प्लाज्मिड व्युत्पन्न कार्यान्वयन केमिकल रिएक्शन नेटवर्क के लिए डीएनए किनारा विस्थापन गेट्स

Biology
 

Cite this Article

Copy Citation | Download Citations

Chen, Y. J., Rao, S. D., Seelig, G. Plasmid-derived DNA Strand Displacement Gates for Implementing Chemical Reaction Networks. J. Vis. Exp. (105), e53087, doi:10.3791/53087 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

वाटसन-क्रिक आधार बाँधना के predictability गतिशील डीएनए नैनो गतिशील गुण 1,2 के साथ आणविक उपकरणों डिजाइन करने के लिए एक प्रोग्राम तरीके के रूप में उभरने के लिए अनुमति दी गई है। विशेष रूप से, डीएनए किनारा विस्थापन - एक प्रोग्राम, प्रतिस्पर्धी संकरण प्रतिक्रिया - गतिशील डीएनए सिस्टम इंजीनियरिंग के लिए एक शक्तिशाली तंत्र साबित हुई है। एक डीएनए किनारा विस्थापन प्रतिक्रिया में, एक आने वाली oligonucleotide एक पूरक बाध्यकारी साथी से एक पहले से ही "उत्पादन" किनारा विस्थापित। एकाधिक ऐसी प्रतिक्रियाओं आदेश और अलग-अलग प्रतिक्रिया के समय 3 कदम पर नियंत्रण का एक उच्च डिग्री के साथ बहु कदम प्रतिक्रिया झरने में एक साथ जंजीर जा सकता है। डीएनए किनारा विस्थापन झरने डिजिटल और एनालॉग आणविक सर्किट 4-7, switchable nanostructures 8-10, स्वायत्त आणविक मोटर्स 11-15, और न सहसंयोजक उत्प्रेरक एम्पलीफायरों 13,16-21 बनाने के लिए इस्तेमाल किया गया है। इसके अलावा, डीकतरा विस्थापन प्रतिक्रियाओं का उपयोग कर एनए उपकरणों नकली और कंप्यूटर की मदद से डिजाइन सॉफ्टवेयर 22-24 का उपयोग कर विभिन्न अनुप्रयोगों के लिए तैयार किया जा सकता है।

वर्तमान में, रासायनिक संश्लेषित डीएनए डीएनए नैनो के लिए मुख्य सामग्री के रूप में कार्य करता है। हालांकि, डीएनए संश्लेषण की प्रक्रिया में त्रुटियों, और जिसके परिणामस्वरूप अपूर्ण oligonucleotides, गलत साइड प्रतिक्रियाओं के कारण द्वारा गतिशील डीएनए उपकरणों के प्रदर्शन को सीमित करने के लिए माना जाता है। उदाहरण के लिए, 'लीक' प्रतिक्रियाओं भी एक प्रतिक्रिया ट्रिगर के अभाव में एक उत्पादन oligonucleotide की रिहाई हो सकती है। इस तरह के प्रभाव प्रारंभिक रिसाव की भी एक न्यूनतम राशि के अंत में झरना 19,20 से भरा सक्रियण में परिणाम होगा जहां autocatalytic प्रतिक्रिया झरने में सबसे स्पष्ट कर रहे हैं। इसके विपरीत, प्रतिक्रियाओं अक्सर कुछ घटक भी इरादा इनपुट 7,25 की उपस्थिति में ट्रिगर नहीं है क्योंकि सक्रियण की उम्मीद स्तर तक पहुंचने में विफल। का प्रदर्शन करने के लिए डीएनए आधारितउनके जैविक प्रोटीन आधारित समकक्षों के लिए तुलनीय nanodevices, ऐसी त्रुटि मोड नाटकीय रूप से कम होने की जरूरत है।

बैक्टीरियल प्लास्मिडों या अन्य जैविक डीएनए नैनो अनुप्रयोगों के लिए अत्यधिक शुद्ध डीएनए के एक अपेक्षाकृत सस्ते स्रोत के रूप में काम आ सकते हैं। डीएनए की बड़ी मात्रा में बैक्टीरिया में प्रतिकृति द्वारा उत्पन्न किया जा सकता है और रहने वाले सिस्टम की आंतरिक प्रूफरीडिंग क्षमताओं जिसके परिणामस्वरूप डीएनए की पवित्रता सुनिश्चित करते हैं। वास्तव में, हाल ही में कई कागजात नैनो अनुप्रयोगों 21,26-28 के लिए जैविक डीएनए की क्षमता उपयोगिता को मान्यता दी है। हालांकि, डीएनए की पूरी तरह से डबल असहाय प्रकृति अब तक आम तौर पर कई oligonucleotides से मिलकर बनता है और असहाय-डबल और एकल असहाय डोमेन दोनों होते हैं, जो गतिशील डीएनए उपकरणों, बनाने के लिए एक सामग्री के रूप में इसके उपयोग पर रोक लगा दी। हाल ही में एक पेपर 29 इस मुद्दे को संबोधित किया गया था और मुख्य रूप से nicked डबल असहाय डीएनए (ndsDNA) के होते हैं कि एक नई डीएनए गेट वास्तुकला में लागू थाघ।

महत्वपूर्ण बात है, ndsDNA फाटक के सिस्टम किसी भी औपचारिक रासायनिक प्रतिक्रिया नेटवर्क (CRN) 29 द्वारा निर्दिष्ट गतिशीलता का एहसास है कि बनाया जा सकता है। ndsDNA फाटकों इस प्रकार दोलनों और अराजकता, bistability और स्मृति, बूलियन तर्क या एल्गोरिथम व्यवहार 30-38 है कि प्रदर्शन के dynamical सिस्टम बनाने के लिए सिद्धांत रूप में, इस्तेमाल किया जा सकता है। उदाहरण के लिए, रेफरी। 29 एक 'आम सहमति' प्रोटोकॉल का एक आणविक कार्यान्वयन, वितरित कंप्यूटिंग एल्गोरिथ्म 29,39,40 का एक प्रकार प्रदान की है कि एक तीन प्रतिक्रिया CRN का प्रदर्शन किया। इस काम में पहले से तेजी से कार्यात्मक आणविक सिस्टम (चित्रा 1 ए) synthesizing के लिए एक "प्रोग्रामिंग भाषा के रूप में" CRN रीतिवाद के लिए एक उपन्यास उपयोग का प्रदर्शन किया।

इधर, प्लास्मिड डीएनए से ndsDNA फाटकों पाने के लिए एक विस्तृत प्रोटोकॉल प्रदान की जाती है। पहले क्रम डिजाइन की प्रक्रिया की समीक्षा की है। तब से युक्त कैसे सिंथेटिक oligonucleotides की एक व्याख्या इस प्रकार हैगेट दृश्यों प्लास्मिडों में क्लोन कर रहे हैं और अनुक्रम सत्यापित और बैक्टीरियल संस्कृति के माध्यम से परिलक्षित। NdsDNA फाटकों एंजाइमी प्रसंस्करण द्वारा प्लास्मिडों से प्राप्त किया जा सकता है कि कैसे इसके बाद, यह दिखाया गया है (देखें चित्र 2)। अंत में, प्रतिदीप्ति कैनेटीक्स assays का उपयोग गेट व्यवहार के परीक्षण के लिए एक विधि उल्लिखित है।

प्रतिक्रिया तंत्र
एक उदाहरण के रूप में, प्रोटोकॉल उत्प्रेरक रासायनिक प्रतिक्रिया ए + बी> ख + ग पर केंद्रित है। प्रजातियों ए, बी, और सी ("संकेत", चित्रा 1 बी) सब एक अलग एकल असहाय डीएनए अणु के अनुरूप हैं। इन अणुओं के दृश्यों को पूरी तरह से स्वतंत्र हैं और किस्में सीधे एक दूसरे के साथ प्रतिक्रिया नहीं है। सभी संकेतों के दृश्यों यानी दो अलग कार्यात्मक डोमेन, कतरा विस्थापन प्रतिक्रियाओं में एक साथ काम करते हैं कि subsequences है: 1) एक छोटी toehold डोमेन (लेबल कतरा विस्थापन आर की दीक्षा के लिए प्रयोग किया जाता है कि, टीबी, टीसी) टाeaction, और 2) एक लंबे डोमेन (क, ख, ग) संकेत है कि पहचान को निर्धारित करता है लेबल।

संकेत किस्में के बीच सहभागिता nicked डबल असहाय डीएनए (ndsDNA) गेट परिसरों से और सहायक एकल असहाय प्रजातियों (<टीआर R>, <टीबी ग> और <टीआर b> <मैं टीसी (बुलाया अटल बिहारी और कांटा ईसा पूर्व में शामिल होने) मध्यस्थता कर रहे हैं >)। + बी> बी + सी औपचारिक प्रतिक्रिया एक प्रत्येक प्रतिक्रिया कदम बाद में एक प्रतिक्रिया (चित्रा 1 बी) के लिए एक toehold को उजागर करता है, जहां कतरा विस्थापन प्रतिक्रिया कदम की एक श्रृंखला के माध्यम से क्रियान्वित किया जाता है। संकेत सी कांटा गेट के लिए बाध्य है, जबकि इस उदाहरण में, संकेतों और बी शुरू में समाधान में स्वतंत्र हैं। प्रतिक्रिया बी और सी के अंत में समाधान में हैं। आम तौर पर, एक फाटक के लिए बाध्य कर रहे हैं संकेत है कि समाधान में स्वतंत्र हैं कि संकेतों सक्रिय हैं, जबकि वह यह है कि वे एक कतरा विस्थापन प्रतिक्रिया के रूप में भाग ले सकते हैं निष्क्रिय हैंएक इनपुट। प्रतिक्रिया के समय के पाठ्यक्रम एक फ्लोरोसेंट रिपोर्टर रणनीति (चित्रा 1 सी) का उपयोग किया जाता है। पिछले काम 29 में, यह इस प्रतिक्रिया तंत्र सही stoichiometry लेकिन यह भी लक्ष्य प्रतिक्रिया के कैनेटीक्स पता चलता है कि न केवल प्रदर्शन किया गया।

Protocol

1. अनुक्रम डिजाइन

नोट: अनुक्रम डिजाइन अवलोकन: इस खंड में, प्लाज्मिड व्युत्पन्न डीएनए फाटकों को डिजाइन करने के लिए रणनीति में वर्णित है। फाटक के दोनों छोर पर रखा एनजाइम साइटों पाचन के बाद पूरी तरह से डबल असहाय फाटकों की रिहाई के लिए अनुमति देने के लिए। Nicking साइटों तो एंजाइमों अंतिम ndsDNA फाटक बनाने के लिए शीर्ष किनारा पर खरोंच बना है कि इस तरह रखा जाता है। अंत में, शेष दृश्यों स्वतंत्र डोमेन के एक दूसरे के orthogonal हैं और माध्यमिक संरचना का प्रदर्शन नहीं करते हैं कि इस तरह चुना जाता है।

  1. चार न्यूक्लियोटाइड दूर एक लंबी डोमेन के 3 'अंत से Nt.BstNBI Nicking साइट की जगह (ए, बी, सी, आर, और मैं)। (। ए, बी, सी, और आर डोमेन मैं किसी भी Nb.BsrDI nicking साइट नहीं है कि नोट) प्रत्येक लंबी डोमेन के 5 'अंत पर Nb.BsrDI Nicking साइट रखें। चित्रा -2 की विस्तृत अनुक्रम को देखने से पता चलता है अटल बिहारी और कांटा ई.पू. फाटकों में शामिल हों।
  2. PvuII पाचन प्लास्मिडों से फाटक जारी कर सकते हैं कि इतने ndsDNA फाटक के दोनों सिरों पर PvuII प्रतिबंध साइट की जगह (चित्रा -2 सी देखें)।
  3. (क) किस्में (डीएनए संरचना Nupack 41 का उपयोग करते हुए भविष्यवाणी की जा सकती है) माध्यमिक संरचनाओं का प्रदर्शन नहीं करना चाहिए, और (ख) सभी डोमेन crosstalk को कम करने के लिए ओर्थोगोनल होना चाहिए: दो सिद्धांतों का पालन करते हुए अन्य स्वेच्छापूर्ण दृश्यों डिजाइन।
  4. एक गेट टेम्पलेट के केंद्र में ndsDNA दृश्यों रखें। गेट टेम्पलेट के दोनों सिरों पर 30-40 बीपी यादृच्छिक स्पेसर दृश्यों की जगह, प्रत्येक स्पेसर निम्नलिखित पोलीमरेज़ चेन रिएक्शन (पीसीआर) के लिए एक अनूठा बाध्यकारी साइट के रूप में कार्य करता है।

प्लास्मिड में NdsDNA गेट्स 2. क्लोनिंग

नोट: इस खंड में एक प्लाज्मिड रीढ़ की हड्डी में गेट की 4 प्रतियां डालने के लिए गिब्सन क्लोनिंग विधि का वर्णन है।

  1. एक डीएनए निर्माता से डबल असहाय जीनोमिक ब्लॉक के रूप में आदेश ndsDNA गेट टेम्पलेट्स (गेट टेम्पलेट दृश्यों को दिखाया जाता हैतालिका 1 में; किस्में तालिका 2 में दिखाया जाता है ndsDNA फाटकों में होते हैं; डोमेन स्तर दृश्यों) तालिका 3 में दिखाया जाता है।
  2. आदेश डीएनए प्राप्त करने के बाद, सभी सूख डीएनए ट्यूब के नीचे है कि यह सुनिश्चित करने के लिए 1 मिनट के लिए 10,000-14,000 XG पर जीनोमिक ब्लॉकों युक्त ट्यूबों स्पिन।
  3. 10 एनजी / μl के अंतिम एकाग्रता को प्राप्त करने के लिए DNase मुक्त पानी में सूखे जीनोमिक ब्लॉकों Resuspend।
    नोट: वैकल्पिक रूप से, डीएनए 1x Tris ethylenediaminetetraacetic एसिड (EDTA) बफर का उपयोग resuspended जा सकता है (ते बफर: 10 मिमी Tris और 1 मिमी EDTA, पीएच 8.0)। हालांकि, EDTA द्विसंयोजक फैटायनों के लिए एक chelating एजेंट है और पीसीआर को बाधित कर सकता है।
  4. एक उच्च निष्ठा डीएनए पोलीमरेज़ के साथ एक मानक पीसीआर के माध्यम से विभिन्न ओवरलैप क्षेत्रों (चित्रा 3 देखें) के साथ 4 गेट टुकड़े उत्पन्न। प्राइमर दृश्यों तालिका 4 में विस्तृत रहे हैं (इन प्राइमरों के पिघलने के तापमान 62 डिग्री सेल्सियस होता है)।
  5. 1 पर एक 2% agarose जेल भागोआरटी पर 30 मिनट के लिए 40 वी जेल से बाहर टुकड़ा प्रवर्धित (एक विस्तृत agarose जेल वैद्युतकणसंचलन प्रोटोकॉल के लिए 42 देखें) और प्रत्येक पीसीआर के लिए इसी बैंड में कटौती। तब निर्माता के निर्देशों के बाद एक जेल निकालना किट (सामग्री को देखें) का उपयोग कर जेल स्लाइस शुद्ध।
  6. निर्माता प्रोटोकॉल के अनुसार 1 घंटा (5 तालिका देखें) के लिए 37 डिग्री सेल्सियस पर PvuII-एचएफ और PstI-एचएफ के साथ एक उच्च प्रतिलिपि संख्या प्लाज्मिड रीढ़ की हड्डी (सामग्री देखें) डाइजेस्ट। PvuII-एचएफ और PstI-एचएफ नाटकीय रूप से unspecific कटौती को कम जो उच्च निष्ठा प्रतिबंध एंजाइमों, कर रहे हैं।
  7. Linearized रीढ़ की हड्डी एक 1.5% agarose जेल चलाने के लिए और कटौती (आमतौर पर आरटी पर 30-40 मिनट के लिए 140 वी पर जेल चलाने के लिए)। तब निर्माता के निर्देशों का पालन जेल निकालना किट का उपयोग कर जेल टुकड़ा से डीएनए निकाल सकते हैं।
  8. Linearized वेक्टर और शुद्ध पीसीआर टुकड़े के साथ गिब्सन विधानसभा 43 प्रदर्शन करना (टेबल 6 और चित्रा 3B देखें
  9. (100 माइक्रोग्राम / एमएल की एकाग्रता में) एम्पीसिलीन एंटीबायोटिक दवाओं युक्त एक Lysogeny शोरबा (पौंड) अगर प्लेट पर कोलाई (ई कोलाई) और थाली में 2.8 कदम से गिब्सन विधानसभा उत्पाद रूपांतरण। Electroporation या एक गर्मी झटका विधि 44,45 के माध्यम से परिवर्तन करते हैं, और उचित का उपयोग कोलाई तनाव। उदाहरण के लिए, का उपयोग कोलाई तनाव गर्मी झटका परिवर्तन के लिए JM109, और DH5α electrocompetent का उपयोग electroporation के लिए कोलाई कोशिकाओं।
    नोट: इस्तेमाल किया प्लाज्मिड रीढ़ की हड्डी एक एम्पीसिलीन प्रतिरोध कैसेट में शामिल है। एक अलग चयन मार्कर का उपयोग करते हैं, बजाय एम्पीसिलीन की उचित एंटीबायोटिक दवाओं का उपयोग करें।

3. जीवाणु संस्कृति प्रवर्धन और गुणवत्ता नियंत्रण

नोट: इस खंड में गुणवत्ता नियंत्रण के बाद डीएनए फाटकों युक्त plasmids के बड़े पैमाने पर उत्पादन और अलगाव का वर्णन है।

  1. एक भी कॉलोनी उठाओ2.9 कदम से एम्पीसिलीन चयनात्मक थाली से और 3 मिलीलीटर एम्पीसिलीन एंटीबायोटिक दवाओं युक्त समृद्ध माध्यम की एक संस्कृति सेते (100 माइक्रोग्राम / एमएल की एकाग्रता में)। यह बाद में प्रयोगात्मक चरणों में फिर से उपयोग किया जा सकता है कि इस तरह कॉलोनी के निशान। जोरदार झटकों के (200-300 आरपीएम) के साथ 37 डिग्री सीओ / एन पर संस्कृति विकसित। आमतौर पर, 16-24 घंटे के लिए सेते हैं।
  2. निर्माता के निर्देशों के बाद एक मिनी प्रस्तुत किट का उपयोग जीवाणु संस्कृति से प्लास्मिड डीएनए निकालें।
  3. निर्माता के निर्देशों का पालन एक स्पेक्ट्रोफोटोमीटर का उपयोग कर शुद्ध प्लास्मिड डीएनए उपाय। 50-1,000 एनजी / μl से ठेठ उपज पर्वतमाला।
  4. एक डीएनए अनुक्रमण कंपनी के लिए नमूना भेजने के द्वारा अनुक्रम निकाले प्लास्मिड डीएनए जाओ। अनुक्रमण प्राइमरों नदी के ऊपर के बारे में 100 न्यूक्लियोटाइड स्थित होना चाहिए और इस क्षेत्र के बहाव के अनुक्रम किया जा करने के लिए; प्लाज्मिड के लिए अनुक्रमण प्राइमर (प्लाज्मिड के लिए सामग्री देखें) निम्नलिखित अनुक्रम है: ATTACCGCCTTTGAGTGAGC।
    नहींते: अनुक्रम त्रुटि या डाला ndsDNA फाटकों में पुनर्संयोजन नहीं है, तो 2.9 कदम से थाली से एक अलग कॉलोनी का चयन करें। पालन ​​डाला फाटक के दृश्यों सही हैं कि यह पुष्टि करने के लिए 3.1-3.4 कदम।
  5. दृश्यों सही हैं कि पुष्टि करने के बाद, (2.9 कदम से) एम्पीसिलीन चयनात्मक थाली से इसी कॉलोनी लेने, और (100 माइक्रोग्राम / एमएल की एकाग्रता में) एम्पीसिलीन एंटीबायोटिक दवाओं युक्त 800 मिलीलीटर भयानक शोरबा (टीबी) की एक संस्कृति सेते हैं। जोरदार झटकों के (200-300 आरपीएम) के साथ 16-24 घंटे के लिए 37 डिग्री सेल्सियस पर संस्कृति विकसित। टीबी विशेष रूप से उच्च उपज प्लाज्मिड उत्पादन के लिए अच्छी तरह से अनुकूल है।
    नोट: प्लाज्मिड उपज एक मुद्दा हो सकता है, हालांकि वैकल्पिक रूप से, पौंड भी बैक्टीरिया विकसित करने के लिए इस्तेमाल किया जा सकता है।
  6. निर्माता के निर्देशों का पालन एक मैक्सी प्रस्तुत करने का किट का उपयोग डीएनए शुद्ध।
  7. दृश्यों सही हैं या नहीं यह जांच करने के लिए कदम 3.3-3.4 का पालन करें। किसी भी पुनर्संयोजन हुआ, तो निम्न नोट देखें। अन्यथा, 4. कदम पर चलते हैं <br /> नोट: यहाँ एक संभव मुद्दा प्लाज्मिड में डाला फाटकों की कई प्रतियां डीएनए की मरम्मत के कारण recombine सकता है। इस समस्या का समाधान करने के लिए, एक का उपयोग ऐसे JM109 या DH5α रूप Reca प्रोटीन (डीएनए की मरम्मत से संबंधित एक प्रोटीन) की कमी कोलाई तनाव (किसी भी क्रम त्रुटियों और पुनर्संयोजन के बिना, यानी) एक पहले से अनुक्रम-सत्यापित प्लाज्मिड को बदलने की। तो फिर इस थाली से एक कॉलोनी उठाओ और एक डीएनए अनुक्रमण कंपनी के लिए नमूना भेजने के द्वारा प्लाज्मिड अनुक्रम की जाँच करें।

4. एंजाइमी प्रसंस्करण

नोट: इस खंड में वे कटौती और सही स्थानों में nicked और कैनेटीक्स प्रयोगों के लिए इस्तेमाल किया जा करने के लिए तैयार कर रहे हैं कि इस तरह के प्लास्मिडों पचाने के लिए प्रक्रिया का वर्णन करता है।

  1. 37 डिग्री सेल्सियस (तालिका 7 देखें) पर 1 घंटे के लिए प्रतिबंध एंजाइम PvuII-एचएफ के साथ कदम 3.7 से शुद्ध प्लास्मिड डीएनए डाइजेस्ट। आमतौर पर प्लाज्मिड के 1 मिलीग्राम प्रति PvuII-एचएफ की 4 इकाइयों के साथ प्लाज्मिड पचाने। उच्च खूंटीवे नाटकीय रूप से unspecific कटौती को कम क्योंकि elity प्रतिबंध एंजाइमों उपयोग के लिए सिफारिश कर रहे हैं।
  2. नमूना पर इथेनॉल प्रदर्शन करते हैं।
    1. नमूने के लिए ठंडा पूर्ण इथेनॉल के 2 बराबर मात्रा में जोड़ें।
    2. कम से कम 1 घंटा (इस मिश्रण भी हे / N के लिए -80 डिग्री सेल्सियस पर बैठ सकते हैं) के लिए -80 डिग्री सेल्सियस पर मिश्रण सेते हैं।
    3. 30 मिनट के लिए 0 डिग्री सेल्सियस पर 10,000-14,000 XG पर अपकेंद्रित्र।
    4. सतह पर तैरनेवाला निकालें।
    5. नमूने के लिए आर टी 95% इथेनॉल के 1,000 μl जोड़ें, और 10-15 बार पलटना।
    6. 10 मिनट के लिए 4 डिग्री सेल्सियस पर 10,000-14,000 XG पर अपकेंद्रित्र।
    7. 10-20 मिनट के लिए बेंच पर सतह पर तैरनेवाला और शुष्क हवा निकाल दें।
    8. Nuclease मुफ्त एच 2 ओ (आमतौर पर 100-200 μl) का एक उचित मात्रा में डीएनए छर्रों Resuspend। 200 से अधिक μl जोड़ना आम तौर पर नमूना भी कैनेटीक्स प्रयोगों में इस्तेमाल के लिए पतला कर देगा।
  3. मीटर के बाद एक स्पेक्ट्रोफोटोमीटर का उपयोग resuspended डीएनए उपायanufacturer के निर्देशों।
  4. डाइजेस्ट (तालिका 8 देखें) प्लाज्मिड के एक माइक्रोग्राम प्रति एंजाइम की 4 इकाइयों का उपयोग कर 1 घंटे के लिए 65 डिग्री सेल्सियस पर एंजाइम Nb.BsrDI nicking साथ फाटकों में शामिल होने के; प्लाज्मिड के एक माइक्रोग्राम प्रति एंजाइम के 8 इकाइयों का उपयोग कर 1 घंटे के लिए 55 डिग्री सेल्सियस पर एंजाइम Nt.BstNBI nicking साथ कांटा फाटकों को पचाने (तालिका 9 देखें)।
    नोट: चरण 4.2 एंजाइम पाचन बफर हटा और कैनेटीक्स प्रयोगों के लिए फाटक ध्यान केंद्रित करने में मदद करता। प्रतिबंध एंजाइम PvuII-एचएफ और nicking एंजाइम दोनों ही पाचन बफर हिस्सा Nb.BsrDI क्योंकि फाटकों में शामिल होने के लिए 4.2 कदम को छोड़ दिया जा सकता है। EDTA द्विसंयोजक फैटायनों के लिए एक chelating एजेंट है और कार्य करने के लिए इन आयनों की जरूरत है कि प्रतिबंध एंजाइमों को बाधित कर सकते हैं, क्योंकि कदम 4.2.8 में, Nuclease मुफ्त एच 2 ओ बजाय ते का प्रयोग किया जाता है।
    नोट: एंजाइमों की अतिरिक्त मात्रा के अलावा सबसे अधिक संभावना अधिक-पाचन 46 के कारण होता है जो प्रारंभिक सर्किट रिसाव (चित्रा 4), की उच्च मात्रा में पैदा हो सकती है। यह समस्या सीएएन एंजाइम मात्रा में अनुकूलन के द्वारा संबोधित किया जाना (चित्रा 4 देखें)। एंजाइमों की विशिष्ट श्रेणी 1-10 इकाइयों / 1 ग्राम प्लाज्मिड से है।

एकल असहाय oligonucleotides 5. तैयारी

नोट: इस खंड में resuspending और संकेत किस्में और सहायक किस्में के लिए इस्तेमाल किया जाएगा कि रासायनिक synthetized एकल असहाय डीएनए (ssDNA) quantitating के लिए प्रोटोकॉल का वर्णन है। कतरा दृश्यों के लिए मेज 10 देखें। निम्नलिखित प्रोटोकॉल 10 माइक्रोन ssDNA तैयारी का एक उदाहरण है कि ध्यान दें। SsDNA की अन्य सांद्रता इसी तरह तैयार किया जा सकता है।

  1. डीएनए निर्माता से ओलिगोस प्राप्त करने के बाद, सभी सूख डीएनए ट्यूब के नीचे है कि यह सुनिश्चित करने के लिए 1 मिनट के लिए 10,000-14,000 XG पर डीएनए युक्त ट्यूबों स्पिन।
  2. 100 सुक्ष्ममापी के अंतिम एकाग्रता को प्राप्त करने के लिए: (10 मिमी Tris और 1mm EDTA, पीएच 8.0 ते बफर) 1x Tris ethylenediaminetetraacetic एसिड (EDTA) बफर का उपयोग डीएनए Resuspend। के लिएउदाहरण के लिए, ते बफर के 80 μl में डीएनए के 8 nmol resuspend।
  3. 10 माइक्रोन के अंतिम एकाग्रता को प्राप्त करना चाहिए जो एक microcentrifuge ट्यूब में आणविक पानी के 90 μl, के साथ 100 माइक्रोन से डीएनए के 10 μl मिलाएं।
  4. निर्माता के निर्देशों का पालन एक स्पेक्ट्रोफोटोमीटर का उपयोग डीएनए नमूने की सटीक एकाग्रता उपाय। निम्नलिखित प्रोटोकॉल डीएनए एकाग्रता मापा जा सकता है की एक उदाहरण देता है।
    1. आणविक पानी के 2 μl साथ स्पेक्ट्रोफोटोमीटर खाली।
    2. डीएनए नमूने की 260 एनएम (ए 260) पर absorbance के उपाय। शेयर एकाग्रता की गणना करने के लिए निम्न समीकरण का प्रयोग करें।
      नोट: नमूना एकाग्रता एम ए 260 / विलुप्त होने के गुणांक = है। विलुप्त होने के गुणांक डीएनए निर्माता द्वारा विनिर्देश datasheet पर पाया जा सकता है।

फ्लोरोसेंट संवाददाताओं से 6. तैयारी

नोट: इस खंड का वर्णनरिपोर्टर सी तैयारी के लिए प्रोटोकॉल, अन्य फ्लोरोसेंट संवाददाताओं इसी तरह इकट्ठा किया जा सकता है।

  1. उच्च प्रदर्शन तरल क्रोमैटोग्राफी (एचपीएलसी) शुद्ध oligonucleotides के आदेश ROX- <ग * टीसी *> (रिपोर्टर सी के शीर्ष किनारा) और <ग> -RQ डीएनए निर्माता से (रिपोर्टर सी के नीचे किनारा) (दृश्यों के लिए टेबल 10 देखें )।
  2. और संश्लेषित oligonucleotides, resuspend प्राप्त करने के बाद के रूप में चरण 5 में विस्तार से बताया नमूने quantitate।
  3. 12.5 मिमी मिलीग्राम के साथ संवाददाता शीर्ष और 1x Tris- एसीटेट EDTA (TAE) में नीचे की किस्में (यानी, ROX- <ग * टीसी *> और <ग> -RQ) मिक्स 2 + (विस्तृत नुस्खा के लिए तालिका 11 देखना )। यहां 30% अतिरिक्त पेय लेबल कतरा <ग> -RQ सभी fluorophore लेबल किस्में भी अपूर्ण stoichiometry साथ बुझती सुनिश्चित करता है कि जो पत्रकार, इकट्ठा करने के लिए जोड़ा जाता है कि ध्यान दें।
  4. 1 डिग्री सेल्सियस / मिनट की दर से 20 डिग्री सेल्सियस से 95 डिग्री सेल्सियस से ठंडा, एक थर्मल cycler का उपयोग कर रिपोर्टर सी जटिल पानी रखना। नमूने 4 डिग्री सेल्सियस पर संग्रहित किया जा सकता है।

7. प्रतिदीप्ति माप

नोट: खंड प्रतिदीप्ति कैनेटीक्स माप (प्रायोगिक प्रक्रिया के लिए चित्रा 5) के लिए एक सामान्य प्रोटोकॉल का वर्णन करता है, और इस प्रोटोकॉल कदम 8, 9 में इस्तेमाल किया जाएगा, और 10 इसके अलावा इस प्रोटोकॉल एक spectrofluorimeter के इस्तेमाल के लिए है कि ध्यान दें। संवेदनशीलता, अच्छी तरह से करने के लिए अच्छी तरह से विविधताओं और लंबी अवधि के प्रयोगों में तापमान नियंत्रण के अभाव में एक मुद्दा हो सकता है, हालांकि वैकल्पिक रूप से, इन प्रयोगों में भी एक प्लेट रीडर में प्रदर्शन किया जा सकता है।

  1. 25 डिग्री सेल्सियस तक तापमान नियंत्रक सेट है, और तापमान को स्थिर करने के लिए प्रतीक्षा करें। एक तापमान नियंत्रक का प्रयोग तापमान परिवर्तन से परिणाम कर सकते हैं कि सिग्नल में परिवर्तनशीलता को कम कर सकते हैं।
  2. के लिए सेट उचित पैरामीटरspectrofluorimeter का डाटा अधिग्रहण सॉफ्टवेयर में आर कैनेटीक्स माप। के रूप में विस्तृत उदाहरण सेटिंग कर रहे हैं:
    1. दोनों उत्तेजना और उत्सर्जन monochromators के लिए 2.73 एनएम के लिए भट्ठा चौड़ाई सेट करें।
    2. हर 60 सेकंड समय बिंदु के लिए 10 सेकंड के लिए एकीकरण के समय निर्धारित करें। 24 घंटा के लिए कुल माप समय निर्धारित करें।
    3. प्रयोग में इस्तेमाल fluorophores के मैच के लिए उत्तेजना / उत्सर्जन तरंग दैर्ध्य सेट करें। Rox (588 एनएम / 608 एनएम), और Tamra (559 एनएम / 583 एनएम) इस प्रकार है: उदाहरण तरंग दैर्ध्य हैं।
  3. Nuclease मुफ्त एच 2 हे और एक सिंथेटिक क्वार्ट्ज सेल करने के लिए 125 मिमी 2 मिलीग्राम + (10x TAE / 2 मिलीग्राम +) युक्त 10x Tris- एसीटेट EDTA के बफर जोड़ें। उदाहरण के संस्करणों का उपयोग करने के लिए टेबल्स, 13, 12 और 14 देखें।
  4. ~ 1 माइक्रोन (देखें तालिका 12, 13, और मात्रा के लिए 14) के अंतिम एकाग्रता को प्राप्त करने के POLYT किस्में जोड़ें, और उसके सिंथेटिक भंवर10-15 सेकंड के लिए क्वार्ट्ज कोशिकाओं। आम तौर पर, विंदुक युक्तियाँ गैर विशेष डीएनए बाध्य होगा। POLYT किस्में की उच्च सांद्रता जोड़ना इस गैर विशिष्ट बंधन त्रुटि को कम कर सकते हैं।
  5. पत्रकारों और सहायक किस्में जोड़ें। का उपयोग करने के उदाहरण के संस्करणों के लिए टेबल 12, 13, और 14 देखें। रिपोर्टर जांच के लिए, कोई सहायक किस्में की जरूरत है कि ध्यान दें।
  6. 0.15% एसडीएस के अंतिम एकाग्रता को प्राप्त करने के लिए 10% सोडियम dodecyl सल्फेट (एसडीएस) जोड़ें। नोट: एसडीएस एंजाइमों कतरा विस्थापन प्रतिक्रिया (6 चित्रा देखें) के साथ हस्तक्षेप कर सकते हैं, क्योंकि प्लाज्मिड व्युत्पन्न द्वार से एंजाइमों को अलग कर देना करने के लिए इस्तेमाल किया जाता है। एसडीएस हदबंदी और प्रतिकूल सर्किट समारोह को प्रभावित कर सकता है, जो गेट किस्में, की गलत पुनर्संयोजन से बचने के लिए बजाय एंजाइमों की गर्मी विकृतीकरण की यहाँ की सिफारिश की है।
  7. [रिपोर्टर जांच के लिए इस कदम को छोड़।]
    1. में शामिल होने जोड़ें और कांटा फाटकों (तालिका 13 देखते हैं, और मात्रा के लिए 14)सिंथेटिक क्वार्ट्ज सेल करने के लिए और कम से कम 20 बार (एसडीएस के साथ vortexing के समाधान प्रतिदीप्ति कैनेटीक्स माप को प्रभावित करेगा जो बुलबुले में परिणाम कर सकते हैं क्योंकि क्युवेट भंवर नहीं है) के लिए यह ऊपर और नीचे pipetting द्वारा समाधान मिश्रण।
    2. रिसाव प्रतिक्रिया सिंथेटिक क्वार्ट्ज सेल के शामिल होने और कांटा फाटकों के अलावा के बाद तुरंत शुरू की क्योंकि इसके अलावा, जितनी जल्दी हो सके निम्नलिखित माप कदम के लिए कदम।
  8. एक spectrofluorimeter के चेंबर में सिंथेटिक क्वार्ट्ज कोशिकाओं रखें।
  9. कैनेटीक्स माप की शुरुआत करें।
  10. माप के 5 मिनट के बाद, सिंथेटिक क्वार्ट्ज सेल के लिए इनपुट किस्में (संस्करणों के लिए टेबल 12, 13, और 14 देखें) जोड़ सकते हैं और कम से कम 20 बार के लिए यह ऊपर और नीचे pipetting द्वारा प्रतिक्रिया मिश्रण। नमूना बुलबुले से बचने के लिए धीरे मिलाया जाना चाहिए कि ध्यान दें। डाटा अधिग्रहण कार्यक्रम बाहरी से शुरू हो रहा संकेतों को मापने से बचने के लिए रोक दिया गया है, जबकि इस कदम प्रदर्शनप्रकाश।
  11. यह स्थिर अवस्था तक पहुँच जाता है जब तक प्रतिक्रिया कैनेटीक्स रिकॉर्ड। प्रतिक्रिया कैनेटीक्स कंप्यूटर पर प्रदर्शित कर रहे हैं।

8. जांचना फ्लोरोसेंट संवाददाताओं

नोट: इस खंड में फ्लोरोसेंट संवाददाताओं की अंशांकन घटता बनाने के लिए प्रोटोकॉल का वर्णन है। कैलिब्रेशन घटता दाढ़ संकेत एकाग्रता के लिए मनमाने ढंग से प्रतिदीप्ति इकाइयों में परिवर्तित करने के लिए इस्तेमाल किया जाएगा।

  1. टेबल 12 में संक्षेप के रूप में कदम 7. उपयोग अभिकारकों और buffers के संस्करणों में वर्णित प्रोटोकॉल के बाद फ्लोरोसेंट संवाददाताओं जांचना इस उदाहरण के लिए मानक एकाग्रता 50 एनएम (1x) है। संवाददाताओं 3x पर कर रहे हैं; इनपुट 1x है। इनपुट <टीसी ग> 0.25x, 0.5x, 0.75x कहाँ पर हैं मामलों के लिए, 600 μl होने के लिए प्रत्येक प्रतिक्रिया की अंतिम मात्रा रखने के लिए 2 हे तदनुसार Nuclease मुफ्त एच की मात्रा समायोजित करें। एक उदाहरण डेटा चित्रा 7A में दिखाए जाते हैं।
  2. की एक अंशांकन वक्र बनाओसंकेत सी की प्रारंभिक एकाग्रता के खिलाफ अंतिम प्रतिदीप्ति मूल्यों की एक रेखीय फिट द्वारा रिपोर्टर सी (एक उदाहरण अंशांकन वक्र चित्रा 7 बी में दिखाया गया है)। इस अंशांकन वक्र अपनी इसी संकेत एकाग्रता के लिए मनमाने ढंग से प्रतिदीप्ति इकाइयों में परिवर्तित करने के लिए इस्तेमाल किया जा सकता है।

9. प्लाज्मिड व्युत्पन्न ndsDNA गेट्स की एकाग्रता यों

कार्यात्मक फाटकों की एक अलग उपज में प्लाज्मिड व्युत्पन्न ndsDNA फाटकों परिणामों में से प्रत्येक में स्वतंत्र रूप से संसाधित बैच, और इस खंड प्लाज्मिड व्युत्पन्न ndsDNA फाटकों की एकाग्रता को बढ़ाता के लिए एक प्रोटोकॉल का वर्णन करता है: ध्यान दें।

  1. टेबल 13 में संक्षेप के रूप में कदम 7. उपयोग अभिकर्मकों की मात्रा में वर्णित प्रोटोकॉल के बाद प्लाज्मिड व्युत्पन्न ndsDNA फाटकों की एकाग्रता यों नोट:। टेबल 13 कांटा ई.पू. मात्रा का ठहराव के लिए एक उदाहरण नुस्खा का वर्णन शामिल हों। एबी और अन्य फाटकों इसी तरह का प्रदर्शन किया है, लेकिन अलग इनपुट किस्में, सहायक किस्में और संवाददाताओं का उपयोग किया जा सकता है।
  2. कदम 8.2 से अंशांकन वक्र का उपयोग संकेत सी के एक एकाग्रता के लिए इस प्रयोग में मापा अंतिम प्रतिदीप्ति मूल्य कन्वर्ट। तब ndsDNA गेट एकाग्रता बैक की गणना। उदाहरण के लिए, चित्रा 7B में अंशांकन वक्र के आधार पर 25 एनएम संकेत सी (0.5x) से मेल खाती के गेट मात्रा का ठहराव के प्रयोग के लिए एक अंतिम प्रतिदीप्ति मूल्य। कांटा ईसा पूर्व के शेयर इस प्रतिक्रिया में 40 गुना पतला है के बाद से, कांटा ई.पू. फाटक के शेयर एकाग्रता 1 माइक्रोन है।

रिएक्शन ए + बी> ख + ग के लिए 10 काइनेटिक्स माप

नोट: इस खंड में प्रतिदीप्ति कैनेटीक्स माप का उपयोग करने के लिए एक औपचारिक रासायनिक प्रतिक्रिया के डीएनए प्राप्ति के परीक्षण के लिए एक प्रोटोकॉल का वर्णन है।

  1. प्रतिटेबल 14 में संक्षेप के रूप में अभिकर्मकों और buffers के चरण 7. उपयोग खंडों में वर्णित प्रोटोकॉल का पालन करके प्रपत्र कैनेटीक्स माप।

Representative Results

एक कार्यात्मक परीक्षण के लिए, bimolecular उत्प्रेरक प्रतिक्रिया (यानी, ए + बी> बी + सी) के एक डीएनए कार्यान्वयन बनाया गया था। प्लाज्मिड व्युत्पन्न फाटक के प्रदर्शन सिंथेटिक डीएनए से इकट्ठे फाटकों की तुलना में था। एक दोषपूर्ण गेट अचल जाल उत्पाद की राशि पर आय से अधिक प्रभाव के कारण एक उत्प्रेरक, 18,19 उत्पादन किया जा सकता है, क्योंकि प्रतिक्रियाओं उत्प्रेरक फाटक पवित्रता के लिए एक अच्छा परीक्षण कर रहे हैं। एक ही समय में, उत्प्रेरक संकेत के untriggered रिलीज में जिसके परिणामस्वरूप एक छोटी सी दरार प्रतिक्रिया रैखिक आय से अधिक त्रुटि संकेत करने के लिए अग्रणी परिलक्षित हो जाएगा। प्लाज्मिड ली गई है और संश्लेषित फाटकों के लिए प्रायोगिक डेटा क्रमश: चित्रा 8B और 8 में दिखाए जाते हैं। उत्प्रेरक संकेत बी की राशि अलग-अलग है, जबकि प्रयोगों में, संकेत कतरा की एकाग्रता तय हो गई है। सिग्नल सी उत्प्रेरक दखल के बिना प्रतिक्रिया की प्रगति बाहर पढ़ने के लिए प्रयोग किया जाता हैचक्र। प्रतिक्रियाओं भी एक की राशि की तुलना में काफी छोटा उत्प्रेरक बी की मात्रा के साथ पूरा करने के दृष्टिकोण के बाद से कटैलिसीस डेटा में मनाया जा सकता है। एसडीएस संश्लेषित प्रणाली के साथ किया प्रयोगों को नहीं जोड़ा गया था, प्रतिक्रिया की गति (कि एसडीएस के अलावा द्वारा प्रभावित किया जा सकता है) की तुलना नहीं है और विश्लेषणात्मक फोकस (के रूप में विस्तृत) के बजाय उत्प्रेरक कारोबार पर है।

इस प्रतिक्रिया का उत्प्रेरक कारोबार के आगे विश्लेषण आयोजित किया गया। टर्नओवर एक निश्चित समय पर प्रत्येक उत्प्रेरक बी के लिए उत्पादित राशि संकेत सी के रूप में परिभाषित किया गया है। विशेष रूप से, कारोबार बी जोड़ा उत्प्रेरक की प्रारंभिक राशि से रिसाव घटाया संकेत सी विभाजित करके हमारे प्रयोगात्मक डेटा से गणना की गई। एक आदर्श उत्प्रेरक प्रणाली के लिए, इस कारोबार नंबर रैखिक समय के साथ वृद्धि करनी चाहिए और जब तक सब्सट्रेट सीमित नहीं है, के रूप में उत्प्रेरक की राशि के स्वतंत्र होने के लिए। एक वास्तविक प्रणाली में, दोषपूर्ण फाटकों बिल्ली निष्क्रिय कर सकते हैं alysts, और कारोबार नहीं सभी उपलब्ध सब्सट्रेट उत्पाद में बदल जाती है, भले ही एक अधिकतम मूल्य तक पहुंच जाएगा। कारोबार अधिकतम मूल्य कई substrates (संकेत ए) एक उत्प्रेरक (संकेत बी) के निष्क्रिय बनने से पहले बदल सकते हैं इंगित करता है। इधर, यह संश्लेषित सिस्टम प्लाज्मिड व्युत्पन्न प्रणाली की तुलना में काफी पहले कारोबार का आदर्श रैखिक वृद्धि से भटक देखा गया है कि एक अवांछनीय पक्ष की प्रतिक्रिया (चित्रा 8D) के माध्यम से उत्प्रेरक की ज़ब्ती का संकेत है, करता है। कारोबार तुलना केवल क्योंकि उत्प्रेरक की उच्च सांद्रता में कम मात्रा के लिए दिखाया गया है, सभी फाटकों शुरू हो रहा है और संकेत रिलीज किया जाएगा। सर्किट रिसाव भी तुलना की जाती है, और यह प्लाज्मिड व्युत्पन्न फाटकों का उपयोग रिसाव संकेत के अनुपात प्रतिक्रिया के 10 घंटा (चित्रा 8E) के बाद उस का उपयोग कर संश्लेषित फाटकों की तुलना में लगभग 8% से भी कम है कि मनाया जाता है।

Iles / ftp_upload / 53,087 / 53087fig1.jpg "/>
चित्रा 1. (क) CRNs एक आदेशात्मक प्रोग्रामिंग भाषा के रूप में काम करते हैं। डीएनए प्रतिक्रिया नेटवर्क एक औपचारिक CRN की गतिशीलता लगभग करने के लिए इंजीनियर हो सकता है एक उदाहरण रासायनिक शिक्षा का (बी) के डीएनए कार्यान्वयन:। ए + बी> बी + सी। डीएनए किस्में 3 'के अंत में तीर के साथ लाइनों के रूप में तैयार कर रहे हैं और * पूरकता इंगित करता है। सभी संकेत किस्में ए, बी (<टीबी b> नारंगी), और सी (<टीसी ग>, लाल) एक toehold डोमेन के शामिल कर रहे हैं (<एक टा>, हरा) (टीबी, टा के रूप में चिह्नित है, और टीसी) और (ए, बी, और सी के रूप में लेबल) एक पहचान डोमेन। bimolecular प्रतिक्रिया ए + बी> बी + सी दो बहु फंसे परिसरों अटल बिहारी और कांटा ईसा पूर्व में शामिल होने की आवश्यकता है, और चार सहायक किस्में <टीआर R> <tr> <ग टीबी>, और <मैं टीसी> बी। प्रतिक्रिया कतरा विस्थापन के सात चरणों में, जहां हर कदम प्रारंभ होकर गुज़रताtoehold बंधन। (सी) रिपोर्टर रणनीति के साथ। प्रतिक्रिया नीचे किनारा एक fluorophore (लाल डॉट) के साथ लेबल है और शीर्ष कतरा एक पेय (काले डॉट) से जुड़ा हुआ है, जिसमें एक रिपोर्टर का उपयोग करते हुए पीछा किया जाता है। क्योंकि fluorophore और पेय की सह स्थानीयकरण की, संवाददाता प्रतिदीप्ति बरकरार रिपोर्टर में बुझती है। संकेत सी प्रतिदीप्ति की वृद्धि के लिए अग्रणी, रिपोर्टर के शीर्ष कतरा जगह ले सकता है। (यह आंकड़ा रेफरी 29 से संशोधित किया गया है।) यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र 2
बैक्टीरियल प्लास्मिड डीएनए से बने चित्रा 2 (ए) NdsDNA द्वार। डबल असहाय ndsDNA गेट टेम्पलेट की कई प्रतियां एक प्लाज्मिड में क्लोन कर रहे हैं। क्लोन किया प्लास्मिडों हैंएन में तब्दील कोलाई कोशिकाओं और थाली पर कालोनियों अनुक्रम सत्यापित कर रहे हैं। अनुक्रम पुष्टि होती है, प्लास्मिड डीएनए प्रवर्धित और निकाला जाता है। अंत में, डबल असहाय प्लाज्मिड। एंजाइमी प्रसंस्करण के माध्यम से वांछित ndsDNA फाटकों में कार्रवाई की है ndsDNA फाटकों (बी) एंजाइमी प्रसंस्करण। प्रतिबंध एंजाइम PvuII प्लाज्मिड से गेट जारी करने के लिए प्रयोग किया जाता है। जारी की फाटकों आगे nicking एंजाइमों का उपयोग कर कार्रवाई कर रहे हैं: Nb.BsrDI एबी (पैनल मैं) में शामिल होने के लिए Nicks उत्पन्न करने के लिए प्रयोग किया जाता है; Nt.BstNBI कांटा ईसा पूर्व (पैनल द्वितीय) के लिए Nicks उत्पन्न करने के लिए प्रयोग किया जाता है। प्रतिबंध और nicking साइटों कलर-कोडेड बक्से के रूप में संकेत कर रहे हैं। के गेट टेम्पलेट (सी) अनुक्रम देखें एबी (पैनल i) और कांटा ईसा पूर्व (पैनल द्वितीय) में शामिल हों। PvuII प्रतिबंध साइट (बैंगनी बॉक्स में प्रकाश डाला) के दोनों सिरों पर है ndsDNA फाटकों की। Nb.BsrDI और NT.BstNBI Nicking साइटों क्रमश: लाल और काले रंग के बक्से में डाला जाता है। कटौती के स्थानों को तीर के साथ चिह्नित हैं। अनुक्रम एन किसी भी न्यूक्लियोटाइड है। (यह आंकड़ा रेफरी 29 से अनुमति के साथ संशोधित किया गया है।) यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र तीन
एक डीएनए गेट टेम्पलेट का चित्रा 3. (क) पीसीआर। एक डीएनए गेट टेम्पलेट दोनों सिरों पर केंद्र में ndsDNA गेट दृश्यों (एक नीले क्षेत्र), और स्पेसर दृश्यों (; इन दोनों के अंत दृश्यों orthogonal हैं काला क्षेत्रों) शामिल हैं। प्राइमर गेट टेम्पलेट का स्पेसर दृश्यों के लिए बाध्य है, और। (बी) गिब्सन विधानसभा (ओवरलैपिंग दृश्यों कलर-कोडेड आंकड़ा में हैं) पीसीआर के माध्यम से चार ओवरलैपिंग डीएनए टुकड़े उत्पन्न कर सकते हैं। चार प्रवर्धित डीएनए fragmenटीएस तो गिब्सन विधानसभा विधि 43 के माध्यम से एक linearized प्लाज्मिड रीढ़ की हड्डी में इकट्ठा कर रहे हैं। (यह आंकड़ा रेफरी 29 से अनुमति के साथ संशोधित किया गया है।) यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 4
अलग एंजाइम मात्रा के साथ चित्रा 4. सर्किट प्रदर्शन। (ए) इसी प्रयोगों के लिए इस्तेमाल गेट, संवाददाता, सहायक किस्में, और संकेत किस्में का एक सरलीकृत प्रतिनिधित्व। (बी) प्लाज्मिड व्युत्पन्न एबी अलग एंजाइम मात्रा के साथ कार्रवाई की फ्री साथ काइनेटिक्स प्रयोगों । मैं। PvuII-एचएफ की 10 इकाइयों और 1 प्लाज्मिड के माइक्रोग्राम प्रति Nb.BsrDI की 45 इकाइयों; द्वितीय। PvuII-एचएफ की 10 इकाइयों के एक माइक्रोग्राम प्रति Nb.BsrDI की 4 इकाइयों प्लाज्मिड; तृतीय। PvuII-एचएफ की 4 इकाइयों और प्लाज्मिड के एक माइक्रोग्राम प्रति Nb.BsrDI की 4 इकाइयों। सभी सहायक किस्में 2x (1x = 10nm) पर थे। गेट परिसर 1.5x था, और प्रयोगों 1x TAE में 35 डिग्री सेल्सियस / 2 मिलीग्राम + पर प्रदर्शन किया गया। (यह आंकड़ा रेफरी 29 से अनुमति के साथ संशोधित किया गया है।) यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 5
चित्रा 5 कैनेटीक्स प्रयोगों के फ्लो चार्ट ब्लू:। सामग्री क्युवेट में जोड़ने के लिए (0.875 मिलीग्राम सिंथेटिक क्वार्ट्ज सेल)। > बी + सी - विशिष्ट संस्करणों के लिए संदर्भ तालिका 14 ए + बी की गतिज प्रयोग के लिए जोड़ने के लिए। ग्रीन: (SPEX के रूप में लेबल) एक spectrofluorimeter के निर्देश। लाल: निर्देश मिश्रण।53087fig5large.jpg "लक्ष्य =" _blank "> यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 6
चित्रा 6 एनजाइम हदबंदी और सर्किट व्यवहार। (ए) इसी प्रयोगों के लिए इस्तेमाल गेट, संवाददाता, सहायक किस्में, और संकेत किस्में के एक सरलीकृत प्रतिनिधित्व। (बी) प्लाज्मिड व्युत्पन्न एबी शामिल होने का उपयोग 80 डिग्री सेल्सियस गर्मी की काइनेटिक्स प्रयोगों निष्क्रियता (हरे निशान), 0.15% सोडियम dodecyl सल्फेट (एसडीएस) (लाल), और गर्मी निष्क्रियता या एसडीएस (नीला) के अलावा बिना किसी नियंत्रण के। मानक एकाग्रता 1x = 10 एनएम था, और सभी सहायक किस्में और इनपुट बी 2x पर थे। गेट परिसर 1.5x था, और प्रयोगों 2 + 12.5 मिमी 2 मिलीग्राम + (1x TAE / मिलीग्राम से युक्त 1x Tris- एसीटेट EDTA के बफर में 35 डिग्री सेल्सियस पर प्रदर्शन किया गया 29 से संशोधित किया गया है।) यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 7
चित्रा 7. रिपोर्टर अंशांकन। (ए) रिपोर्टर सी कैनेटीक्स। संवाददाता एकाग्रता 3x (1x = 50 एनएम) में किया गया था, और संकेत सी की प्रारंभिक एकाग्रता आकृति में संकेत दिया है। (बी) के माप अंत बिंदु (40 मिनट) पर संकेत सी के प्रतिदीप्ति के स्तर के साथ एक रैखिक संबंध से पता चलता है संकेत सी की प्रारंभिक एकाग्रता। कांटा ई.पू. गेट (हरी धराशायी लाइन) की एक मात्रा का ठहराव उदाहरण में, कांटा ईसा पूर्व के प्रतिदीप्ति मूल्य उपाय थाडी अंशांकन वक्र के आधार पर 25 एनएम (0.5x) से मेल खाती है, जो 3 एक्स 10 6 (एयू) के रूप में। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

आंकड़ा 8
8 चित्रा। Bimolecular उत्प्रेरक प्रतिक्रिया कैनेटीक्स (ए + बी> बी + सी)। (ए) एक इसी प्रयोगों के लिए इस्तेमाल गेट, संवाददाता, सहायक किस्में, और संकेत किस्में के प्रतिनिधित्व को सरल बनाया। प्रयोगों 12.5 मिमी 2 मिलीग्राम + (1x TAE / 2 मिलीग्राम +) युक्त 1x Tris- एसीटेट EDTA के बफर में चलाए जा रहे थे। सभी गेट परिसरों 75 एनएम एकाग्रता (1.5x) पर थे, और सहायक किस्में 100 एनएम एकाग्रता (2x) पर थे। संश्लेषित फाटकों के लिए काइनेटिक्स प्लाज्मिड व्युत्पन्न फाटक और डेटा के लिए डेटा (बी) में दिखाया गया है और कर रहे हैं (सी) (डी) प्लाज्मिड व्युत्पन्न फाटक इनपुट की कम मात्रा के लिए जोड़ा गया था जब संश्लेषित डीएनए फाटकों की तुलना में अधिक कारोबार का प्रदर्शन किया। (ई) हद रिसाव। बार चार्ट अंत अंक (10 घंटा) पर अंतिम सिग्नल (सी B0 = 0 / सी B0 = 1) के लिए अंतिम रिसाव के अनुपात से पता चलता है। (यह आंकड़ा रेफरी 29 से संशोधित किया गया है।) यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

गेट टेम्पलेट्स दृश्यों लंबाई (एनटी)
JoinAB TCTAGTTCGATCAGAGCGTTATTACCAGTAGTCGATTGCTCAGCTGCTACATTGCTTCTACGAGTCATCCTTCCACCATTGCACCTTAGAGTCCGAATCCTACCATTGCTTAACCGAGTCTCACAACCAGCTGTCATTATGGACTTGACACACAGATTACACGGGAAAGTTGC 173
FORKBC TCTAGTTCGATCAGAGCGTTATTACCAGTAGTCGATTGCTCAGCTGCCATCATAAGAGTCACCATACCCACATTGCCACATCGAGTCCCTTTTCCACCATTGCACCTTAGAGTCCGAATCCTACCATTGCTTAACCGAGTCTCACAACCAGCTGTCATTATGGACTTGACACACAGATTACACGGGAAAGTTGC 194

1 टेबल। ndsDNA गेट टेम्पलेट्स के दृश्यों।

द्वार किनारा नीचे कतरा की लम्बाई (एनटी)
JoinAB JoinAB-नीचे, <a tb> <b टीआर>, <R TQ> 87
ForkBC ForkBC-नीचे, <i> <टीसी ग>, <टीबी b> <टीआर R> 108

तालिका 2। एबी और कांटा ई.पू. फ्री में शामिल किस्में। (इस तालिका में रेफरी 29 से संशोधित किया गया है।)

डोमेन अनुक्रम लंबाई (एनटी)
टा CTGCTA 6
टीबी TTCCAC 6
टीसी TACCCA 6
टीआर TCCTAC 6
TQ AACCAG 6
CATTGCTTCTACGAGTCATCC 21
CATTGCACCTTAGAGTCCGAA 21
सी CATTGCCACATCGAGTCCCTT 21
आर CATTGCTTAACCGAGTCTCAC 21
मैं CTGCCATCATAAGAGTCACCA 21
।> बी + सी - हमेशा "रासायनिक प्रतिक्रिया एक को लागू करने के लिए> 3 टेबल डोमेन स्तर दृश्यों + बी: हमेशा" रखने के-साथ-previous.within-पेज = के लिए ":" रख-together.within-पेज = के लिए "jove_content (इस तालिका में रेफरी 29 से संशोधित किया गया है।)

प्राइमर किनारा दृश्यों लंबाई (एनटी)
आगे प्राइमर -1 AAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAG CGTTATTACCAGTAGTCGATTGC 60
रिवर्स प्राइमर -1 ACTACTATTTACTAATCCCATTGCGTGTTCTTATT TAATCTGTGTGTCAAGTCCATAATG 60
आगे प्राइमर -2 AATAAGAACACGCAATGGGATTAGTAAATAGTAGT CGTTATTACCAGTAGTCGATTGC 58
रिवर्स प्राइमर -2 GCGAAACTAGCTTGTGGTGATATTGTCTCGTGTGT TAATCTGTGTGTCAAGTCCATAATG 60
आगे प्राइमर -3 ACACACGAGACAATATCACCACAAGCTAGTTTCGC CGTTATTACCAGTAGTCGATTGC 58
रिवर्स प्राइमर -3 ACATTGTACGCCTAAATCATCAAGAATAATTGTTG TAATCTGTGTGTCAAGTCCATAATG 60
आगे प्राइमर -4 CAACAATTATTCTTGATGATTTAGGCGTACAATGT CGTTATTACCAGTAGTCGATTGC 58
रिवर्स प्राइमर -4 GAGCGCAGCGAGTCAGTGAGCGAGGAAGCCTGCAG TAATCTGTGTGTCAAGTCCATAATG 60

तालिका 4। पीसीआर ndsDNA के गेट टेम्पलेट्स के लिए प्राइमर दृश्यों।

अभिकर्मक 1x प्रतिक्रिया के लिए वॉल्यूम (μl)
उच्च प्रतिलिपि प्लाज्मिड रीढ़ की हड्डी (~ 300 एनजी / μl) 10
PvuII-एचएफ (20,000 इकाइयों / एमएल) 2
PstI-एचएफ (20,000 इकाइयों / एमएल) 2
10x कट स्मार्ट बफर 2
एच 2 4
कुल मात्रा 20 घ>

तालिका 5। प्लाज्मिड रीढ़ पचाने के लिए प्रोटोकॉल।

अभिकर्मक 1x प्रतिक्रिया के लिए वॉल्यूम (μl)
डीएनए वेक्टर (~ 50 एनजी / μl) 1
पीसीआर टुकड़ा-एक परिलक्षित (~ 50 एनजी / μl) 1
पीसीआर टुकड़ा -2 प्रवर्धित (~ 50 एनजी / μl) 1
पीसीआर टुकड़ा -3 प्रवर्धित (~ 50 एनजी / μl) 1
पीसीआर टुकड़ा-4 प्रवर्धित (~ 50 एनजी / μl) 1
2x गिब्सन विधानसभा मास्टर मिक्स 5
कुल मात्रा 10
"के लिए: रखने के-साथ-previous.within-पेज =" हमेशा "> टेबल 6 प्रोटोकॉल गिब्सन विधानसभा के लिए।।

अभिकर्मक 1x प्रतिक्रिया के लिए वॉल्यूम (μl)
प्लास्मिड डीएनए (~ 1 माइक्रोग्राम / μl एकाग्रता) 1000
PvuII-एचएफ (20,000 इकाइयों / एमएल) 200
10x कट स्मार्ट बफर 133.3
कुल मात्रा 1333.3

टेबल 7। प्रोटोकॉल प्लाज्मिड प्रतिबंध एंजाइम PvuII-एचएफ के साथ पचा डाला ndsDNA फाटकों के लिए।

अभिकर्मक मात्रा (μl)
फ्री में फाटकों (~ 5 माइक्रोग्राम / μl एकाग्रता) 150
Nb.BsrDI (10,000 इकाइयों / एमएल) 300
10x कट स्मार्ट बफर 50
कुल मात्रा 500

तालिका 8। फाटकों एंजाइम Nb.BsrDI nicking साथ पचाने में शामिल होने के लिए प्रोटोकॉल।

अभिकर्मक मात्रा (μl)
कांटा फाटकों (~ 5 माइक्रोग्राम / μl एकाग्रता) 150
Nt.BstNBI (10,000 इकाइयों / एमएल) 600
10x चंचु बफर 3.1 83.3
कुल मात्रा 833.3

टेबल 9 प्रोटोकॉल कांटा फाटकों एंजाइम Nt.BstNBI nicking साथ पचाने के लिए।

किनारा डोमेन अनुक्रम लंबाई (एनटी)
JoinAB-नीचे TQ आर * टीआर * ख * टीबी * एक * टा * CTGGTT GTGAGACTCGGTTAAGCAATG GTAGGA TTCGGACTCTAAGGTGCAATG GTGGAA GGATGACTCGTAGAAGCAATG TAGCAG 87
FORKBC-नीचे TQ आर * टीआर * ख * टीबी * ग * टीसी * मैं * CTGGTT GTGAGACTCGGTTAAGCAATG GTAGGA TTCGGACTCTAAGGTGCAATG GTGGAA AAGGGACTCGATGTGGCAATG TGGजीटीए TGGTGACTCTTATGATGGCAG 108
<एक टा> CTGCTA CATTGCTTCTACGAGTCATCC 27
<टीबी b> टा एक TTCCAC CATTGCACCTTAGAGTCCGAA 27
<टीसी ग> टीबी ख TACCCA CATTGCCACATCGAGTCCCTT 27
<a tb> टीसी ग CATTGCTTCTACGAGTCATCC TTCCAC 27
<B टीआर> एक टीबी CATTGCACCTTAGAGTCCGAA TCCTAC 27
<R TQ> ख टीआर CATTGCTTAACCGAGTCTCAC AACCAG 27
<I> आर TQ CTGCCATCATAAGAGTCACCA 21
<टीआर R> मैं TCCTAC CATTGCTTAACCGAGTCTCAC 27
<मैं टीसी> टीआर आर CTGCCATCATAAGAGTCACCA TACCCA 27
<ग टीआर> मैं टीसी CATTGCCACATCGAGTCCCTT TCCTAC 27
<ग टीबी> ग टीआर CATTGCCACATCGAGTCCCTT TTCCAC 27
<B टीआर> ग टीबी CATTGCACCTTAGAGTCCGAA TCCTAC 27
<मैं टीबी> ख टीआर CTGCCATCATAAGAGTCACCA TTCCएसी 27
<B टीबी> मैं टीबी CATTGCACCTTAGAGTCCGAA TTCCAC 27
<B टीसी> ख टीबी CATTGCACCTTAGAGTCCGAA TACCCA 27
<ग टीआर> बी टी सी CATTGCCACATCGAGTCCCTT TCCTAC 27
<B टीआर> ग टीआर CATTGCACCTTAGAGTCCGAA TCCTAC 27
ROX- <ग * टीसी *> ख टीआर / 56-ROXN / AAGGGACTCGATGTGGCAATG TGGGTA 27
<ग> -RQ ग * टीसी * CATTGCCACATCGAGTCCCTT / 3IAbRQSp / 21
<TQ आर *> - Tamra CTGGTT GTGAGACTCGGTTAAGCAATG / 36-TAMTSp / 27
RQ- <R> TQ आर * / 5IAbRQ / CATTGCTTAACCGAGTCTCAC 21
आर

तालिका 10 किनारा दृश्यों रासायनिक प्रतिक्रिया एक को लागू करने के लिए + बी -।> ख + ग (। इस तालिका में रेफरी 29 से संशोधित किया गया है)

अभिकर्मक मात्रा (μl) अंतिम एकाग्रता
100 माइक्रोन पर ROX- <ग * टीसी *> 10 10 माइक्रोन (1x)
<ग> -RQ 100 μ पर, एम 13 13 माइक्रोन (1.3x)
10x TAE से 125 मिमी 2 मिलीग्राम + 10 1x TAE से 12.5 मिमी 2 मिलीग्राम +
एच 2 67 -
कुल मात्रा 100 10 माइक्रोन (1x)

रिपोर्टर सी संयोजन के लिए टेबल 11. प्रोटोकॉल।

अभिकर्मक मात्रा (μl) अंतिम एकाग्रता
एच 2 514 -
10x TAE से 125 मिमी 2 मिलीग्राम + 60 1x TAE से 12.5 मिमी 2 मिलीग्राम +
300 μ पर POLYT, एम 2 1 माइक्रोन
10 माइक्रोन से कम रिपोर्टर सी 9 150 एनएम (3x)
10% एसडीएस 9 0.15%
<टीसी ग> 5 माइक्रोन पर 6 50 एनएम (1x)
कुल मात्रा 600 -

रिपोर्टर सी की जांच के लिए टेबल 12। प्रोटोकॉल। यहाँ प्रदान की मात्रा 600 μl (एक 0.875 मिलीग्राम सिंथेटिक क्वार्ट्ज सेल का उपयोग करने के लिए इसी) के कुल प्रतिक्रिया मात्रा के लिए है, लेकिन अलग-अलग आकार की कोशिकाओं के साथ काम करने के लिए समायोजित किया जा सकता है।

<टीडी> 600
अभिकर्मक मात्रा (μl) अंतिम चोरcentration
एच 2 493 -
10x TAE से 125 मिमी 2 मिलीग्राम + 60 1x TAE से 12.5 मिमी 2 मिलीग्राम +
300 माइक्रोन पर POLYT 2 1 माइक्रोन
10 माइक्रोन से कम रिपोर्टर सी 9 150 एनएम (3x)
100 माइक्रोन पर <मैं टीसी> 3 10x
<ग टीबी> 100 सुक्ष्ममापी पर 3 10x
100 माइक्रोन पर <b टीआर> 3 10x
10% एसडीएस 9 0.15%
~ 1 माइक्रोन पर कांटा ईसा पूर्व (एकाग्रता अज्ञात) 15 ~ 0.5x
<R TQ> 100 सुक्ष्ममापी पर 3 10x
कुल मात्रा -

टेबल 13। कांटा ईसा पूर्व की जांच के लिए प्रोटोकॉल। यहाँ प्रदान की मात्रा 600 μl की कुल प्रतिक्रिया मात्रा के लिए है, लेकिन अलग-अलग आकार की कोशिकाओं के साथ काम करने के लिए समायोजित किया जा सकता है।

अभिकर्मक मात्रा (μl) अंतिम एकाग्रता
एच 2 407.2 -
10x TAE से 125 मिमी 2 मिलीग्राम + 52.8 12.5 मिमी 2 मिलीग्राम +
300 माइक्रोन पर POLYT 2 1 माइक्रोन
10 माइक्रोन से कम रिपोर्टर सी 9 150 एनएम (3x)
10 माइक्रोन पर <मैं टीसी> 6 100 एनएम (2x)
<ग टीबी> 10 माइक्रोन से कम 6 100 एनएम (2x)
10 माइक्रोन पर <b टीआर> 6 100 एनएम (2x)
<टीआर R> 10 माइक्रोन से कम 6 100 एनएम (2x)
10% एसडीएस 9 0.15%
1 माइक्रोन पर एबी शामिल हों 45 75 एनएम (1.5x)
1 माइक्रोन पर कांटा ई.पू. 45 75 एनएम (1.5x)
<एक टा> पर 10 माइक्रोन 3 50 एनएम (1x)
10 माइक्रोन पर <टीबी b> 3 50 एनएम (1x)
कुल मात्रा 600 -

एक रासायनिक प्रतिक्रिया ए + बी> ख + ग के लिए तालिका 14. प्रोटोकॉल। यहाँ प्रदान की मात्रा 600 μl की कुल प्रतिक्रिया मात्रा के लिए है, लेकिन अलग-अलग आकार की कोशिकाओं के साथ काम करने के लिए समायोजित किया जा सकता है।

संश्लेषित फाटकों प्लाज्मिड व्युत्पन्न फाटकों
विवरण लागत फाटकों शामिल हों कांटा फाटकों
पृष्ठ शुद्ध लंबे किनारा (100 NT, एक फाटक के नीचे किस्में के रूप में सेवा) ~ 75 $ विवरण <> / मजबूत लागत विवरण लागत
पृष्ठ शुद्ध लघु किनारा (~ 30 NT, एक गेट के शीर्ष किस्में के रूप में सेवा) ~ 185 $ गेट टेम्पलेट ~ 100 $ गेट टेम्पलेट ~ 100 $
कुल ~ 260 $ प्लाज्मिड निकासी किट ~ 26 $ प्लाज्मिड निकासी किट ~ 26 $
प्रतिबंध एंजाइम (PvuII-एचएफ) ~ 11 $ प्रतिबंध एंजाइम (PvuII-एचएफ) ~ 11 $
एंजाइम Nicking (Nt.BsrDI, फाटकों शामिल हों) ~ 29 $ Nicking एंजाइम (Nt.BstNBI, कांटा फाटकों) ~ 62 $
कुल ~ 166 $ कुल ~ 199 $

लिए:।। रखने के-साथ-previous.within-पेज = "हमेशा"> प्लाज्मिड व्युत्पन्न फाटकों और संश्लेषित फाटकों के बीच टेबल 15 लागत की तुलना (। इस तालिका में रेफरी 29 से संशोधित किया गया है)

संश्लेषित फाटकों प्लाज्मिड व्युत्पन्न फाटकों
प्रसंस्करण प्रसंस्करण समय प्रसंस्करण प्रसंस्करण समय
एनीलिंग 1 घंटा क्लोनिंग 5 घंटा
पृष्ठ शुद्धि 2 घंटा प्लाज्मिड निकासी 2 घंटा
कुल 3 घंटा एंजाइम पाचन के दो कदम 0.5 घंटा
इथेनॉल
कुल 8.5 घंटा

प्लाज्मिड व्युत्पन्न फाटक और सिंथेटिक फाटकों के बीच टेबल 16। प्रसंस्करण समय तुलना। (इस तालिका में रेफरी 29 से संशोधित किया गया है।)

Discussion

इस पत्र अत्यधिक शुद्ध प्लास्मिड डीएनए से ndsDNA फाटकों पाने के लिए एक विधि का वर्णन है। इसके अलावा, एक प्रोटोकॉल एक प्रतिदीप्ति कैनेटीक्स परख का उपयोग गेट प्रदर्शन निस्र्पक के लिए प्रस्तुत किया है। प्रायोगिक डेटा सिंथेटिक सिस्टम जेल वैद्युतकणसंचलन (पृष्ठ) का उपयोग कर शुद्ध किस्में से इकट्ठा किया जाता है, भले ही प्लाज्मिड व्युत्पन्न प्रणाली अपने सिंथेटिक समकक्ष से बेहतर साबित पता चलता है कि। अधिक संभावना है, प्लाज्मिड व्युत्पन्न फाटक के बेहतर प्रदर्शन के जैविक डीएनए के बहुत उच्च शुद्धता के कारण मुख्य रूप से है। सिंथेटिक डीएनए में आम तौर पर पूरी तरह से पेज या उच्च प्रदर्शन तरल क्रोमैटोग्राफी (एचपीएलसी) शुद्धिकरण प्रक्रियाओं में नहीं हटा रहे हैं लंबाई एन -1, और इस तरह के पक्ष उत्पादों की oligonucleotides में परिणाम है कि विशेष विलोपन में त्रुटियों की एक किस्म शामिल हैं। यहां सूचना लोगों के लिए इसी तरह के सुधार भी जैविक स्रोतों 21 से निकाली गई डीएनए इस्तेमाल किया है कि एक उत्प्रेरित बाल के लिये कांटा एम्पलीफायर के पिछले एक अध्ययन में मनाया गया।

(चित्रा 4 देखें) अनुकूलन के द्वारा हटाए जा सकते हैं। दूसरा, इन प्रयोगों में, सबसे आदानों और सहायक किस्में सिंथेटिक डीएनए थे और इस तरह विलोपन और म्यूटेशन निहित। सिद्धांत रूप में, सभी एकल असहाय इनपुट और सहायक किस्में भी पूर्व इनकोडिंग M13 वायरल जीनोम 26 की एक Nicking एंजाइम पाचन के माध्यम से phagemid डीएनए से प्राप्त किया जा सकता है। शायद सर्किट प्रदर्शन आगे बैक्टीरियल जीनोम से निकाली गई ssDNA का उपयोग कर सुधार किया जा सकता है।

प्लाज्मिड व्युत्पन्न फाटकों का उपयोग सर्किट के प्रदर्शन में सुधार करने के लिए पाया गया था, जबकि एक विश्लेषणलागत और प्रसंस्करण बार की प्लाज्मिड व्युत्पन्न फाटक के उत्पादन थोड़ा सस्ता (तालिका 15) है, जबकि यह व्यावसायिक रूप से संश्लेषित ओलिगोस (तालिका 16) से विधानसभा के लिए और फाटकों की शुद्धि की तुलना में प्रसंस्करण समय 2-3 बार अब लगता है कि पता चला। प्लाज्मिड व्युत्पन्न फाटकों की प्राथमिक लागत जीन संश्लेषण और प्रतिबंध एंजाइमों का उपयोग कर रहे हैं। (30 एनएम पर 15 प्रतिक्रियाओं के लिए पर्याप्त) फाटकों के 300 pmole के लिए, फाटकों में शामिल होने के लिए अनुमानित लागत की वजह से विभिन्न nicking एंजाइमों का उपयोग करने के लिए लगभग $ 170 और कांटा फाटक, किया जा रहा लागत अंतर के लिए $ 200 है। इसके विपरीत, एक पृष्ठ शुद्धि शुल्क सहित $ 260 के आसपास ही गेट लागत के लिए किस्में के रासायनिक संश्लेषण। प्लाज्मिड व्युत्पन्न फाटकों के लिए प्राथमिक समय लागत सिर्फ डीएनए संश्लेषण की तरह, एक जीन संश्लेषण कंपनी को आउटसोर्स किया जा सकता है, जो क्लोनिंग प्रक्रिया में है। हालांकि, एक बार इकट्ठे, प्लाज्मिड व्युत्पन्न फाटकों मेजबान प्लास्मिडों आसानी से एक दोहराया जा सकता है कि लाभएन डी जीवाणु ग्लिसरॉल शेयरों के रूप में संग्रहित किया जा सकता है। यह संभव खत्म फाटक कई बार पुन: उपयोग करने के लिए बनाता है।

आगे देख रहे हैं, प्लाज्मिड व्युत्पन्न फाटक के बेहतर प्रदर्शन के लिए प्रयोगात्मक अब तक डीएनए CRNs के साथ प्रदर्शन किया गया है की तुलना में गतिशीलता व्यवहार का एक बहुत बड़ी रेंज सक्षम हो सकता है। उदाहरण के लिए, हाल ही में सैद्धांतिक काम 47,48 वृहद पैमाने पर स्वयं संगठित स्थानिक पैटर्न एक प्रतिक्रिया प्रसार तंत्र के माध्यम से डीएनए CRNs साथ महसूस किया जा सकता है कि सुझाव दिया। यहाँ प्रस्तुत विधि ऐसे आत्म-patterning डीएनए सामग्री के लिए अंतर्निहित आणविक घटकों के निर्माण के लिए एक व्यावहारिक रास्ता प्रदान करता है। चुनौतीपूर्ण हालांकि, एक प्रोग्राम रास्ते में वृहद पैमाने पर morphologies विकासशील biomaterials के अनुसंधान से पुनर्योजी दवा को लेकर क्षेत्रों में महत्वपूर्ण प्रभाव होगा।

Acknowledgements

आंकड़े 1, 2, 3, 4, 6, 8 और टेबल्स 2, 3, 10, 15, 16 रेफरी 29 से संशोधित कर रहे हैं। यह काम राष्ट्रीय विज्ञान फाउंडेशन द्वारा समर्थित किया गया (NSF-सीसीएफ 1,117,143 और जी एस करने के लिए NSF-सीसीएफ 1,162,141 अनुदान)। वाई-जे.सी. ताइवानी सरकार फैलोशिप द्वारा समर्थित किया गया। एसडीआर राष्ट्रीय विज्ञान फाउंडेशन ग्रेजुएट रिसर्च फैलोशिप प्रोग्राम (GRFP) द्वारा समर्थित किया गया।

Materials

Name Company Catalog Number Comments
Phusion High-Fidelity PCR Master Mix with HF Buffer NEB M0531S
PvuII-HF NEB R3151L
PstI-HF NEB R3140S
Gibson Assembly Master Mix NEB E2611S
Terrific Broth, Modified SIGMA-ALDRICH T0918-250G
QIAprep Spin Miniprep Kit (250) QIAGEN 27106
QIAGEN Hispeed Maxi-prep Kit QIAGEN 12662
Nb.BsrDI NEB R0648L
Nt.BstNBI NEB R0607L
NanoDrop 2000c Thermo Scientific
Double-stranded Genomic Blocks IDT
Horiba Jobin-Yvon Spex Fluorolog-3 Fluorimeter Horiba/Jobin Yvon
Synthetic Quartz Cells  Starna 23-5.45-S0G-5
QIAGEN Gel Extraction Kit QIAGEN 28706
Plasmid Backbones BioBrick E0240-pSB1A2 High copy number plasmid with Ampicillin resistance. Sequence can be found from http://parts.igem.org

DOWNLOAD MATERIALS LIST

References

  1. Zhang, D. Y., Seelig, G. Dynamic DNA nanotechnology using strand-displacement reactions. Nat. Chem. 3, 103-113 (2011).
  2. Krishnan, Y., Simmel, F. C. Nucleic acid based molecular devices. Angew. Chem. Int. Ed. Engl. 50, 3124-3156 (2011).
  3. Zhang, D. Y., Winfree, E. Control of DNA strand displacement kinetics using toehold exchange. J. Am. Chem. Soc. 131, 17303-17314 (2009).
  4. Qian, L., Winfree, E., Bruck, J. Neural network computation with DNA strand displacement cascades. Nature. 475, 368-372 (2011).
  5. Qian, L., Winfree, E. Scaling up digital circuit computation with DNA strand displacement cascades. Science. 332, 1196-1201 (2011).
  6. Zadegan, R. M., Jepsen, M. D., Hildebrandt, L. L., Birkedal, V., Kjems, J. Construction of a fuzzy and boolean logic gates based on DNA. Small. 11, 1811-1817 (2015).
  7. Seelig, G., Soloveichik, D., Zhang, D. Y., Winfree, E. Enzyme-free nucleic acid logic circuits. Science. 314, 1585-1588 (2006).
  8. Zadegan, R. M., et al. Construction of a 4 zeptoliters switchable 3D DNA box origami. ACS Nano. 6, 10050-10053 (2012).
  9. Andersen, E. S., et al. Self-assembly of a nanoscale DNA box with a controllable lid. Nature. 459, 73-76 (2009).
  10. Zhang, D. Y., Hariadi, R. F., Choi, H. M., Winfree, E. Integrating DNA strand-displacement circuitry with DNA tile self-assembly. Nat. Commun. 4, (1965).
  11. Yurke, B., Turberfield, A. J., Mills, A. P., Simmel, F. C., Neumann, J. L. A DNA-fuelled molecular machine made of DNA. Nature. 406, 605-608 (2000).
  12. Green, S. J., Lubrich, D., Turberfield, A. J. DNA hairpins: fuel for autonomous DNA devices. Biophys. J. 91, 2966-2975 (2006).
  13. Venkataraman, S., Dirks, R. M., Rothemund, P. W., Winfree, E., Pierce, N. A. An autonomous polymerization motor powered by DNA hybridization. Nat. Nanotechnol. 2, 490-494 (2007).
  14. Green, S. J., Bath, J., Turberfield, A. J. Coordinated chemomechanical cycles: a mechanism for autonomous molecular motion. Phys. Rev. Lett. 101, 238101 (2008).
  15. Omabegho, T., Sha, R., Seeman, N. C. A bipedal DNA Brownian motor with coordinated legs. Science. 324, 67-71 (2009).
  16. Turberfield, A. J., et al. DNA fuel for free-running nanomachines. Phys. Rev. Lett. 90, 118102 (2003).
  17. Dirks, R. M., Pierce, N. A. Triggered amplification by hybridization chain reaction. Proc. Natl. Acad. Sci. U. S. A. 101, 15275-15278 (2004).
  18. Seelig, G., Yurke, B., Winfree, E. Catalyzed relaxation of a metastable DNA fuel. J. Am. Chem. Soc. 128, 12211-12220 (2006).
  19. Zhang, D. Y., Turberfield, A. J., Yurke, B., Winfree, E. Engineering entropy-driven reactions and networks catalyzed by DNA. Science. 318, 1121-1125 (2007).
  20. Yin, P., Choi, H. M., Calvert, C. R., Pierce, N. A. Programming biomolecular self-assembly pathways. Nature. 451, 318-322 (2008).
  21. Chen, X., Briggs, N., McLain, J. R., Ellington, A. D. Stacking nonenzymatic circuits for high signal gain. Proc. Natl. Acad. Sci. U. S. A. 110, 5386-5391 (2013).
  22. Phillips, A., Cardelli, L. A programming language for composable DNA circuits. J. R. Soc. Interface. 6, Suppl 4. S419-S436 (2009).
  23. Lakin, M. R., Youssef, S., Polo, F., Emmott, S., Phillips, A. Visual DSD: a design and analysis tool for DNA strand displacement systems. Bioinformatics. 27, 3211-3213 (2011).
  24. Lakin, M. R., Youssef, S., Cardelli, L., Phillips, A. Abstractions for DNA circuit design. J. R. Soc. Interface. 9, 470-486 (2012).
  25. Zhang, D. Y., Winfree, E. Robustness and modularity properties of a non-covalent DNA catalytic reaction. Nucleic Acids Res. 38, 4182-4197 (2010).
  26. Ducani, C., Kaul, C., Moche, M., Shih, W. M., Hogberg, B. Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides. Nat. Methods. 10, 647-652 (2013).
  27. Lin, C., et al. In vivo cloning of artificial DNA nanostructures. Proc. Natl. Acad. Sci. U. S. A. 105, 17626-17631 (2008).
  28. Bhatia, D., et al. Icosahedral DNA nanocapsules by modular assembly. Angew. Chem. Int. Ed. Engl. 48, 4134-4137 (2009).
  29. Chen, Y. J., et al. Programmable chemical controllers made from DNA. Nat. Nanotechnol. 8, 755-762 (2013).
  30. Arkin, A., Ross, J. Computational functions in biochemical reaction networks. Biophys. J. 67, 560-578 (1994).
  31. Érdi, P., Tóth, J. Mathematical models of chemical reactions: theory and applications of deterministic and stochastic models. Manchester University Press. (1989).
  32. Magnasco, M. O. Chemical kinetics is Turing universal. Phys. Rev. Lett. 78, 1190 (1997).
  33. Oishi, K., Klavins, E. Biomolecular implementation of linear I/O systems. IET Syst. Biol. 5, 252-260 (2011).
  34. Senum, P., Riedel, M. Rate-independent constructs for chemical computation. PLoS One. 6, (2011).
  35. Soloveichik, D., Cook, M., Winfree, E., Bruck, J. Computation with finite stochastic chemical reaction networks. Natural Computing. 7, 615-633 (2008).
  36. Soloveichik, D., Seelig, G., Winfree, E. DNA as a universal substrate for chemical kinetics. Proc. Natl. Acad. Sci. U. S. A. 107, 5393-5398 (2010).
  37. Tyson, J. J., Chen, K. C., Novak, B. Sniffers, buzzers, toggles and blinkers: dynamics of regulatory and signaling pathways in the cell. Curr. Opin. Cell. Biol. 15, 221-231 (2003).
  38. Cardelli, L. Two-domain DNA strand displacement. Math. Struct. Comput. Sci. 23, 247-271 (2013).
  39. Angluin, D., Aspnes, J., Eisenstat, D. A simple population protocol for fast robust approximate majority. Distrib. Comput. 21, 87-102 (2008).
  40. Cardelli, L., Csikasz-Nagy, A. The cell cycle switch computes approximate majority. Sci. Rep. 2, 656 (2012).
  41. Zadeh, J. N., et al. NUPACK: Analysis and design of nucleic acid systems. J. Comput. Chem. 32, 170-173 (2011).
  42. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. J. Vis. Exp. (2012).
  43. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods. 6, 343-345 (2009).
  44. Froger, A., Hall, J. E. Transformation of plasmid DNA into E. coli using the heat shock method. J. Vis. Exp. e253 (2007).
  45. Lessard, J. C. Transformation of E. coli via electroporation. Methods Enzymol. 529, 321-327 (2013).
  46. Nasri, M., Thomas, D. Alteration of the specificity of PvuII restriction endonuclease. Nucleic Acids Res. 15, 7677-7687 (1987).
  47. Dalchau, N., Seelig, G., Phillips, A. Computational design of reaction-diffusion patterns using DNA-based chemical reaction networks. DNA Computing and Molecular Programming. 84-99 (2014).
  48. Scalise, D., Schulman, R. Designing modular reaction-diffusion programs for complex pattern formation. Technology. 2, 55-66 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics