DNA ستراند المهجرين غيتس لشبكات التفاعل التنفيذية الكيميائية المشتقة من البلازميد

Biology
 

Cite this Article

Copy Citation | Download Citations

Chen, Y. J., Rao, S. D., Seelig, G. Plasmid-derived DNA Strand Displacement Gates for Implementing Chemical Reaction Networks. J. Vis. Exp. (105), e53087, doi:10.3791/53087 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

وقد أتاح إمكانية التنبؤ واتسون-كريك قاعدة الاقتران تكنولوجيا النانو DNA الديناميكي لتظهر وكأنها وسيلة للبرمجة لتصميم الأجهزة الجزيئية مع الخصائص الحيوية 1،2. على وجه الخصوص، ضفيرة DNA النزوح - للبرمجة، رد فعل التهجين تنافسية - وقد ثبت أن آلية قوية لهندسة النظم الحيوية DNA. في رد فعل النزوح حبلا DNA، وهو قليل النوكليوتيد واردة نزوح وملزمة من قبل حبلا "الإخراج" من شريك ملزم التكميلي. ردود الفعل هذه متعددة يمكن بالسلاسل معا في شلالات رد فعل متعددة الخطوات مع وجود درجة عالية من السيطرة على النظام وتوقيت رد الفعل الفردي الخطوات 3. وقد استخدمت DNA شلالات حبلا النزوح إلى إنشاء الدوائر الرقمية والتناظرية الجزيئية 4-7، النانو للتحويل 10/08، 15/11 المحركات الجزيئية مستقلة، ومكبرات الصوت الحفازة غير التساهمية 13،16-21. وعلاوة على ذلك، Dأجهزة NA باستخدام تفاعلات النزوح حبلا يمكن محاكاة ومصممة لتطبيقات متنوعة باستخدام بمساعدة الحاسوب تصميم البرمجيات 22-24.

، يقدم DNA تصنيعه كيميائيا حاليا كمادة رئيسية لتكنولوجيا النانو DNA. ومع ذلك، وأخطاء في عملية توليف الحمض النووي، وأليغنوكليوتيد الكمال الناتجة عن ذلك، ويعتقد أن للحد من أداء الأجهزة الحيوية DNA عن طريق التسبب في التفاعلات الجانبية الخاطئة. على سبيل المثال، وردود الفعل "تسرب" يمكن أن يؤدي إلى الإفراج عن النوكليوتيد الانتاج حتى في حالة عدم وجود رد فعل الزناد. هذه الآثار هي الأكثر وضوحا في شلالات رد فعل بالحفز فيها حتى الحد الأدنى من تسرب الأولي سوف يؤدي في نهاية المطاف في تفعيل كامل لل19،20 تتالي. على العكس من ذلك، غالبا ما تفشل ردود الفعل للوصول إلى المستوى المتوقع من تفعيل لبعض المكونات لا يؤدي حتى في وجود مدخلات المقصود 7،25. لجعل أداء DNA يعمل بنظام التشغيلالأجهزة النانوية مماثلة لنظرائهم القائم على البروتين البيولوجية، يتعين خفضت بشكل كبير هذه سائط الخطأ.

البلازميدات البكتيرية أو DNA البيولوجية الأخرى يمكن أن تكون مصدرا رخيصا نسبيا من الحمض النووي نقية للغاية لتطبيقات تكنولوجيا النانو. يمكن توليد كميات كبيرة من الحمض النووي عن طريق تكرارها في البكتيريا وقدرات التدقيق الجوهرية للنظم المعيشة ضمان نقاء DNA الناتجة عن ذلك. في الواقع، وقد اعترفت عدة ورقات الأخيرة الفائدة المحتملة من DNA البيولوجي لتطبيقات تكنولوجيا النانو 21،26-28. ومع ذلك، فإن طبيعة المزدوج تقطعت بهم السبل تماما DNA البلازميد حظرت حتى الآن استخدامه كمادة لصنع أجهزة DNA الحيوية، والتي تتكون عادة من [أليغنوكليوتيد متعددة وتحتوي على كل المجالات المزدوج تقطعت بهم السبل واحدة الذين تقطعت بهم السبل. في ورقة حديثة 29 تم تناول هذه المسألة، وهيكل جديد بوابة DNA التي تتكون أساسا من الحمض النووي المزدوج تقطعت بهم السبل رصدت (ndsDNA) كان إدخالد.

الأهم من ذلك، أنظمة البوابات ndsDNA يمكن تصميم أن ندرك ديناميات المحدد من قبل أي شبكة التفاعل الكيميائي الرسمية (CRN) 29. وبالتالي يمكن استخدام بوابات ndsDNA، من حيث المبدأ، لإنشاء الأنظمة الديناميكية التي تظهر التذبذبات والفوضى، bistability والذاكرة، والمنطق منطقي أو السلوكيات حسابي 30-38. على سبيل المثال، المرجع 29 أظهرت رد فعل CRN ثلاث سنوات التي وفرت تنفيذ الجزيئي للبروتوكول "الإجماع"، وهو نوع من توزيع خوارزمية الحوسبة 29،39،40. تظاهر هذا العمل لأول مرة استخدام الرواية لالشكلية CRN بأنها "لغة البرمجة" لتوليف بسرعة الأنظمة الجزيئية وظيفية (الشكل 1A).

هنا، يتم توفير بروتوكول مفصلة لاشتقاق بوابات ndsDNA من DNA البلازميد. الأول هو إعادة النظر في عملية التصميم التسلسل. ثم يلي شرح لكيفية [أليغنوكليوتيد الاصطناعية التي تحتوي علىيتم استنساخ تسلسل البوابة إلى البلازميدات وتسلسل التحقق وتضخيمها عبر ثقافة البكتيرية. بعد ذلك، فإنه يظهر كيف يمكن أن تستمد ndsDNA البوابات من البلازميدات عن طريق تجهيز الأنزيمي (انظر الشكل 2). وأخيرا، الخطوط العريضة لطريقة لاختبار السلوك البوابة باستخدام حركية مضان فحوصات.

آلية رد الفعل
وكمثال على ذلك، يركز البروتوكول على الحفاز تفاعل كيميائي A + B-> B + C. الأنواع A، B، C و("إشارات"، الشكل 1B) كل تتوافق مع احد الذين تقطعت بهم السبل مختلف جزيء DNA. تسلسل هذه الجزيئات هي مستقلة تماما وخيوط لا تتفاعل مع بعضها البعض مباشرة. تسلسل جميع الاشارات واثنين من المجالات الوظيفية المختلفة، أي المتتالية والتي تعمل معا في التفاعلات النزوح حبلا: 1) مجال موطئ قدم قصيرة (علامات تا، السل، TC) التي يتم استخدامها لبدء حبلا النزوح صeaction، و2) مجال طويلة (تسميات أ، ب، ج) أن يحدد هوية إشارة.

وبوساطة التفاعلات بين مسارات الإشارات التي رصدت DNA (ndsDNA) المجمعات بوابة المزدوج تقطعت بهم السبل (وتسمى إنضم AB وشوكة قبل الميلاد)، ونوع واحد الذين تقطعت بهم السبل المساعدة (<tr ص>، <ب tr> <ج السل> و <ط ح >). يتم تنفيذ رد فعل رسمي A + B-> B + C من خلال سلسلة من حبلا النزوح خطوات التفاعل، حيث تكشف كل خطوة رد فعل على موطئ قدم لرد فعل لاحق (الشكل 1B). في هذا المثال، إشارات A و B في البداية الحرة في حل بينما إشارة C منضما إلى بوابة شوكة. في نهاية التفاعل B و C في الحل. بشكل أعم، الإشارات التي لا بد أن بوابة غير نشطة بينما الإشارات التي هي حرة في حل نشطة، وهذا يعني أنها يمكن أن تشارك في رد فعل حبلا التشردمدخلا. ويتبع مسار وقت رد الفعل باستخدام استراتيجية مراسل فلوري (الشكل 1C). في الأعمال السابقة 29، وقد تبين أن هذه الآلية رد فعل يدرك ليس فقط رياضيات الكيمياء الصحيح ولكن أيضا حركية التفاعل الهدف.

Protocol

1. تسلسل التصميم

ملاحظة: تسلسل نظرة عامة حول تصميم: في هذا القسم، وصفت استراتيجية لتصميم بوابات DNA المستمدة من البلازميد. مواقع الانزيم وضعت على حد سواء من بوابات للسماح للإفراج عن بوابات الذين تقطعت بهم السبل مزدوجة تماما بعد الهضم. يتم وضع المواقع الخدش ثم ان هذه الانزيمات خلق النكات على حبلا كبار لإنشاء بوابات ndsDNA النهائية. وأخيرا، يتم اختيار تسلسل المتبقية بحيث المجالات مستقلة متعامدة مع بعضها البعض ولا يحمل هيكل الثانوي.

  1. وضع موقع الخدش Nt.BstNBI أربعة النيوكليوتيدات بعيدا عن 3 'نهاية كل مجال طويلة (أ، ب، ج، ص، ط). وضع موقع الخدش Nb.BsrDI على 5 'نهاية كل مجال طويلة (أ، ب، ج، و r. لاحظ أن المجال ط ايوجد أي موقع الخدش Nb.BsrDI). الشكل 2C يظهر عرض تسلسل مفصل ل تاريخ AB وشوكة BC البوابات.
  2. وضع موقع تقييد PvuII على طرفي بوابات ndsDNA بحيث PvuII الهضم يمكن أن يفرج عن بوابات من البلازميدات (انظر الشكل 2C).
  3. تصميم تسلسل غير المقيدة الأخرى باتباع مبدأين: (أ) ينبغي أن خيوط لا يحمل الهياكل الثانوية (يمكن توقع الهياكل باستخدام الحمض النووي Nupack 41)، و (ب) يجب أن يكون جميع المجالات متعامد للحد من الحديث المتبادل.
  4. وضع تسلسل ndsDNA في وسط قالب البوابة. ضع 30-40 متواليات هل عشوائية سنة مضت على طرفي القالب البوابة، يخدم كل فاصل كموقع ملزم فريدة من نوعها تتعلق بما يلي رد فعل البلمرة المتسلسل (PCR).

2. الاستنساخ من NdsDNA غيتس في البلازميدات

ملاحظة: يصف هذا القسم طريقة الاستنساخ جيبسون لإدخال 4 نسخ من البوابة إلى العمود الفقري البلازميد.

  1. ترتيب ndsDNA قوالب البوابة لبنات الجينومية المزدوج تقطعت بهم السبل من الشركة المصنعة DNA (ترد بوابة تسلسل القالبفي الجدول تحدث فروع في ما هو مبين في الجدول 2 بوابات ndsDNA. وتظهر تسلسل مستوى المجال في الجدول 3).
  2. بعد استلام DNA أمر، وتدور في أنابيب تحتوي على كتل الجينومية في 10،000-14،000 x ج لمدة 1 دقيقة للتأكد من أن كل DNA المجففة في الجزء السفلي من الأنبوب.
  3. Resuspend وكتل الجينومية المجفف في الماء خالية من الدناز لتحقيق تركيز النهائي من 10 نانوغرام / ميكرولتر.
    ملاحظة: بدلا من ذلك، DNA يمكن معلق باستخدام 1X تريس ثنائي أمين الإيثيلين رباعي حمض الخل (EDTA) العازلة (TE العازلة: 10 ملي تريس و 1 ملي EDTA، ودرجة الحموضة 8.0). ومع ذلك، EDTA هو عامل خالب للالكاتيونات ثنائي التكافؤ، ويمكن أن تحول دون PCR.
  4. توليد 4 شظايا بوابة مع مناطق التداخل مختلفة من خلال PCR القياسية مع البلمرة DNA عالية الدقة (انظر الشكل 3A). تسلسل التمهيدي مفصلة في الجدول 4 (درجة حرارة ذوبان هذه الاشعال هي 62 ° C).
  5. تشغيل هلام الاغاروز 2٪ في 140 V لمدة 30 دقيقة في RT (لالاغاروز بروتوكول مفصلة الكهربائي للهلام نرى 42) وقطع العصابات المقابلة لكل PCR تضخيم جزء من هلام. ثم تنقية شرائح الجل باستخدام مجموعة استخراج الهلام (يرجى الرجوع إلى المواد) باتباع إرشادات الشركة المصنعة.
  6. هضم نسخة عالية عدد البلازميد العمود الفقري (انظر المواد) مع PvuII-HF وPstI-HF عند 37 درجة مئوية لمدة 1 ساعة (انظر الجدول 5) وفقا لبروتوكول الشركة المصنعة. PvuII-HF وPstI-HF الانزيمات تقييد عالية الدقة، والتي تقلل بشكل كبير تخفيضات غير محددة.
  7. تشغيل 1.5٪ هلام الاغاروز وقطع العمود الفقري خطي (عادة تشغيل هلام في 140 V لمدة 30-40 دقيقة في RT). ثم استخراج الحمض النووي من شريحة الجل باستخدام هلام عدة استخراج باتباع إرشادات الشركة المصنعة.
  8. أداء جيبسون التجمع 43 مع الناقل الخطي وشظايا PCR المنقى (انظر الجدول رقم 6 والشكل 3B
  9. تحويل المنتج التجمع جيبسون من الخطوة 2.8 إلى الإشريكية القولونية (E. القولونية) وطبق على استذابة مرق (LB) لوحة آغار تحتوي على مضادات حيوية الأمبيسلين (بتركيز 100 ميكروغرام / مل). أداء التحول من خلال Electroporation للأو أسلوب الصدمة الحرارية 44،45، واستخدام E. المناسب سلالة القولونية. على سبيل المثال، استخدم E. كولاي سلالة JM109 للتحول الصدمة الحرارية، واستخدام DH5α electrocompetent E. خلايا القولونية ل electroporation.
    ملاحظة: العمود الفقري البلازميد المستخدمة يحتوي على المقاومة كاسيت الأمبيسلين. إذا باستخدام علامة اختيار مختلفة، استخدام المضادات الحيوية المناسبة بدلا من الأمبيسلين.

3. البكتيرية الثقافة التضخيم ومراقبة الجودة

ملاحظة: يصف هذا القسم الإنتاج الضخم وعزل البلازميدات تحتوي على بوابات DNA بعد مراقبة الجودة.

  1. اختيار مستعمرة واحدةمن الأمبيسلين لوحة مختارة من الخطوة 2.9 واحتضان ثقافة 3 مل المتوسطة المخصب تحتوي على مضادات حيوية الأمبيسلين (بتركيز 100 ميكروغرام / مل). بمناسبة مستعمرة بحيث يمكن استخدامها مرة أخرى في الخطوات التجريبية لاحقة. تنمو ثقافة في 37 ° CO / N مع قوية تهز (200-300 دورة في الدقيقة). عادة، احتضان لمدة 16-24 ساعة.
  2. استخراج DNA البلازميد من ثقافة البكتيرية باستخدام مجموعة مصغرة الإعدادية باتباع إرشادات الشركة المصنعة.
  3. قياس DNA البلازميد تنقيته باستخدام معمل باتباع إرشادات الشركة المصنعة. يتراوح العائد نموذجي من 50-1،000 نانوغرام / ميكرولتر.
  4. الحصول على DNA البلازميد استخراج التسلسل عن طريق إرسال العينة إلى شركة تسلسل الحمض النووي. يجب أن يكون موجودا الاشعال التسلسل حوالي 100 النيوكليوتيدات المنبع والمصب في المنطقة لتكون متسلسلة. التمهيدي التسلسل لالبلازميد (انظر المواد للالبلازميد) لديه التسلسل التالي: ATTACCGCCTTTGAGTGAGC.
    لاالشركة المصرية للاتصالات: إذا كان هناك خطأ تسلسل أو إعادة التركيب في ndsDNA بوابات المدرج، حدد مستعمرة مختلفة من لوحة من الخطوة 2.9. اتبع الخطوات من 3،1-3،4 للتحقق من أن تتابع بوابات المدرج صحيحة.
  5. بعد التحقق من أن تسلسل صحيحة، واختيار مستعمرة المقابلة من لوحة الأمبيسلين انتقائية (من الخطوة 2.9)، واحتضان ثقافة 800 مل مرق رائع (TB) التي تحتوي على المضادات الحيوية الأمبيسلين (بتركيز 100 ميكروغرام / مل). تنمو ثقافة في 37 درجة مئوية لمدة 16-24 ساعة مع الهز قوي (200-300 دورة في الدقيقة). TB هي مناسبة تماما لإنتاج البلازميد ارتفاع العائد بشكل خاص.
    ملاحظة: بدلا من ذلك، LB ويمكن أيضا أن تستخدم لتنمو البكتيريا على الرغم من أن العائد البلازميد يمكن أن يكون مشكلة.
  6. تنقية الحمض النووي باستخدام طقم ماكسي الإعدادية باتباع إرشادات الشركة المصنعة.
  7. اتبع الخطوة 3،3-3،4 للتحقق ما إذا كان تسلسل صحيحة. إذا حدث أي إعادة التركيب، انظر الملاحظة التالية. خلاف ذلك، والانتقال إلى الخطوة 4. <ر /> ملاحظة: قضية واحدة الممكنة هنا هي أن نسخ متعددة من بوابات إدراجها في البلازميد قد بإعادة التراكب بسبب إصلاح الحمض النووي. لمعالجة هذه المشكلة، استخدم E. كولاي سلالة تفتقر إلى البروتين RECA (بروتين تتعلق إصلاح DNA) مثل JM109 أو DH5α لتحويل البلازميد سابقا التحقق من تسلسل (أي بدون أية أخطاء تسلسل وإعادة التركيب). ثم اختيار مستعمرة واحدة من هذه اللوحة، والتحقق من تسلسل البلازميد عن طريق إرسال العينة إلى شركة تسلسل الحمض النووي.

4. الأنزيمية المعالجة

ملاحظة: يصف هذا القسم عملية هضم البلازميدات بحيث يتم قطع ورصدت في المواقع الصحيحة وعلى استعداد لاستخدامها في حركية التجارب.

  1. هضم DNA البلازميد المنقى من الخطوة 3.7 مع انزيم التقييد PvuII-HF مدة 1 ساعة على 37 درجة مئوية (انظر جدول رقم 7). عادة هضم البلازميد مع 4 وحدات من PvuII-HF لكل 1 ملغ من البلازميد. ارتفاع الاستثمارات الخارجية المباشرةينصح الانزيمات تقييد elity للاستخدام لأنها تقلل بشكل كبير تخفيضات غير محددة.
  2. أداء الإيثانول هطول الأمطار على العينة.
    1. إضافة 2 مجلدات يعادل الايثانول المطلق المثلج للعينة.
    2. احتضان الخليط في -80 درجة مئوية لمدة 1 ساعة على الأقل (هذا الخليط يمكن أيضا الجلوس في -80 درجة مئوية لمدة O / N).
    3. أجهزة الطرد المركزي في 10،000-14،000 x ج في 0 درجة مئوية لمدة 30 دقيقة.
    4. إزالة طاف.
    5. إضافة 1000 ميكرولتر من RT 95٪ من الإيثانول لعينة، وعكس 10-15 مرة.
    6. أجهزة الطرد المركزي في 10،000-14،000 x ج في 4 درجة مئوية لمدة 10 دقيقة.
    7. إزالة طاف والهواء الجاف على مقاعد البدلاء لمدة 10-20 دقيقة.
    8. Resuspend والكريات DNA في حجم مناسب من نوكلياز H 2 O مجانا (عادة 100-200 ميكرولتر). وأضاف ان أكثر من 200 ميكرولتر جعل عموما العينة المخففة جدا للاستخدام في حركية التجارب.
  3. قياس DNA معلق باستخدام مقياس الطيف الضوئي في أعقاب متعليمات anufacturer و.
  4. ملخص الانضمام البوابات مع الخدش انزيم Nb.BsrDI عند 65 درجة مئوية لمدة 1 ساعة باستخدام 4 وحدات من الانزيم لكل 1 ميكروغرام من البلازميد (انظر الجدول 8)؛ هضم شوكة البوابات مع الخدش انزيم Nt.BstNBI عند 55 درجة مئوية لمدة 1 ساعة باستخدام 8 وحدات من الانزيم لكل 1 ميكروغرام من البلازميد (انظر الجدول 9).
    ملاحظة: الخطوة 4.2 يزيل العازلة انزيم الهضم ويساعد على التركيز بوابات لحركية التجارب. خطوة 4،2 يمكن تخطي للانضمام بوابات لأن كلا انزيم التقييد PvuII-HF وانزيم الخدش Nb.BsrDI نصيب نفس العازلة الهضم. في خطوة 4.2.8، يتم استخدام نوكلياز H 2 O مجانا بدلا من TE لأن EDTA هو عامل خالب للالكاتيونات ثنائي التكافؤ ويمكن أن تمنع الانزيمات التي تحتاج إلى تقييد هذه الأيونات في العمل.
    ملاحظة: إضافة كميات زائدة من الإنزيمات قد يؤدي إلى تسرب كميات كبيرة من الدائرة الأولي (الشكل 4)، والذي هو الأكثر احتمالا بسبب الإفراط في الهضم 46. هذه المسألة كاليفورنيان أن تعالج عن طريق تحسين كميات انزيم (انظر الشكل 4). مجموعة نموذجية من الانزيمات هو 1-10 وحدة / 1 ميكروغرام البلازميد.

5. إعداد [أليغنوكليوتيد] واحد الذين تقطعت بهم السبل

ملاحظة: يصف هذا القسم بروتوكول لإعادة التعليق وquantitating واحد الذين تقطعت بهم السبل DNA synthetized كيميائيا (ssDNA) التي سيتم استخدامها لمسارات الإشارات وخيوط مساعدة. لتسلسل حبلا انظر الجدول 10. لاحظ أن البروتوكول التالي هو مثال على إعداد 10 ميكرومتر ssDNA. تركيزات أخرى من ssDNA يمكن إعداد بالمثل.

  1. بعد تلقي oligos من الشركة المصنعة DNA، وتدور في أنابيب تحتوي على الحمض النووي في 10،000-14،000 x ج لمدة 1 دقيقة للتأكد من أن كل DNA المجففة في الجزء السفلي من الأنبوب.
  2. Resuspend وDNA باستخدام 1X تريس ثنائي أمين الإيثيلين رباعي حمض الخل (EDTA) العازلة (TE العازلة: 10 ملي تريس و1MM EDTA، ودرجة الحموضة 8.0) لتحقيق تركيز النهائي من 100 ميكرومتر. لسبيل المثال، و resuspend 8 نانومول من الحمض النووي في 80 ميكرولتر من TE العازلة.
  3. مزيج 10 ميكرولتر من الحمض النووي في 100 ميكرومتر مع 90 ميكرولتر من الماء الجزيئية في أنبوب microcentrifuge، والتي ينبغي أن تحقيق تركيز النهائي من 10 ميكرومتر.
  4. قياس تركيز الدقيق للعينة الحمض النووي باستخدام معمل باتباع إرشادات الشركة المصنعة. بروتوكول التالي يعطي مثالا على الكيفية التي يمكن بها قياس تركيز الحمض النووي.
    1. فارغة في معمل مع 2 ميكرولتر من الماء الجزيئية.
    2. قياس الامتصاصية في 260 نانومتر (A 260) من عينة DNA. استخدام المعادلة التالية لحساب تركيز الأسهم.
      ملاحظة: إن تركيز العينة M = A معامل 260 / الانقراض. معامل الانقراض يمكن العثور على ورقة البيانات مواصفات من قبل الشركة المصنعة DNA.

6. إعداد مراسلون الفلورسنت

ملاحظة: يصف هذا القسمبروتوكول لإعداد المراسل للصحفيين الفلورسنت باقي يمكن تجميعها بالمثل.

  1. طلب عالية الأداء اللوني السائل (HPLC) [أليغنوكليوتيد تنقية ROX- <ج * ح *> (حبلا العلوي من مراسل C) و <ج> -RQ (حبلا السفلي من مراسل C) من الشركة المصنعة DNA (انظر الجدول 10 لمتواليات ).
  2. بعد استلام توليفها أليغنوكليوتيد]، و resuspend وquantitate عينات كما هو موضح في الخطوة 5.
  3. مزيج أعلى مراسل وخيوط أسفل (أي ROX- <ج * ح *> و <ج> -RQ) في 1X تريس، خلات EDTA (تاي) مع 12.5 ملي المغنيسيوم 2+ (انظر الجدول 11 لوصفة مفصلة ). لاحظ أن هنا يتم إضافة 30٪ زيادة حبلا المسمى فاكهه تقضي <ج> -RQ لتجميع المراسل، الذي يضمن أن جميع خيوط المسمى fluorophore تطفأ حتى مع رياضيات الكيمياء غير كامل.
  4. يصلب مجمع مراسل C باستخدام cycler الحرارية والتبريد من 95 ° C إلى 20 ° C بمعدل 1 ° C / دقيقة. ويمكن تخزين العينات في 4 درجات مئوية.

7. الإسفار القياسات

ملاحظة: يصف القسم بروتوكول عام لحركية مضان القياسات (انظر الشكل 5 لإجراء التجارب)، وسيتم استخدام هذا البروتوكول في الخطوات 8 و 9 و 10. لاحظ أيضا أن هذا البروتوكول هو لاستخدام spectrofluorimeter. بدلا من ذلك، يمكن أيضا أن يتم تنفيذ هذه التجارب في قارئ لوحة على الرغم من حساسية، بالإضافة إلى الاختلافات بشكل جيد وعدم التحكم في درجة الحرارة في التجارب على المدى الطويل يمكن أن تكون هذه القضية.

  1. تعيين تحكم في درجة الحرارة إلى 25 درجة مئوية، والانتظار لدرجة الحرارة لتحقيق الاستقرار. يمكن استخدام وحدة تحكم في درجة الحرارة لحد من التباين في إشارة إلى أن يمكن أن تنجم عن اختلاف درجة الحرارة.
  2. تعيين المعلمات المناسبة FOحركية ص القياسات في البرنامج الحصول على البيانات من spectrofluorimeter. إعدادات سبيل المثال مفصلة على النحو التالي:
    1. تعيين عرض الشق إلى 2.73 نانومتر لكل من الإثارة وانبعاث monochromators.
    2. ضبط الوقت التكامل إلى 10 ثانية لكل 60 ثانية الوقت نقطة. تعيين مجموع وقت القياس إلى 24 ساعة.
    3. ضبط موجات الإثارة / الانبعاثات لتتناسب مع fluorophores التي استخدمت في التجربة. موجات سبيل المثال هي كما يلي: ROX (588 نانومتر / 608 نانومتر)، وطمرة (559 نانومتر / 583 نانومتر).
  3. إضافة نوكلياز H 2 O مجانا و 10x تريس، خلات-EDTA العازلة التي تحتوي على 125 ملي المغنيسيوم 2+ (10X تاي / المغنيسيوم 2+) إلى خلية الكوارتز الاصطناعية. انظر الجدولين 12 و 13 و 14 وحدات التخزين سبيل المثال للاستخدام.
  4. إضافة خيوط polyT لتحقيق تركيز النهائي من ~ 1 ميكرومتر (انظر الجدول 12، 13، و 14 لمجلدات)، ثم دوامة الاصطناعيةخلايا الكوارتز لمدة 10-15 ثانية. عموما، سوف نصائح ماصة ربط غير تحديدا DNA. يمكن إضافة تراكيز عالية من خيوط polyT لحد من هذا الخطأ ملزم غير محددة.
  5. إضافة للصحفيين وخيوط مساعدة. انظر الجدول 12، 13، و 14 لكميات سبيل المثال للاستخدام. لاحظ أن لمراسل المعايرة، هناك حاجة إلى أي خيوط مساعدة.
  6. إضافة 10٪ سلفات الصوديوم دوديسيل (SDS) لتحقيق تركيز النهائي من 0.15٪ SDS. ملاحظة: يستخدم SDS لفصل الانزيمات من أبواب المستمدة من البلازميد لأن الإنزيمات قد تتداخل مع رد فعل حبلا النزوح (انظر الشكل 6). يوصى SDS هنا بدلا من تمسخ الحرارة من الانزيمات لتجنب التفكك وإعادة التركيب غير صحيح من خيوط البوابة، والتي قد تؤثر سلبا على وظيفة الدائرة.
  7. [تخطي هذه الخطوة لمراسل المعايرة.]
    1. إضافة الانضمام إليها وبوابات شوكة (انظر الجدول 13، و 14 لمجلدات)إلى الخلية الكوارتز الاصطناعية ومزيج الحل بواسطة pipetting انها صعودا وهبوطا لمدة 20 مرات على الأقل (لا دوامة كفيت لحلول vortexing لمع SDS يمكن أن يؤدي إلى فقاعات والتي سوف تؤثر على القياسات الحركية مضان).
    2. أيضا، والانتقال إلى خطوات القياس التالية في أقرب وقت ممكن لأن رد الفعل تسرب يبادر فورا بعد إضافة الانضمام إليها وشوكة البوابات إلى الخلية الكوارتز الاصطناعية.
  8. وضع الخلايا الكوارتز الاصطناعية في غرفة من spectrofluorimeter.
  9. بدء قياس حركية.
  10. بعد 5 دقائق من القياس، إضافة خيوط المدخلات (انظر الجدول 12، 13، و 14 لمجلدات) إلى الخلية الكوارتز الاصطناعية وخلط رد فعل من قبل pipetting انها صعودا وهبوطا لمدة 20 مرات على الأقل. لاحظ أن العينة يجب أن تكون مختلطة بلطف لتجنب الفقاعات. تنفيذ هذه الخطوة في الوقت الذي توقف البرنامج الحصول على البيانات لتجنب قياس الإشارات الناتجة عن الخارجيةخفيفة.
  11. تسجيل حركية التفاعل حتى تصل إلى حالة الاستقرار. يتم عرض حركية التفاعل على الكمبيوتر.

8. معايرة نيون مراسلون

ملاحظة: يصف هذا القسم بروتوكول لجعل منحنيات المعايرة للصحفيين الفلورسنت. وسيتم استخدام منحنيات المعايرة لتحويل وحدات مضان التعسفي لتركيز إشارة المولي.

  1. معايرة للصحفيين الفلورسنت بعد بروتوكول موضح في الخطوة 7. استخدام كميات المواد المتفاعلة ومخازن النحو الموجز في الجدول 12 تركيز القياسي لهذا المثال هو 50 نانومتر (1X)؛ للصحفيين هي في 3X. المدخلات هو 1X. في الحالات التي المدخلات <ح ج> هي في 0.25X، 0.5X، 0.75x، وضبط حجم نوكلياز مجانا H 2 O المقابل للحفاظ على الحجم النهائي من كل رد فعل ليكون 600 ميكرولتر. وترد في البيانات المثال في الشكل 7A.
  2. جعل منحنى المعايرة للمراسل C التي تناسب خطية من القيم مضان النهائية ضد التركيز الأولي للإشارة C (ويرد منحنى المعايرة سبيل المثال في الشكل 7B). هذا منحنى المعايرة يمكن استخدامها لتحويل وحدات مضان التعسفي لتركيزه إشارة المقابلة.

9. قياس تركيز البلازميد المستمدة من ndsDNA غيتس

ملاحظة: كل دفعة معالجتها بشكل مستقل عن نتائج بوابات ndsDNA المستمدة من البلازميد في العائد مختلف البوابات الوظيفية، ويصف هذا القسم بروتوكول لقياس تركيز بوابات ndsDNA المستمدة من البلازميد.

  1. قياس تركيز بوابات ndsDNA المستمدة من البلازميد بعد بروتوكول موضح في الخطوة 7. استخدام كميات الكواشف كما تلخيصها في الجدول 13 ملاحظة: يصف الجدول 13 وصفة سبيل المثال لشوكة BC الكمي تاريخ. AB وبوابات أخرى لا يمكن أن يؤديها بالمثل ولكن باستخدام خيوط مدخلات مختلفة، جدائل المساعدة وصحفيين.
  2. تحويل قيمة مضان النهائية المقاسة في هذه التجربة إلى تركيز إشارة C باستخدام منحنى المعايرة من الخطوة 8.2. ثم ظهر حساب تركيز بوابة ndsDNA. على سبيل المثال، قيمة مضان النهائية للتجربة الكمي بوابة يتوافق مع 25 نانومتر إشارة C (0.5X) استنادا إلى منحنى المعايرة في الشكل 7B. لأن المخزون من شوكة BC هو المخفف 40 مرات في رد الفعل هذا، وتركيز الأسهم من بوابة شوكة BC هو 1 ميكرومتر.

10. القياسات الحركية للتفاعل A + B-> B + C

ملاحظة: يصف هذا القسم بروتوكول لاختبار الحمض النووي لتحقيق تفاعل كيميائي رسمي باستخدام قياسات حركية مضان.

  1. لكلقياس حركية شكل باتباع البروتوكول هو موضح في الخطوة 7. استخدام كميات من الكواشف ومخازن النحو الموجز في الجدول 14.

Representative Results

لاختبار وظيفي، تم إنشاء تطبيق الحمض النووي للتفاعل محفز ثنائي الجزيء (أي، A + B-> B + C). ومقارنة أداء بوابات المستمدة من البلازميد بوابات تجميعها من الحمض النووي الاصطناعي. ردود فعل الحفاز هي اختبارا جيدا لبوابة نقاء لبوابة خاطئة يمكن أن لا رجعة فيه فخ محفز، مما تسبب في تأثير غير متناسب على كمية المنتج أنتجت 18،19. في نفس الوقت، وهو رد فعل تسرب صغير مما أدى إلى الإفراج untriggered للإشارة الحفازة سوف تتضخم خطيا، مما أدى إلى إشارة خطأ غير متناسبة. وتظهر البيانات التجريبية للبوابات وتوليفها المستمدة من البلازميد في الشكل 8B و8C، على التوالي. في التجارب، ويحدد تركيز إشارة حبلا A في حين تباينت كمية إشارة الحفاز ب. يستخدم إشارة C تلا التقدم من رد فعل دون مقاطعة الحفازدورة. ويمكن ملاحظة الحفز في البيانات منذ ردود الفعل اقتراب الانتهاء حتى مع كميات من حافز B أصغر بكثير من مبلغ A. منذ SDS لم يتم إضافة إلى التجارب القيام به مع نظام توليفها، سرعة رد الفعل (التي يمكن أن تتأثر من خلال إضافة SDS) لا تقارن والتركيز التحليلي بدلا من ذلك على دوران الحفاز (مفصلة على النحو التالي).

وأجري مزيد من التحليل للدوران الحفاز لهذا التفاعل. ويعرف دوران كما إشارة كمية C تنتج عن كل عامل حفاز B في وقت معين. على وجه التحديد، تم احتساب معدل دوران من البيانات التجريبية لدينا من خلال تقسيم تسرب طرح إشارة C من مبلغ أولي قدره حافزا أضاف B. لنظام تحفيزي مثالي، يجب أن هذا العدد دوران زيادة خطيا مع الزمن وتكون مستقلة عن كمية الحفاز طالما الركيزة لا تحد. في نظام حقيقي، يمكن بوابات الخاطئة تعطيل القط alysts، وسوف دوران تصل إلى القيمة القصوى حتى لو تم تحويلها ليس كل الركيزة المتاحة للمنتج. قيمة دوران أقصى يشير إلى مدى العديد من ركائز (إشارة A) محفز (إشارة B) يمكن تحويل قبل أن يصبح المعطل. هنا، لوحظ أن النظام توليفها ينحرف عن زيادة خطية مثالية للدوران في وقت سابق بكثير من نظام المستمدة من البلازميد يفعل، مشيرا إلى مصادرة المحفز من خلال رد فعل الجانب غير مرغوب فيه (الشكل 8D). يظهر فقط مقارنة دوران لتركيزات منخفضة لأن في تركيزات عالية من المواد الحفازة، وسيتم تشغيل جميع البوابات وإطلاق إشارة C. ومقارنة أيضا تسرب الدائرة، ويلاحظ أن نسبة إشارة تسرب باستخدام بوابات المستمدة من البلازميد حوالي 8٪ أقل من أن استخدام بوابات تصنيعه بعد 10 ساعة من التفاعل (الشكل 8E).

ديزيل / ftp_upload / 53087 / 53087fig1.jpg "/>
الشكل 1. (A) CRNs بمثابة لغة البرمجة مفروضة. شبكات رد فعل DNA يمكن هندستها لتقريب ديناميات CRN الرسمي التنفيذ (B) DNA من تعليمات الكيميائية سبيل المثال: A + B-> B + C. يتم رسم خيوط DNA على شكل خطوط مع السهام في 'نهاية 3 و* تشير إلى التكامل. كل إشارة فروع A (<تا أ> والأخضر)، ويتألف B (<السل ب> والبرتقالي)، وC (<ح ج> والأحمر) المجال موطئ قدم واحد (وصفت بأنها تا والسل وح) و نطاق هوية واحدة (وصفت بأنها أ، ب، ج). وثنائي الجزيء رد فعل A + B-> B + C يتطلب مجمعين الذين تقطعت بهم السبل متعددة انضمام AB وشوكة قبل الميلاد، وأربعة فروع المساعدة <tr ص>، <ب tr> <ج السل>، و <i ح>. عائدات رد الفعل من خلال سبع خطوات حبلا النزوح، حيث كل خطوة البدايةالصورة مع موطئ قدم ملزم. (C) استراتيجية المراسل. ويتبع التفاعل باستخدام مراسل التي وصفت حبلا السفلي مع fluorophore (النقطة الحمراء) ويتم إرفاق حبلا الأعلى إلى فاكهه تقضي (نقطة سوداء). بسبب شارك في توطين fluorophore وفاكهه تقضي، تطفأ مراسل مضان في مراسل سليمة. إشارة C يمكن أن تحل محل حبلا العلوي من المراسل، مما يؤدي إلى زيادة في مضان. (تم تعديل هذا الرقم من الرقم 29.) يرجى النقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الرقم 2
الرقم بوابات 2. (A) NdsDNA مصنوعة من DNA البلازميد البكتيري. يتم استنساخ عدة نسخ من قالب بوابة ndsDNA المزدوج تقطعت بهم السبل في البلازميد. البلازميدات المستنسخة هين تتحول إلى E. خلايا القولونية والمستعمرات على لوحة هي تسلسل التحقق منها. بمجرد تأكيد تسلسل، يتم تضخيمه DNA البلازميد واستخراج. وأخيرا، يتم معالجة البلازميد الذين تقطعت بهم السبل المزدوج إلى بوابات ndsDNA المرجوة من خلال المعالجة الأنزيمية. (B) وتجهيز الأنزيمية من بوابات ndsDNA. يتم استخدام انزيم تقييد PvuII للافراج عن بوابة من البلازميد. تتم معالجة بوابات الكشف عن مزيد من الخدش باستخدام أنزيمات: يستخدم Nb.BsrDI لتوليد النكات عن تاريخ AB (الفريق الأول)؛ يستخدم Nt.BstNBI لتوليد النكات لشوكة BC (لوحة الثاني). يشار إلى تقييد مواقع والخدش مربعات مرمزة. (C) عرض تسلسل من القالب بوابة تاريخ AB (الفريق الأول) وشوكة BC (لوحة الثاني). الموقع تقييد PvuII (سلط عليها الضوء في مربع الأرجواني) هو عند كلا الطرفين بوابات ndsDNA. وNb.BsrDI و NTوأبرز المواقع الخدش .BstNBI في مربعات حمراء وسوداء، على التوالي. يتم وضع علامة على مواقع قطع مع السهام. تسلسل N أي النوكليوتيدات. (تم تعديل هذا الرقم بإذن من المرجع 29). يرجى النقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الشكل (3)
الشكل 3. (A) PCR من قالب بوابة DNA. قالب بوابة DNA يحتوي على تسلسل ndsDNA البوابة في مركز (منطقة الزرقاء)، وتسلسل فاصل على طرفي (المناطق السوداء، وهذه متواليات نهاية اثنين متعامدة). يمكن الاشعال ربط تسلسل هل من القالب البوابة، وتوليد أربع شظايا الحمض النووي متداخلة من خلال PCR (متواليات متداخلة هي في الشكل مرمزة). (B) جيبسون التجمع. وfragmen DNA أربعة تضخيمهاثم يتم تجميع البحوث في العمود الفقري البلازميد خطي من خلال جيبسون طريقة التجميع 43. (تم تعديل هذا الرقم بإذن من المرجع 29). يرجى النقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الرقم 4
الرقم 4. أداء الدائرة مع كميات أنزيم مختلفة. (A) تمثيل مبسط للبوابة، مراسل، خيوط المساعدة، وإشارة خيوط المستخدمة في التجارب المماثلة. (B) تجارب حركية مع المستمدة من البلازميد تاريخ AB معالجتها مع كميات أنزيم مختلفة . أنا. 10 وحدات من PvuII-HF و 45 وحدة من Nb.BsrDI لكل 1 ميكروغرام من البلازميد. ثانيا. 10 وحدات من PvuII-HF و 4 وحدات من Nb.BsrDI لكل 1 ميكروغرام من البلازميد. ثالثا. 4 وحدات من PvuII-HF و 4 وحدات من Nb.BsrDI لكل 1 ميكروغرام من البلازميد. وكانت جميع فروع المساعدة في 2X (1X = 10nM). وكان مجمع بوابة 1.5X، وأجريت التجارب على 35 ° C في 1X TAE / المغنيسيوم 2+. (تم تعديل هذا الرقم بإذن من المرجع 29). يرجى النقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الرقم 5
. الرقم 5 تتدفق الرسم البياني للحركية التجارب الأزرق: المواد إضافة إلى كفيت (خلية الكوارتز 0.875 مل الاصطناعية). إشارة الجدول 14 لكميات محددة لإضافة لتجربة الحركية للA + B -> B + C. أخضر: تعليمات من spectrofluorimeter (وصفت بأنها سبكس). الأحمر: خلط التعليمات.53087fig5large.jpg "الهدف =" _ فارغة "> الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل (6)
الرقم 6. أنزيم التفكك ودائرة السلوك. (A) تمثيل مبسط للبوابة، مراسل، خيوط المساعدة، وإشارة خيوط المستخدمة في التجارب المماثلة. (B) تجارب حركية 80 ° C الحرارة تاريخ AB المستمدة من البلازميد باستخدام تعطيل (آثار الخضراء)، 0.15٪ سلفات الصوديوم دوديسيل (SDS) (أحمر)، والسيطرة من دون تعطيل الحرارة أو إضافة SDS (الأزرق). وكان تركيز قياسي 1X = 10 نانومتر، وجميع فروع المساعدة وإدخال B في 2X. وكان مجمع بوابة 1.5X، وأجريت التجارب على 35 ° C في 1X تريس، خلات-EDTA العازلة التي تحتوي على 12.5 ملي المغنيسيوم 2+ (1X TAE / المغنيسيوم 2+ 29.) يرجى النقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الرقم 7
الرقم 7. مراسل المعايرة. (A) مراسل C حركية. وكان تركيز المراسل في 3X (1X = 50 نانومتر)، ويشار إلى التركيز الأولي للإشارة C في الشكل (B) على مستويات مضان إشارة C عند نقطة نهاية القياس (40 دقيقة) تبين وجود علاقة خطية مع التركيز الأولي للإشارة C. وفي مثال الكمي من شوكة BC بوابة (الأخضر خط متقطع)، وكانت قيمة مضان من شوكة BC التدبيرد ك 3 × 10 6 (AU)، وهو ما يعادل 25 نانومتر (0.5X) استنادا إلى منحنى المعايرة. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الرقم 8
الرقم 8. ثنائي الجزيء حركية التفاعل الحفاز (A + B-> B + C). (A) A تبسيط تمثيل البوابة، مراسل، خيوط المساعدة، ومسارات الإشارات المستخدمة في التجارب المماثلة. تم تشغيل التجارب في 1X تريس، خلات-EDTA العازلة التي تحتوي على 12.5 ملي المغنيسيوم 2+ (1X TAE / المغنيسيوم 2+). وكانت جميع المجمعات بوابة في 75 نانومتر تركيز (1.5X)، وكانت خيوط المساعدة في تركيز 100 نانومتر (2X). وتظهر بيانات حركية للبوابات والبيانات المستمدة من البلازميد للبوابات توليفها في (B) و (C) بوابات (D) البلازميد المشتقة أظهرت دوران أعلى من بوابات DNA توليفها عندما أضيفت كميات قليلة من المدخلات. (E) مدى تسرب. يظهر على الرسم البياني شريط نسبة التسرب نهائي للإشارة النهائية (C B0 = 0 / C B0 = 1) في نقطة النهاية (10 ساعة). (تم تعديل هذا الرقم من الرقم 29.) يرجى النقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

قوالب البوابة متواليات طول (الإقليم الشمالي)
JoinAB TCTAGTTCGATCAGAGCGTTATTACCAGTAGTCGATTGCTCAG CTGCTACATTGCTTCTACGAGTCATCCTTCCACCATTGCACCTTAGAGTCCGAATCCTACCATTGCTTAACCGAGTCTCACAACCAGCTGTCATTATGGACTTGACACACAGATTACACGGGAAAGTTGC 173
FORKBC TCTAGTTCGATCAGAGCGTTATTACCAGTAGTCGATTGCTCAGCTGCCATCATAAGAGTCACCATACCCACATTGCCACATCGAGTCCCTTTTCCACCATTGCACCTTAGAGTCCGAATCCTACCATTGCTTAACCGAGTCTCACAACCAGCTGTCATTATGGACTTGACACACAGATTACACGGGAAAGTTGC 194

vious.within صفحة = "دائما"> الجدول 1. متواليات من قوالب البوابة ndsDNA.

بوابة ساحل طول أسفل حبلا (الإقليم الشمالي)
JoinAB JoinAB من أسفل، <a tb>، <ب tr>، <ص TQ> 87
ForkBC ForkBC من أسفل، <i>، <ح ج>، <السل ب>، <tr ص> 108

الجدول 2. السواحل تضم تاريخ AB وشوكة قبل الميلاد. (وقد تم تعديل هذا الجدول من الرقم 29).

مجال تسلسل طول (الإقليم الشمالي)
تا CTGCTA 6
مرض السل TTCCAC 6
ح TACCCA 6
TR TCCTAC 6
تي كيو AACCAG 6
ا CATTGCTTCTACGAGTCATCC 21
ب CATTGCACCTTAGAGTCCGAA 21
ج CATTGCCACATCGAGTCCCTT 21
ص CATTGCTTAACCGAGTCTCAC 21
أنا CTGCCATCATAAGAGTCACCA 21
jove_content "FO: المحافظة على together.within صفحة =" دائما "FO: المحافظة على مع previous.within صفحة =". دائما "> الجدول 3 متواليات مستوى المجال لتنفيذ التفاعل الكيميائي A + B -> B + C (تم تعديل هذا الجدول من الرقم 29).

حبلا التمهيدي متواليات طول (الإقليم الشمالي)
إلى الأمام التمهيدي-1 AAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAG CGTTATTACCAGTAGTCGATTGC 60
عكس التمهيدي-1 ACTACTATTTACTAATCCCATTGCGTGTTCTTATT TAATCTGTGTGTCAAGTCCATAATG 60
إلى الأمام التمهيدي-2 AATAAGAACACGCAATGGGATTAGTAAATAGTAGT CGTTATTACCAGTAGTCGATTGC 58
عكس التمهيدي-2 GCGAAACTAGCTTGTGGTGATATTGTCTCGTGTGT TAATCTGTGTGTCAAGTCCATAATG 60
إلى الأمام التمهيدي-3 ACACACGAGACAATATCACCACAAGCTAGTTTCGC CGTTATTACCAGTAGTCGATTGC 58
عكس التمهيدي-3 ACATTGTACGCCTAAATCATCAAGAATAATTGTTG TAATCTGTGTGTCAAGTCCATAATG 60
إلى الأمام التمهيدي-4 CAACAATTATTCTTGATGATTTAGGCGTACAATGT CGTTATTACCAGTAGTCGATTGC 58
عكس التمهيدي-4 GAGCGCAGCGAGTCAGTGAGCGAGGAAGCCTGCAG TAATCTGTGTGTCAAGTCCATAATG 60

جدول (4). متواليات التمهيدي لPCR من ndsDNA قوالب البوابة.

كاشف حجم رد فعل 1X (ميكرولتر)
عالية نسخ البلازميد العمود الفقري (~ 300 نانوغرام / ميكرولتر) 10
PvuII-HF (20000 وحدة / مل) 2
PstI-HF (20000 وحدة / مل) 2
10X قطع عازلة الذكية 2
H 2 O 4
الحجم الكلي 20 د>

الجدول 5. بروتوكول البلازميد العمود الفقري هضم.

كاشف حجم رد فعل 1X (ميكرولتر)
ناقلات الحمض النووي (~ 50 نانوغرام / ميكرولتر) 1
PCR تضخيم جزء 1 (~ 50 نانوغرام / ميكرولتر) 1
PCR تضخيم جزء 2 (~ 50 نانوغرام / ميكرولتر) 1
PCR تضخيم جزء 3 (~ 50 نانوغرام / ميكرولتر) 1
PCR تضخيم شظية-4 (~ 50 نانوغرام / ميكرولتر) 1
2X الجمعية جيبسون ميكس ماستر 5
الحجم الكلي 10
الصورة "FO: المحافظة على مع previous.within صفحة =" دائما "> الجدول 6 بروتوكول جيبسون التجمع.

كاشف حجم رد فعل 1X (ميكرولتر)
البلازميد الحمض النووي (~ 1 ميكروغرام / تركيز ميكرولتر) 1000
PvuII-HF (20000 وحدة / مل) 200
10X قطع عازلة الذكية 133.3
الحجم الكلي 1333.3

الجدول 7. بروتوكول للبوابات ndsDNA إدراج هضم البلازميد مع انزيم تقييد PvuII-HF.

كاشف الحجم (ميكرولتر)
تاريخ بوابات (~ 5 ميكروغرام / تركيز ميكرولتر) 150
Nb.BsrDI (10000 وحدة / مل) 300
10X قطع عازلة الذكية 50
الحجم الكلي 500

الجدول 8. بروتوكول انضمام بوابات هضم مع الخدش انزيم Nb.BsrDI.

كاشف الحجم (ميكرولتر)
شوكة بوابات (~ 5 ميكروغرام تركيز / ميكرولتر) 150
Nt.BstNBI (10000 وحدة / مل) 600
10X NEB عازلة 3.1 83.3
الحجم الكلي 833.3

together.within صفحة = "دائما" FO: المحافظة على مع previous.within صفحة = "دائما"> الجدول 9 بروتوكول شوكة بوابات هضم مع الخدش انزيم Nt.BstNBI.

ساحل مجال تسلسل طول (الإقليم الشمالي)
JoinAB-القاع تي كيو * ص * TR * ب * السل * على * تا * CTGGTT GTGAGACTCGGTTAAGCAATG GTAGGA TTCGGACTCTAAGGTGCAATG GTGGAA GGATGACTCGTAGAAGCAATG TAGCAG 87
FORKBC-القاع تي كيو * ص * TR * ب * السل * ج * ح * أنا * CTGGTT GTGAGACTCGGTTAAGCAATG GTAGGA TTCGGACTCTAAGGTGCAATG GTGGAA AAGGGACTCGATGTGGCAATG TGGGTA TGGTGACTCTTATGATGGCAG 108
<تا أ> CTGCTA CATTGCTTCTACGAGTCATCC 27
<السل ب> تا ل TTCCAC CATTGCACCTTAGAGTCCGAA 27
<ح ج> السل ب TACCCA CATTGCCACATCGAGTCCCTT 27
<a tb> ح ج CATTGCTTCTACGAGTCATCC TTCCAC 27
<ب tr> والسل CATTGCACCTTAGAGTCCGAA TCCTAC 27
<ص TQ> ب آر CATTGCTTAACCGAGTCTCAC AACCAG 27
<i> ص TQ CTGCCATCATAAGAGTCACCA 21
<tr ص> أنا TCCTAC CATTGCTTAACCGAGTCTCAC 27
<ط ح> TR ص CTGCCATCATAAGAGTCACCA TACCCA 27
<ج tr> ط ح CATTGCCACATCGAGTCCCTT TCCTAC 27
<ج السل> ج TR CATTGCCACATCGAGTCCCTT TTCCAC 27
<ب tr> ج السل CATTGCACCTTAGAGTCCGAA TCCTAC 27
<ط السل> ب آر CTGCCATCATAAGAGTCACCA TTCCAC 27
<ب السل> ط السل CATTGCACCTTAGAGTCCGAA TTCCAC 27
<ب ح> ب السل CATTGCACCTTAGAGTCCGAA TACCCA 27
<ج tr> ب ح CATTGCCACATCGAGTCCCTT TCCTAC 27
<ب tr> ج TR CATTGCACCTTAGAGTCCGAA TCCTAC 27
ROX- <ج * ح *> ب آر / 56 ROXN / AAGGGACTCGATGTGGCAATG TGGGTA 27
<ج> -RQ ج * ح * CATTGCCACATCGAGTCCCTT / 3IAbRQSp / 21
<TQ * ص *> - طمرة CTGGTT GTGAGACTCGGTTAAGCAATG / 36 TAMTSp / 27
RQ- <ص> تي كيو * ص * / 5IAbRQ / CATTGCTTAACCGAGTCTCAC 21
ص

الجدول 10 متواليات ستراند لتنفيذ التفاعل الكيميائي A + B -> B + C (. وقد تم تعديل هذا الجدول من الرقم 29)

كاشف الحجم (ميكرولتر) التركيز النهائي
ROX- <ج * ح *> في 100 ميكرومتر 10 10 ميكرومتر (1X)
<ج> -RQ في 100 μ؛م 13 13 ميكرومتر (1.3x)
10X تاي مع 125 ملي المغنيسيوم 2+ 10 1X TAE مع 12.5 ملي المغنيسيوم 2+
H 2 O 67 -
الحجم الكلي 100 10 ميكرومتر (1X)

بروتوكول المائدة 11. لتجميع مراسل C.

كاشف الحجم (ميكرولتر) التركيز النهائي
H 2 O 514 -
10X تاي مع 125 ملي المغنيسيوم 2+ 60 1X TAE مع 12.5 ملي المغنيسيوم 2+
PolyT في 300 μ؛م 2 1 ميكرومتر
مراسل C في 10 ميكرومتر 9 150 نانومتر (3X)
10٪ SDS 9 0.15٪
<ح ج> في 5 ميكرومتر 6 50 نانومتر (1X)
الحجم الكلي 600 -

الجدول 12. بروتوكول لمعايرة مراسل C. إن الكميات المقدمة هنا هو لحجم رد الفعل الكلي 600 ميكرولتر (المقابلة لاستخدام خلية الكوارتز الاصطناعية مل 0.875)، ولكن يمكن تعديلها لتعمل مع خلايا مختلفة الحجم.

<td> 600
كاشف الحجم (ميكرولتر) يخدع النهائيوحدانية التركيز
H 2 O 493 -
10X تاي مع 125 ملي المغنيسيوم 2+ 60 1X TAE مع 12.5 ملي المغنيسيوم 2+
polyT في 300 ميكرومتر 2 1 ميكرومتر
مراسل C في 10 ميكرومتر 9 150 نانومتر (3X)
<ط TC> في 100 ميكرومتر 3 10X
<ج السل> في 100 ميكرومتر 3 10X
<ب tr> في 100 ميكرومتر 3 10X
10٪ SDS 9 0.15٪
شوكة في BC ~ 1 ميكرومتر (تركيز غير معروف) 15 ~ 0.5X
<ص TQ> في 100 ميكرومتر 3 10X
الحجم الكلي -

الجدول 13. بروتوكول لمعايرة شوكة قبل الميلاد. إن الكميات المقدمة هنا هو لحجم رد الفعل الكلي 600 ميكرولتر، ولكن يمكن تعديلها لتعمل مع خلايا مختلفة الحجم.

كاشف الحجم (ميكرولتر) التركيز النهائي
H 2 O 407.2 -
10X تاي مع 125 ملي المغنيسيوم 2+ 52.8 12.5 ملي المغنيسيوم 2+
polyT في 300 ميكرومتر 2 1 ميكرومتر
مراسل C في 10 ميكرومتر 9 150 نانومتر (3X)
<ط TC> في 10 ميكرومتر 6 100 نانومتر (2X)
<ج السل> في 10 ميكرومتر 6 100 نانومتر (2X)
<ب tr> في 10 ميكرومتر 6 100 نانومتر (2X)
<tr ص> في 10 ميكرومتر 6 100 نانومتر (2X)
10٪ SDS 9 0.15٪
تاريخ AB في 1 ميكرومتر 45 75 نانومتر (1.5X)
شوكة BC على 1 ميكرومتر 45 75 نانومتر (1.5X)
<تا أ> في 10 ميكرومتر 3 50 نانومتر (1X)
<السل ب> في 10 ميكرومتر 3 50 نانومتر (1X)
الحجم الكلي 600 -

بروتوكول 14. الجدول لتفاعل مادة كيميائية + B-> B + C. إن الكميات المقدمة هنا هو لحجم رد الفعل الكلي 600 ميكرولتر، ولكن يمكن تعديلها لتعمل مع خلايا مختلفة الحجم.

بوابات توليفها بوابات المستمدة من البلازميد
وصف كلفة تاريخ بوابات بوابات شوكة
PAGE حبلا طويلا النقي (100 الإقليم الشمالي، بمثابة فروع السفلى من بوابة) ~ 75 $ وصف < / قوي> كلفة وصف كلفة
PAGE حبلا القصير النقي (~ 30 الإقليم الشمالي، شغل منصب أعلى خيوط من البوابة) ~ 185 $ قالب البوابة ~ 100 $ قالب البوابة ~ 100 $
الإجمالي الكلي ~ 260 $ البلازميد عدة استخراج ~ 26 $ البلازميد عدة استخراج ~ 26 $
انزيم التقييد (PvuII-HF) ~ 11 $ انزيم التقييد (PvuII-HF) ~ 11 $
الخدش انزيم (Nt.BsrDI، تاريخ بوابات) ~ 29 $ انزيم الخدش (Nt.BstNBI، والبوابات شوكي) ~ 62 $
الإجمالي الكلي ~ 166 $ الإجمالي الكلي ~ 199 $

في صفحة = "دائما" FO:. المحافظة على مع previous.within صفحة = "دائما"> الجدول 15 مقارنة بين التكلفة بوابات المستمدة من البلازميد وبوابات توليفها (. وقد تم تعديل هذا الجدول من الرقم 29)

بوابات توليفها بوابات المستمدة من البلازميد
معالجة زمن التحميل معالجة زمن التحميل
الصلب 1 ساعة استنساخ 5 ساعة
تنقية PAGE 2 ساعة استخراج البلازميد 2 ساعة
الإجمالي الكلي 3 ساعة خطوتين الهضم انزيم 0.5 ساعة
هطول الأمطار الإيثانول
الإجمالي الكلي 8.5 ساعة

الجدول 16. المقارنة بين زمن التحميل بوابات المستمدة من البلازميد وبوابات الاصطناعية. (تم تعديل هذا الجدول من الرقم 29).

Discussion

وتصف هذه الورقة طريقة لاشتقاق بوابات ndsDNA من DNA البلازميد نقية للغاية. وعلاوة على ذلك، يتم تقديم بروتوكول للتميز أداء البوابة باستخدام فحص حركية مضان. وتبين بيانات التجارب أن النظام المستمدة من البلازميد يتفوق نظيرتها الاصطناعية حتى لو تم تجميعها في نظام الاصطناعية من خيوط تنقيته باستخدام هلام بولي أكريلاميد الكهربائي (PAGE). على الأرجح، ويرجع ذلك في المقام الأول إلى نقاء عالية جدا من الحمض النووي البيولوجي في تحسين أداء بوابات المستمدة من البلازميد. يحتوي على الحمض النووي الاصطناعي مجموعة متنوعة من الأخطاء، في الحذف معينة التي تؤدي إلى أليغنوكليوتيد] من طول هذه المنتجات الجانبية ن 1، وعادة ما يتم إزالة تماما في PAGE أو عالية الأداء اللوني السائل (HPLC) إجراءات التنقية. وقد لوحظت تحسينات مماثلة لتلك التي ذكرت هنا أيضا في دراسة سابقة من مكبر للصوت دبوس المحفزة التي تستخدم DNA المستمدة من مصادر بيولوجية 21.

الحمار = "jove_content"> ومع ذلك، وحتى استخدام البوابات المستمدة من البلازميد لا يمكن القضاء على الأخطاء في أداء البوابة، التي هناك سببين على الأقل تماما: أولا الإفراط في الهضم أو عدم وجود قطع الدقة يمكن أن يؤدي إلى البوابات مع عدد كبير جدا النكات أو النكات في مواضع خاطئة. في كلتا الحالتين، هم أكثر عرضة للمشاركة في ردود فعل غير مرغوب فيها البوابات. قد خففت هذه المشاكل عن طريق الاستفادة المثلى من كمية الإنزيم المستخدم (انظر الشكل 4). ثانيا، في هذه التجارب، وكانت معظم المدخلات وخيوط المساعدة DNA الاصطناعية وتضمنت الحذف وطفرات الآن. من حيث المبدأ، يمكن أيضا الحصول على كل مدخل واحد الذين تقطعت بهم السبل وخيوط المساعدة من DNA phagemid من خلال انزيم الهضم الخدش من الجينوم الفيروسي M13 المشفرة قبل 26. ولعل أداء الدائرة ويمكن زيادة تحسين استخدام ssDNA المستمدة من الجينوم البكتيري.

في حين تم العثور على استخدام بوابات المستمدة من البلازميد لتحسين أداء الدوائر، تحليلالعصر التكلفة وتجهيز كشف أنه في حين أن إنتاج البوابات المستمدة من البلازميد هو أرخص قليلا (الجدول 15)، فإنه يأخذ 2-3 مرات أطول وقت المعالجة مقارنة مع التجمع وتنقية البوابات من oligos تصنيعه تجاريا (الجدول 16). التكاليف الأولية للبوابات المستمدة من البلازميد هي التوليف الجيني واستخدام أنزيمات التقييد. 300 pmole من بوابات (ما يكفي لمدة 15 ردود الفعل في 30 نانومتر)، وتبلغ التكلفة التقديرية للتاريخ أبواب ما يقرب من 170 $ و 200 $ للشوكة البوابات، والفرق في التكاليف كونها نتيجة لاستخدام الإنزيمات الخدش مختلفة. في المقابل، فإن التركيب الكيميائي للفروع لتغطية تكاليف البوابة نفسها حوالي 260 $ بما في ذلك رسوم تنقية PAGE. تكلفة الوقت الأولية للبوابات المستمدة من البلازميد هو في إجراء الاستنساخ، التي، تماما مثل الحمض النووي، يمكن الاستعانة بمصادر خارجية لشركة التوليف الجيني. ومع ذلك، مرة واحدة تجميعها، والبوابات المستمدة من البلازميد لديها ميزة أن البلازميدات المضيف يمكن بسهولة أن تتكرر لالثانية يمكن تخزينها في شكل أسهم الجلسرين البكتيرية. هذا يجعل من الممكن إعادة استخدام بوابات عدة مرات.

نتطلع إلى الأمام، يمكن أن تحسن أداء بوابات المستمدة من البلازميد تمكين مجموعة أكبر بكثير من ديناميات السلوك من أثبتت تجريبيا حتى الآن مع DNA CRNs. على سبيل المثال، اقترح مؤخرا 47،48 العمل النظري الذي الأنماط المكانية ذاتية التنظيم على المستوى الكلي يمكن أن تتحقق مع CRNs DNA من خلال آلية نشر رد. الطريقة المعروضة هنا يوفر مسارا قابلا للتطبيق لبناء المكونات الجزيئية الكامنة لهذه المواد DNA-الزخرفة النفس. بالرغم من صعوبتها، فإن وضع الأشكال التضاريسية المستوى الكلي في طريقة برمجة لها آثار كبيرة في مجالات تتراوح من الأبحاث الحيوية في الطب التجديدي.

Acknowledgements

أرقام 1، 2، 3، 4، 6، 8 و الجداول 2 و 3 و 10 و 15 و 16 يتم تعديلها من الرقم 29. وأيد هذا العمل من قبل مؤسسة العلوم الوطنية (NSF-منح CCF 1117143 وNSF-CCF 1162141 لGS). وأيد Y.-JC التي كتبها الزمالات الحكومة التايوانية. وأيد SDR من قبل البرنامج الوطني للعلوم مؤسسة العليا للبحوث زمالة (GRFP).

Materials

Name Company Catalog Number Comments
Phusion High-Fidelity PCR Master Mix with HF Buffer NEB M0531S
PvuII-HF NEB R3151L
PstI-HF NEB R3140S
Gibson Assembly Master Mix NEB E2611S
Terrific Broth, Modified SIGMA-ALDRICH T0918-250G
QIAprep Spin Miniprep Kit (250) QIAGEN 27106
QIAGEN Hispeed Maxi-prep Kit QIAGEN 12662
Nb.BsrDI NEB R0648L
Nt.BstNBI NEB R0607L
NanoDrop 2000c Thermo Scientific
Double-stranded Genomic Blocks IDT
Horiba Jobin-Yvon Spex Fluorolog-3 Fluorimeter Horiba/Jobin Yvon
Synthetic Quartz Cells  Starna 23-5.45-S0G-5
QIAGEN Gel Extraction Kit QIAGEN 28706
Plasmid Backbones BioBrick E0240-pSB1A2 High copy number plasmid with Ampicillin resistance. Sequence can be found from http://parts.igem.org

DOWNLOAD MATERIALS LIST

References

  1. Zhang, D. Y., Seelig, G. Dynamic DNA nanotechnology using strand-displacement reactions. Nat. Chem. 3, 103-113 (2011).
  2. Krishnan, Y., Simmel, F. C. Nucleic acid based molecular devices. Angew. Chem. Int. Ed. Engl. 50, 3124-3156 (2011).
  3. Zhang, D. Y., Winfree, E. Control of DNA strand displacement kinetics using toehold exchange. J. Am. Chem. Soc. 131, 17303-17314 (2009).
  4. Qian, L., Winfree, E., Bruck, J. Neural network computation with DNA strand displacement cascades. Nature. 475, 368-372 (2011).
  5. Qian, L., Winfree, E. Scaling up digital circuit computation with DNA strand displacement cascades. Science. 332, 1196-1201 (2011).
  6. Zadegan, R. M., Jepsen, M. D., Hildebrandt, L. L., Birkedal, V., Kjems, J. Construction of a fuzzy and boolean logic gates based on DNA. Small. 11, 1811-1817 (2015).
  7. Seelig, G., Soloveichik, D., Zhang, D. Y., Winfree, E. Enzyme-free nucleic acid logic circuits. Science. 314, 1585-1588 (2006).
  8. Zadegan, R. M., et al. Construction of a 4 zeptoliters switchable 3D DNA box origami. ACS Nano. 6, 10050-10053 (2012).
  9. Andersen, E. S., et al. Self-assembly of a nanoscale DNA box with a controllable lid. Nature. 459, 73-76 (2009).
  10. Zhang, D. Y., Hariadi, R. F., Choi, H. M., Winfree, E. Integrating DNA strand-displacement circuitry with DNA tile self-assembly. Nat. Commun. 4, (1965).
  11. Yurke, B., Turberfield, A. J., Mills, A. P., Simmel, F. C., Neumann, J. L. A DNA-fuelled molecular machine made of DNA. Nature. 406, 605-608 (2000).
  12. Green, S. J., Lubrich, D., Turberfield, A. J. DNA hairpins: fuel for autonomous DNA devices. Biophys. J. 91, 2966-2975 (2006).
  13. Venkataraman, S., Dirks, R. M., Rothemund, P. W., Winfree, E., Pierce, N. A. An autonomous polymerization motor powered by DNA hybridization. Nat. Nanotechnol. 2, 490-494 (2007).
  14. Green, S. J., Bath, J., Turberfield, A. J. Coordinated chemomechanical cycles: a mechanism for autonomous molecular motion. Phys. Rev. Lett. 101, 238101 (2008).
  15. Omabegho, T., Sha, R., Seeman, N. C. A bipedal DNA Brownian motor with coordinated legs. Science. 324, 67-71 (2009).
  16. Turberfield, A. J., et al. DNA fuel for free-running nanomachines. Phys. Rev. Lett. 90, 118102 (2003).
  17. Dirks, R. M., Pierce, N. A. Triggered amplification by hybridization chain reaction. Proc. Natl. Acad. Sci. U. S. A. 101, 15275-15278 (2004).
  18. Seelig, G., Yurke, B., Winfree, E. Catalyzed relaxation of a metastable DNA fuel. J. Am. Chem. Soc. 128, 12211-12220 (2006).
  19. Zhang, D. Y., Turberfield, A. J., Yurke, B., Winfree, E. Engineering entropy-driven reactions and networks catalyzed by DNA. Science. 318, 1121-1125 (2007).
  20. Yin, P., Choi, H. M., Calvert, C. R., Pierce, N. A. Programming biomolecular self-assembly pathways. Nature. 451, 318-322 (2008).
  21. Chen, X., Briggs, N., McLain, J. R., Ellington, A. D. Stacking nonenzymatic circuits for high signal gain. Proc. Natl. Acad. Sci. U. S. A. 110, 5386-5391 (2013).
  22. Phillips, A., Cardelli, L. A programming language for composable DNA circuits. J. R. Soc. Interface. 6, Suppl 4. S419-S436 (2009).
  23. Lakin, M. R., Youssef, S., Polo, F., Emmott, S., Phillips, A. Visual DSD: a design and analysis tool for DNA strand displacement systems. Bioinformatics. 27, 3211-3213 (2011).
  24. Lakin, M. R., Youssef, S., Cardelli, L., Phillips, A. Abstractions for DNA circuit design. J. R. Soc. Interface. 9, 470-486 (2012).
  25. Zhang, D. Y., Winfree, E. Robustness and modularity properties of a non-covalent DNA catalytic reaction. Nucleic Acids Res. 38, 4182-4197 (2010).
  26. Ducani, C., Kaul, C., Moche, M., Shih, W. M., Hogberg, B. Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides. Nat. Methods. 10, 647-652 (2013).
  27. Lin, C., et al. In vivo cloning of artificial DNA nanostructures. Proc. Natl. Acad. Sci. U. S. A. 105, 17626-17631 (2008).
  28. Bhatia, D., et al. Icosahedral DNA nanocapsules by modular assembly. Angew. Chem. Int. Ed. Engl. 48, 4134-4137 (2009).
  29. Chen, Y. J., et al. Programmable chemical controllers made from DNA. Nat. Nanotechnol. 8, 755-762 (2013).
  30. Arkin, A., Ross, J. Computational functions in biochemical reaction networks. Biophys. J. 67, 560-578 (1994).
  31. Érdi, P., Tóth, J. Mathematical models of chemical reactions: theory and applications of deterministic and stochastic models. Manchester University Press. (1989).
  32. Magnasco, M. O. Chemical kinetics is Turing universal. Phys. Rev. Lett. 78, 1190 (1997).
  33. Oishi, K., Klavins, E. Biomolecular implementation of linear I/O systems. IET Syst. Biol. 5, 252-260 (2011).
  34. Senum, P., Riedel, M. Rate-independent constructs for chemical computation. PLoS One. 6, (2011).
  35. Soloveichik, D., Cook, M., Winfree, E., Bruck, J. Computation with finite stochastic chemical reaction networks. Natural Computing. 7, 615-633 (2008).
  36. Soloveichik, D., Seelig, G., Winfree, E. DNA as a universal substrate for chemical kinetics. Proc. Natl. Acad. Sci. U. S. A. 107, 5393-5398 (2010).
  37. Tyson, J. J., Chen, K. C., Novak, B. Sniffers, buzzers, toggles and blinkers: dynamics of regulatory and signaling pathways in the cell. Curr. Opin. Cell. Biol. 15, 221-231 (2003).
  38. Cardelli, L. Two-domain DNA strand displacement. Math. Struct. Comput. Sci. 23, 247-271 (2013).
  39. Angluin, D., Aspnes, J., Eisenstat, D. A simple population protocol for fast robust approximate majority. Distrib. Comput. 21, 87-102 (2008).
  40. Cardelli, L., Csikasz-Nagy, A. The cell cycle switch computes approximate majority. Sci. Rep. 2, 656 (2012).
  41. Zadeh, J. N., et al. NUPACK: Analysis and design of nucleic acid systems. J. Comput. Chem. 32, 170-173 (2011).
  42. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. J. Vis. Exp. (2012).
  43. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods. 6, 343-345 (2009).
  44. Froger, A., Hall, J. E. Transformation of plasmid DNA into E. coli using the heat shock method. J. Vis. Exp. e253 (2007).
  45. Lessard, J. C. Transformation of E. coli via electroporation. Methods Enzymol. 529, 321-327 (2013).
  46. Nasri, M., Thomas, D. Alteration of the specificity of PvuII restriction endonuclease. Nucleic Acids Res. 15, 7677-7687 (1987).
  47. Dalchau, N., Seelig, G., Phillips, A. Computational design of reaction-diffusion patterns using DNA-based chemical reaction networks. DNA Computing and Molecular Programming. 84-99 (2014).
  48. Scalise, D., Schulman, R. Designing modular reaction-diffusion programs for complex pattern formation. Technology. 2, 55-66 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics