voor PXR, echter, zijn er weinig beschrijvingen van drug-als antagonisten en hun bindingsplaatsen op PXR 3,4,5. Een kritische barrière het onvermogen om efficiënt te zuiveren eiwit van volledige lengte voor structurele studies met antagonisten hoewel PXR werd gekloneerd en gekarakteriseerd in 1998. Ons laboratorium ontwikkelde een nieuwe high throughput op basis van gist two-hybrid is een antagonist, ketoconazol definiëren, bindend residuen op PXR 6. De werkwijze omvat het creëren mutatiepatronen bibliotheken die het effect van afzonderlijke mutaties op de AF-2 oppervlak van PXR interactie verwacht tussen ketoconazol zou redden. Reddings-of 'gain-of-function "second mutaties kunnen zodat conclusies over de genetische interactie van ketoconazol en het oppervlak residu (en) op PXR haalbaar worden gemaakt. Zo, een high throughput two-hybrid gist scherm van PXR mutanten interactie met haar coactivator, SRC-1 ontwikkelden we. Met deze aanpak, waarbij de gist werd gewijzigd om de studie van het antimycoticum ketoconazol tegemoet kunnen we aantonen specifieke mutaties op PXR verrijkt klonen niet binden aan ketoconazol. Door omgekeerde logica, concluderen we dat de oorspronkelijke resten zijn directe interactie residuen met ketoconazol. Deze test is een roman, handelbaar genetische test voor het screenen op antagonist bindingsplaatsen op nucleaire receptor oppervlakken. Deze test kan worden toegepast op elk geneesmiddel ongeacht de cytotoxische gist en cellulaire eiwit (ten) die niet kunnen worden onderzocht met behulp van standaard structurele biologie of proteomics gebaseerde methoden. Mogelijke valkuilen onder de interpretatie van gegevens (complementaire methoden bruikbaar), reliAnce op enkele Y2H methode, deskundigheid in het omgaan met gist of het uitvoeren van gist twee-hybride assays, en test optimalisatie.

Introduction

De gist twee-hybride (Y2H) test wordt veel gebruikt om eiwit-eiwit interacties ontdekken en meer onlangs voor ontdekking van nieuwe kleine moleculen die eiwit-eiwit interactie complexen 7, 8, 9, 10, 11 verstoren. De conventionele benaderingen van deze test gebruikt voor drug discovery of "hits", niet mogelijk voor de detectie van allosterische interactie residuen van chemische verbindingen in eiwit-eiwit oppervlak, dat bij nog veranderde interactie en zorgen voor ondervraging van de veranderde residuen 11 . Immers, een dergelijke methode (n), indien mogelijk ontwikkelen, zou een handelbaar gist voor hoge doorvoer beoordeling van allosterische interactie residuen essentieel voor eiwit-eiwit interactie verstoring mogelijk. In het kader van het geneesmiddelenonderzoek, zou de meest directe manier om wisselwerking van verbindingen vast eiwitten structuurbepaling (bv. kristallisatie eiwit-remmer complex) omvatten. Deze methoden zijn cumbersome, gebruik uitgebreide middelen en het technisch niet haalbaar is om structurele studies van elk eiwit uit te voeren.

Tractable genetische drug screening systemen zijn in bacteriën 1, 2 en andere modelsystemen zoals zoogdier twee-hybride vastgesteld. Echter, deze systemen moeten optimalisatie en alternatieve systemen zoals Y2H zijn nog steeds de meest getest in drug discovery. Er zijn beperkingen die slechte gevoeligheid en betrouwbaarheid van interacties met bijzondere werkwijzen 13 omvatten echter een Y2H test kan worden aangepast aan specifieke vragen over interactie residuen beantwoorden. Op het gebied van nucleaire receptor onderzoek is Y2H gebruikt om interagerende eiwitten 14 definiëren, maar deze eiwitinteracties zelden gebruikt om de natuur waarin liganden / antagonisten interageren met nucleaire receptor-eiwitcomplexen definiëren. Aldus ons laboratorium gericht op pogingen het definiëren van een werkwijze, vooral voor receptoreiwitten die nietgemakkelijk vatbaar voor gebaseerde methoden proteomics, dat zou nieuwe ligand / antagonist interactie resten behulp van een omgekeerde Y2H gebaseerd discovery platform ontgraven.

Op basis van onze eerdere bevinding dat ketoconazol verstoort PXR en de activator SRC-1, ontwikkelden we een nieuwe reverse Y2H systeem dat ons in staat stellen om ketoconazol interactie resten te definiëren en te ondervragen op PXR 6. Onze methode is gebaseerd op de eigenschappen van de gist GAL4 eiwit dat bestaat uit scheidbare domeinen die verantwoordelijk zijn voor DNA-binding en transcriptionele activatie. De PXR LBD proteïne wordt uitgedrukt als een fusie met het LexA DNA-bindingsdomein (DNA-BD), terwijl de volledige lengte co-activatoren SRC-1 (steroïdereceptor coactivator 1) zijn proteïnen tot expressie als fusies aan het GAL4 activeringsdomein (AD ). Interactie tussen PXR en SRC-1 fusie-eiwitten leidt tot de transcriptionele activering van GAL4-bindingsplaatsen bevattend reportergen β-Lac Z die is geïntegreerd in de gist genome. Ketoconazol, een PXR antagonist, verstoort PXR en SRC-1 interactie 15, 16, 17 en kunnen we de interactie van PXR detecteren en SRC-1 bij aanwezigheid of afwezigheid van ketoconazol na kleuren kolonies op filters voor X-gal activiteit. Het principe van Y2H wordt geïllustreerd in figuur 1 en de experimentele procedure wordt samengevat in figuur 2.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Bouw van PXR en SRC-1 Fusies in gistvectoren

  1. PCR-amplificatie van Human PXR LBD (107-434 aminozuren) en Human SRC-1 volledige lengte (1-1401 aminozuren).
    1. Gebruik pSG5-hPXR plasmide 8 als PXR LBD sjabloon, gebruiken pCMX-SRC1 plasmide als SRC-1-sjablonen.
    2. Dooi PCR SuperMix, DNA templates en primers (zie materialen), bewaar ze op ijs.
    3. Voeg 0,25 ug / ul DNA-matrijs 1 ui, 10 mM primerparen 2 pi elk PCR Supermix 45 ui en voeg H2O aan totale volume op 50 ui te brengen.
    4. Stel PCR bij een cyclus van 94 ° C gedurende 2 min, 20 cycli van 94 ° C gedurende 30 seconden, 55 ° C gedurende 30 seconden en 72 ° C gedurende 2 minuten, daarna een cyclus van 72 ° C gedurende 10 minuten tot verlenging. Controleer PCR producten door lopen op 1% agarosegel.
  2. PCR producten klonering in Y2H vectoren.
    1. Zuiver PCR producten van 1% agarosegel. Digest PXR, LBD, PCR, en Y2H vector pSH2-1 metBamHI en Sali; verteren SRC-1 PCR en Y2H vector pGADNOT met NotΙ en SalΙ. Hiertoe voeg 1 ug DNA, 3 pl 10x reactiebuffer, 1 ui restrictie-enzymen, en tenslotte H2O aan totale volume op 30 ui te brengen.
    2. Zet digestie monsters 37 ° C waterbad gedurende 1 uur. Controleer digestie door het uitvoeren op 1% agarosegel.
    3. Zuiver digestie monsters van 1% agarosegel ligeren gedigereerde PCR-producten en Y2H vectoren en te transformeren om DH5a competente cellen.
    4. Kies de koloniën en isoleren het plasmide DNA.
  3. Identificeer pSH2-1-PXR plasmide-DNA met BamHI / SalI digestie, identificeren pGADNOT-SRC-1 plasmide DNA door NotI / SalI digestie. Controleer of alle positieve plasmide-DNA door sequencing.

2. Gist twee-hybride assays

  1. Inoculeren de giststam in 5 ml YPAD en incubeer gedurende de nacht door constant roeren (220 tpm bij 30 ° C). Opmerking: De Saccharomyces cerevisiae stam was CTY10-5d(Mat A ade2 trp 1-901 leu2-3, 112 his3-200 ga l4 - GAL80 - URA3 :: lexA-lacZ) dat een geïntegreerde GAL1-lacZ gen met lexA operator 10 bevat. Om levensvatbare gistcellen resistent ketoconazol verkrijgen, maar die niet transporter veranderingen heeft dragen als een oorzaak van azoolresistentie 18-20, nieuwe stammen van CTY10-5d gist werden verkregen door eerst verwijderen ERG3 (erg3 Δ) en invoering van aanvullende deletie in ERG11 (erg3 Δ / ERG11 Δ) genen door homologe recombinatie. De constructie details zijn beschreven in een eerder gepubliceerde manuscript 6.
  2. De volgende dag ('s morgens), inoculeren gist (01:20) in 5 ml YAPD en incubeer een OD 600 ~ 0,2 verkrijgen door constant roeren (220 rpm bij 30 ° C).
  3. Pellet de cellen bij 2000 rpm in een microcentrifuge gedurende 2 min en de bovenstaande vloeistof. Was daarna de pellet tweemaal met geautoclaveerd water en een keer met 0,1 M LiAc.
  4. Na de laatste wasbeurt, gooi supernatant en voeg de volgende reagentia aan de celpellet: 240 pl PEG 3500 50% w / v, 36 gl 1 M LiAc, 50 ui 2 mg / ml gekookt zalmsperma ssDNA, H2O 34 pl. Vortex te mengen, voeg 1 ug PSH-PXR en 1 ug pGADNOT-SRC-1 DNA en meng.
  5. Breng het mengsel op rondbodem polystyreen buizen, schud de transformatie mengen (220 rpm bij 30 ° C) gedurende 30 minuten. Zet de buis tot 42 ° C waterbad en incubeer gedurende 30 minuten.
  6. Centrifugeer de buis bij 2000 rpm gedurende 2 minuten en verwijder het supernatant. Was de pellet een keer met geautoclaveerd water.
  7. Pipetteer 100 ul steriel water in de buis, resuspendeer de cellen door zachte vinger te tikken en pipetteren, dan plaat op platen van -His/-Leu Dropout Medium (Formulering per een liter -His/-Leu Dropout Medium: 20 g dextrose, 1,7 g YNB, 0,67 g CSM-His/-Leu, 5 g ammoniumsulfaat, 1,5% agar) en meerderUbate bij 30 ° C gedurende 3-4 dagen om transformanten te isoleren.

3. X-gal Filter Assay

  1. Knip nitrocellulosemembraan de grootte van een deel van een petrischaal. Label de nitrocellulosemembraan om de oriëntatie te markeren.
  2. Plaats voorgemarkeerde nitrocellulose membraan op gistkolonies, zorg ervoor dat het membraan in contact is met het oppervlak van de plaat medium.
  3. Verwijder het membraan, plaats het kolonie kant naar boven op een 3 mm filtreerpapier en plaats het membraan en filtreerpapier bij -80 ° C gedurende 15 minuten.
  4. Zorg X-gal oplossing. Voeg 50 ul 20 mg / ml X-gal en 15 ul β-mercapto-ethanol tot 5 ml Z-buffer (1 L buffer bevat 16,1 g Na 2 HPO 4 7H 2 O, 5,5 g NaH 2 PO 4 H2O, 0,75 g KCl, 0,25 g MgSO4 • 7H 2 O). Als Z buffer bij 4 ° C werd gehouden, breng het op kamertemperatuur voor het toevoegen van deze reagentia.
  5. Plaats twee cirkels van 3 mm filterpapierin een petrischaal en week ze met 5 ml X-gal oplossing. Afvoer overtollige buffer van de petrischaal en plaats de nitrocellulose membraan met de kolonie kant naar boven.
  6. Sluit het deksel, ervoor zorgen dat het membraan is het maken volledig contact met de filter papier en het is helemaal nat. Wikkel de petrischaal in folie en incubeer bij 37 ° C gedurende 30 minuten tot overnacht.

4. Vloeibare β-gal Assay

  1. Groeien Gist in -His/-Leu Dropout vloeibaar medium om OD 600 0.7.
  2. Breng 1 ml medium in een 1,5 ml microcentrifugebuis en centrifugeer bij 3000 rpm gedurende 2 minuten. Verwijder het supernatant.
  3. Voeg 1 ml buffer Z om de pellet te resuspenderen centrifuge bij 3000 rpm nogmaals 2 minuten. Verwijder het supernatant.
  4. Voeg 150 pi van Z buffer met 2ME de celpellet opnieuw in suspensie, meng voeg 50 pl chloroform en 20 ul 0,1% SDS. Krachtdadig vortex het monster gedurende 15 sec.
  5. Voeg 700 ul ONPG-oplossing (1 mg / ml in Z buffer). Stel de timer, incubeer bij 30 ° C toereikend is om de gele kleur aan totale reactietijd ontwikkelen en toelichting.
  6. Voeg 500 ul van 1 M Na 2 CO 3 om de reactie te stoppen en bepalen de absorptie bij 420 nm. De blank is 700 pi ONPG oplossing plus 500 ul 1 M Na 2 CO 3.

Bereken Miller Units als volgt: Miller Units = (A420 * 1000) / (A600 * min * ml)

A420: absorptie-eenheden bij 420 nanometer; A600: absorptie-eenheden bij 600 nanometer, min: de reactietijd in minuten, ml: de reactie volume in ml

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

We voerden een test om te zien of we een colorimetrische uitlezing van de vereniging van PXR en steroïde receptor coactivator-1 (SRC-1) kunnen detecteren. Omdat gist aanzienlijke sterol productie is eerder aangetoond dat lacZ expressie in gist kan worden opgewekt zonder extra exogeen ligand. We vonden dat lacZ expressie (blauwe kolonies) ook wordt geïnduceerd in de giststam getransformeerd met PXR en SRC-1, maar er is geen inductie van LacZ expressie (witte kolonies) in gist getransformeerd met lege vectoren, PXR of SRC-1 individueel (Figuur 3). Om te bepalen of ketoconazol (25 uM) verstoord PXR en SRC-1 interactie in gist, werden replica platen die ketoconazol doorweekt met nitrocellulose en X-gal filter, lift, en β-galactosidase vloeistof testen werden uitgevoerd. We tonen aan dat ketoconazol verstoort PXR en SRC-1 interacties in gist omdat alle kolonies van de replica filter waren nu wit (dat wasook uit het aanzienlijk verminderd β-galactosidase activiteit door vloeibare enzymatische assays) (Figuur 4A). Wij hadden eerder zoogdieren assays die de PXR mutant (T248E/K277Q) kan worden geactiveerd door een sterke ligand (bijvoorbeeld rifampicine) weergegeven maar is immuun voor de negatieve effecten van ketoconazol 1 7. Ook wanneer we de engineering van de PXR dubbele mutant (T248E/K277Q) in de gist plasmide en vervolgens uitgevoerd gist transformaties met SRC-1, waren we in staat aan te tonen dat de koloniën blootgesteld aan ketoconazol hebben nog steeds LacZ expressie (Figuur 4B).

Figuur 1
Figuur 1. Schematische illustratie van de principes van de gist twee-hybride (Y2H) assay. Het gist test is vastgesteld als een functionele test die het mogelijk maakt voor isolatie van PXR mutanten die zijn resistant tot gemedieerde remming van SRC-1 interactie ketoconazol. A, rifampicine geïnduceerd twee-hybride interactie van LexA-DB-hPXR fusieproteïne met SRC-1 gefuseerd aan GAL4-activeringsdomein (GAL4AC-SRC-1). De interactie resulteert in blauwe kolonies in een X-gal analyse vanwege de LacZ reporter. B, aanwezigheid van ketoconazol verstoort de rifampicine-geïnduceerde interactie van hPXR met SRC-1. X-gal testresultaten in witte kolonies. C aanwezigheid van een mutatie (aangeduid met een asterisk) in hPXR dat maakt het immuun voor de werking van ketoconazol een blauwe kolonie opleveren. D, een verdere modificatie van onze test in de toekomst nemen extra tweede plaats suppressor mutaties (geïllustreerd met halve maan) teniet het effect van de eerste mutatie die kan leiden tot de verstoring van hPXR-SRC-1 interactie en dus een witte kolonie in de X-gal assay. LexAOp, LexA operon, Galp, Gal4 promotor, Lac Z, beta-glalactosidase, DB, LexAOp DNA-bindende domein van Galp, AC, activation domein; *, mutatie (s). (Overgenomen uit referentie 6). Klik hier om een grotere afbeelding te bekijken .

Figuur 2
Figuur 2. Experimentele Flow Chart.

Figuur 3
Figuur 3. X-gal, lift-test, en β-gal vloeistof assay. Gist werd getransformeerd met aangegeven plasmiden en vergulde kolonies onderworpen aan X-gal lift assay (linker paneel) en β-gal vloeistof assay (rechter paneel). PSH lege vector + pGADNOT lege vector (baan 1); PSH-PXR + pGADNOT lege vector (baan 2); PSH lege vector + pGADNOT-SRC-1 (baan 3); PSH-PXR + pGADNOT-SRC-1 (baan 4 </ Em>); 5. PSH-INI-1 + pGADNOT-c-Myc (positieve controle; laan 5). (Overgenomen uit referentie 6).

Figuur 4
Figuur 4. Ketoconazol verstoort wild-type, maar niet mutant PXR associatie met coactivator, SRC-1 Gist kolonies waren replica in platen met het voertuig. (0,2% DMSO; baan 1) of ketoconazol (25 micrometer; laan 2). X-gal lift assay (linker paneel) en β-gal vloeistof assay (rechter paneel) werden vervolgens uitgevoerd. Wild-type PXR (A, B lijn 1 en 2) en ketoconazol mute mutant T248E/K277Q (B lijn 3 en 4) werden in deze figuur weergegeven. (Overgenomen uit referentie 6).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

In onze gewijzigde Y2H test, hebben we belangrijke residuen voor ketoconazol interacties op PXR 6 geïdentificeerd. Omdat SRC-1 een coactivator (en werd gekloneerd in de vector pGADNot), hebben we ook getest of SRC-1 lacZ expressie kan activeren wanneer gekloneerd in de PSH vectorsysteem en of de activatie profiel zou veranderen en / of beïnvloeden van leakiness de gist two-hybrid. Met onze vernieuwde plasmiden voerden we twee-hybride assays erg3 Δ / ERG11 Δ gist. Zoals wordt aangetoond dat lacZ expressie (blauwe kolonies) ook geïnduceerd in erg3 Δ / ERG11 Δ giststam getransformeerd met PXR en SRC-1, maar er is geen inductie van LacZ expressie (witte kolonies) in gist getransformeerd met lege vectoren , PXR of SRC-1 individueel (gegevens niet getoond). Onze aanpak biedt een krachtige nieuwe methode voor de isolatie van genetische interactie allosteric ligand-eiwit residuen voor eiwitten niet vatbaar is voor conventioNAL structurele biologie en / of proteomics benadert 5,21.

Het protocol zoals beschreven heeft een aantal valkuilen die moeten worden erkend. Eerst detectiegevoeligheid, vooral die gedeeltelijke antagonist effect van eiwit-eiwitinteractie resten de resolutie van de assay beperken. Colorimetrische scannen kan helpen bij het ​​oplossen sommige van de detectie geeft 21. Ten tweede kan de aanwezigheid van blauwe kolonies niet altijd aangeven ketoconazol resistent PXR mutaties (vals positief). De lacZ expressie kan worden gered in aanwezigheid van ketoconazol door mutatie (s) in PXR dat het eiwit constitutief actieve of actieve onafhankelijk van SRC-1 interactie maakt. Dergelijke mutanten van PXR kan worden onderscheiden van de ware ketoconazol resistente mutanten door het testen van het vermogen van de LexA-DB-PXR om zelf activeren lacZ expressie, namelijk deze mutanten zullen blauwe kolonies op in afwezigheid van GAL4AC-SRC-1. In het verlengde hiervan de mutanten kan aldus ingebracht in gist met de GAL4AC-plasmide in de afwezigheid van LexA-DB-SRC-1 bewijs beschrijven verder voor zelf-activatie van LacZ. Ten derde onbekend blijft indien hetzelfde resultaat worden verkregen wanneer andere Y2H protocollen / vectoren werden gebruikt 13. Ten vierde kan de studie van intramoleculaire revertant mutanten (tweede plaats suppressormutanten van ketoconazol-resistente mutanten) aan het begrip van antagonist binden door het definiëren naburige residuen die invloed hebben op de bindende farmacofoor. Bij een wijziging van de bibliotheek van mutanten, kan men deze nauwkeuriger definiëren met een ketoconazol-resistente mutant als mutagenese template.

Deze methode kan worden aangepast aan een geneesmiddel waarbij het cytotoxische doel in gist is goed ingeburgerd of een geneesmiddel (en) dat geen mogelijke toxiciteit naar gist bevatten. De gist kan worden gewijzigd, zoals we hebben laten zien 6, en haalbaar voor Y2H assays nog. De kracht van deze methode is ook afhankelijk van bijkomende informerenatie van andere testen (bijv. moleculaire docking) die site-specifieke interacties te informeren. Voorts zijn er specifieke nucleaire receptor / coregulator interacties (bijv. nurr77/LKB1; AR/PELP1) kan worden bestudeerd 22,23. De volgzaamheid van dit systeem is dat het draagbaar is, kan worden uitgevoerd binnen dagen in high throughput wijze en niet dure reagentia en methoden.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Geen belangenconflicten verklaard.

Acknowledgments

Dit werk werd ondersteund door de National Institutes of Health (NIH) subsidies CA127231 en The Damon Runyon Stichting Clinical Investigator Award (CI 1502) (SM). Wij willen professor Zdenek Dvorak bedanken van Palacky Universiteit Olomouc, Tsjechië voor zijn nuttige inzichten in de bespreking van de overdraagbaarheid van deze techniek om hun instelling en standaardisatie van het protocol.

Materials

Name Company Catalog Number Comments
Yeast Strain CTY10-5d erg3Δ/erg11Δ Our lab CTY10-5d yeast was double knocked out ERG3 and ERG11 (erg3Δ/erg11Δ) genes6 .
YPD Growth Medium BD Biosciences 630409
Difco Yeast Nitrogen Base (YNB) w/o Amino Acids and Ammonium Sulfate BD Biosciences 233520
Bacto Agar BD Biosciences 214010
CSM-His/-Leu Complete Supplement Mixture MP Biomedicals 4250-412
ONPG (o-Nitrophenyl Β-D- Galactopyranoside). Sigma-Aldrich N1127
2-Mercaptoethanol Sigma-Aldrich M6250
Luria Broth (LB) Sigma-Aldrich L3022
X-Gal Fisher BP-1615
Sonicated Salmon Sperm DNA boiled (10 mg/ml) Life Technology 156-017
Ampicillin Acros Organics 61177
Ketoconazole Sigma-Aldrich K1003
N,N-Dimethylformamide Acros Organics 326871000
Lithium Acetate Sigma-Aldrich L4158
50% PEG-3350 solution, filter-sterilized Sigma-Aldrich P-3640
Nitrocellulose Membrane Whatman 10402091
10 cm Petri Dish Fisher 875712
5'-ACCGGATCCCGATGAAGA AGGAGATGATCATGTCC-3' our lab PXR LBD forward primer for pSH2-1
5'-AGAGTCGACTCAGCTA CCTGTGATGCC -3' our lab PXR LBD reverse primer for pSH2-1
5'-TATAGC GGCCGCATGAGTG GCCTCGGGGACAGTTCATCC -3' our lab SRC-1 forward primer for pGADNOT
5'-GCGGTCGACTTATTCAGTCA GTAGCTG -3' our lab SRC-1 reverse primer for pGADNOT
Platinum PCR Supermix Invitrogen 11306-016
BamHI our lab R0136
SalI our lab R0138
NotI our lab R0189

DOWNLOAD MATERIALS LIST

References

  1. Kliewer, S. A., et al. An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway. Cell. 92, (1), 73-82 (1998).
  2. Blumberg, B., et al. a novel steroid and xenobiotic-sensing nuclear receptor. Genes Dev. 12, (20), 3195-3205 (1998).
  3. Biswas, A., Mani, S., Redinbo, M. R., Krasowski, M. D., Li, H., Ekins, S. Elucidating the 'Jekyll and Hyde' Nature of PXR: The Case for Discovering Antagonists. Pharm. Res. 26, (8), 1807-1815 (2009).
  4. Pondugula, S. R., Mani, S. Pregnane xenobiotic receptor in cancer pathogenesis and therapeutic response. Cancer Lett. 328, (1), 1-9 (2013).
  5. Mani, S., Dou, V., Redinbo, M. R. PXR antagonists and implications for drug metabolism. Drug Metab. Rev. 45, (1), 60-72 (2013).
  6. Li, H., et al. Novel Yeast-Based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR. J. Biol. Chem. 288, (19), 13655-13668 (2013).
  7. Hollenberg, S. M., et al. Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system. Mol. Cell. Biol. 15, (7), 3813-3822 (1995).
  8. Vojtek, A. B., Hollenberg, S. M., Cooper, J. A. Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell. 74, (1), 205-214 (1993).
  9. Wang, H., et al. The phytoestrogen coumestrol is a naturally occurring antagonist of the human pregnane X receptor. Mol. Endocrinol. 22, (4), 838-857 (2008).
  10. Kalpana, G. V., Goff, S. P. Genetic analysis of homomeric interactions of human immunodeficiency virus type 1 integrase using the yeast two-hybrid system. Proc. Natl. Acad. Sci. U.S.A. 90, (22), 10593-10597 (1993).
  11. Hamdi, A., Colas, P. Yeast two-hybrid methods and their applications in drug discovery. TiPS. 33, (2), 109-118 (2012).
  12. Battesti, A., Bouveret, E. The bacterial two-hybrid system based on adenylate cyclase reconstitution in Escherichia coli. Methods. 58, (4), 325-334 (2012).
  13. Caufield, J. H., Sakhawalkar, N., Uetz, P. A comparison and optimization of yeast two-hybrid systems. Methods. 58, (4), 317-324 (2012).
  14. Albers, M., et al. Automated yeast two-hybrid screening for nuclear receptor-interacting proteins. Mol. Cell Proteomics. 4, (2), 205-213 (2005).
  15. Takeshita, A., Taguchi, M., Koibuchi, N., Ozawa, Y. Putative role of the orphan nuclear receptor SXR (steroid and xenobiotic receptor) in the mechanism of CYP3A4 inhibition by xenobiotics. J. Biol. Chem. 277, (36), 32453-32458 (2002).
  16. Huang, H., et al. Inhibition of drug metabolism by blocking the activation of nuclear receptors by ketoconazole. Oncogene. 26, (2), 258-268 (2007).
  17. Wang, H., et al. Activated pregnenolone X- receptor is a target for ketoconazole and Its analogs. Clin. Cancer Res. 13, (8), 2488-2495 (2007).
  18. Ghannoum, M. A., Rice, L. B. Antifungal agents: mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance. Clin. Microbiol. Rev. 12, (4), 501-517 (1999).
  19. Kaur, R., Bachhawat, A. K. The yeast multidrug resistance pump, Pdr5p, confers reduced drug resistance in erg mutants of Saccharomyces cerevisiae. Microbiology. 145, 809-818 (1999).
  20. White, T. C., Marr, K. A., Bowden, R. A., cellular, Clinical, cellular, and molecular factors that contribute to antifungal drug resistance. Clin. Microbiol. Rev. 11, (2), 382-402 (1998).
  21. Serebriiskii, I. G., et al. Detection of peptides, proteins, and drugs that selectively interact with protein targets. Genome Res. 12, 1785-1791 (2002).
  22. Yang, L., et al. Central role for PELP1 in nonandrogenic activation of the androgen receptor in prostate cancer. Mol Endocrinol. 26, (4), 550-561 (2012).
  23. Zhan, Y. Y., et al. The orphan nuclear receptor Nur77 regulates LKB1 localization and activates AMPK. Nat Chem Biol. 8, (11), 897-904 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics