Plasmid-härledda DNA Strand Displacement Gates för genomförande Kemisk reaktions Networks

Biology
 

Cite this Article

Copy Citation | Download Citations

Chen, Y. J., Rao, S. D., Seelig, G. Plasmid-derived DNA Strand Displacement Gates for Implementing Chemical Reaction Networks. J. Vis. Exp. (105), e53087, doi:10.3791/53087 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Förutsägbarheten Watson-Crick basparning har gjort dynamisk DNA nanoteknik att framstå som ett programmerbart sätt att utforma molekylära enheter med dynamiska egenskaper 1,2. I synnerhet DNA strängförskjutning - en programmerbar, konkurrenskraftig hybridiseringsreaktion - har visat sig vara en kraftfull mekanism för att konstruera dynamiska DNA system. I en DNA-sträng reaktion, förskjuter en inkommande oligonukleotid en tidigare bunden "output" sträng från en komplementär bindningspartner. Flera sådana reaktioner kan länkas samman till flerstegsreaktions kaskader med en hög grad av kontroll över den ordning och tidpunkten för individuella reaktionsstegen 3. DNA Strand Displacement kaskader har använts för att skapa digitala och analoga molekyl kretsarna 4-7, omkopplingsbara nanostrukturer 8-10, autonoma molekylära motorer 11-15, och icke-kovalenta katalytiska förstärkare 13,16-21. Dessutom DNA enheter med strängförskjutning reaktioner kan simuleras och utformade för olika tillämpningar som använder datorstödd design mjukvara 22-24.

För närvarande fungerar kemiskt syntetiserat DNA som huvudmaterial för DNA nanoteknologi. Men fel i DNA-syntesprocessen, och de resulterande ofullkomliga oligonukleotider, tros begränsa prestandan hos dynamiska DNA-enheter genom att orsaka felaktiga bireaktioner. Till exempel kan "läcka" reaktioner kan resultera i frisättning av en utgångs oligonukleotid även i frånvaro av ett reaktions utlösare. Sådana effekter är mest uppenbara i autokatalytiska reaktions kaskader där även en minimal mängd av initial läcka så småningom kommer att leda till fullständig aktivering av kaskaden 19,20. Omvänt, reaktioner ofta misslyckas med att nå den förväntade nivån på aktivering eftersom vissa komponenter inte utlöser även i närvaro av den avsedda ingång 7,25. För att göra utförandet av DNA-baseradnanomaskiner som är jämförbara med deras biologiska proteinbaserade motsvarigheter sådana lägen fel måste minskas drastiskt.

Bakterieplasmider eller andra biologiska DNA skulle kunna tjäna som en relativt billig källa av mycket ren DNA för nanoteknikapplikationer. Stora mängder DNA kan genereras genom replikation i bakterier och de inneboende korrekturläsning förmåga levande system säkerställa renheten hos det resulterande DNA. I själva verket har flera nya papper erkänt potentiella användbarheten av biologisk DNA för nanotekniska applikationer 21,26-28. Emellertid har det helt dubbelsträngad naturen av plasmid-DNA som hittills förbjudet dess användning som ett material för tillverkning av dynamiska DNA-enheter, vilka typiskt består av flera oligonukleotider och innehåller både dubbelsträngade och enkelsträngade domäner. I en nyligen papper 29 denna fråga togs upp och en ny DNA-grind arkitektur som består främst av trasiga dubbelsträngat DNA (ndsDNA) var införad.

Viktigt kan system ndsDNA grindar utformas som inser dynamiken som anges av någon formell kemisk reaktion nätverk (CRN) 29. ndsDNA grindar kan således användas i princip att skapa dynamiska system som uppvisar svängningar och kaos, bistabilitet och minne, Boolean logik eller algoritmiska beteenden 30-38. Till exempel, Ref. 29 visade en tre-reaktions CRN som gav en molekyl genomförande av en "konsensus" protokoll, en typ av distribuerad databehandling algoritm 29,39,40. Detta arbete först visat en ny användning för CRN formalism som en "programmeringsspråk" för att snabbt syntetisera funktionella molekylära system (Figur 1A).

Här är ett detaljerat protokoll för att härleda ndsDNA portar från plasmid-DNA tillhandahålls. Först är en översyn av sekvensen designprocessen. Därefter följer en förklaring av hur syntetiska oligonukleotider innehållandegrind sekvenserna klonas in i plasmider och sekvens verifieras och förstärks via bakteriekultur. Det visas nästa, hur ndsDNA grindar kan härledas från plasmiderna genom enzymatisk behandling (se figur 2). Slutligen är en metod för att testa porten beteende genom fluorescens kinetik analyser som beskrivs.

Reaktionsmekanism
Som ett exempel, fokuserar protokollet om den katalytiska kemiska reaktionen A + B-> B + C. Arten A, B, och C ("signaler", Figur 1B) alla motsvarar en annan enkelsträngad DNA-molekyl. Sekvenserna för dessa molekyler är helt oberoende och strängarna inte reagerar med varandra direkt. Sekvenserna för alla signaler har två olika funktionella domäner, det vill säga, subsekvenser som samverkar i strängförskjutning reaktioner: 1) en kort fotfäste domän (etiketter ta, tb, tc) som används för initiering av strängförflyttning reaction och 2) en lång domän (etiketter a, b, c) som bestämmer signalidentitet.

Interaktioner mellan signalsträngar förmedlas av nicked dubbelsträngade DNA (ndsDNA) gate-komplex (kallas AB och gaffel BC) och hjälpenkelsträngade arter (<tr r>, <b tr>, <c tb> och <i tc >). Den formella reaktion A + B-> B + C utförs genom en serie av strängundanträngningsreaktionssteg, där varje reaktionssteg exponerar ett fotfäste för en efterföljande reaktion (Figur 1B). I detta exempel signalerna A och B är initialt fri i lösning medan signalen C är bunden till den gaffel grinden. Vid slutet av reaktions B och C är i lösning. Mer allmänt signaler som är bundna till en grind är inaktiva medan signaler som är fria i lösning är aktiva, det vill säga, de kan delta i en strängförskjutningsreaktion somen ingång. Tidsförloppet för reaktionen följes med användning av en fluorescerande reporter strategi (Figur 1C). I tidigare arbete 29, visades det att denna reaktionsmekanism inser inte bara den korrekta stökiometrin utan också kinetiken hos mål-reaktionen.

Protocol

1. Sekvens Design

Obs: Sekvens designen översikt: I det här avsnittet är strategin för att utforma plasmid-härledda DNA-portar beskrivs. Enzymställen placerade på vardera änden av portarna för att möjliggöra lanseringen av helt dubbelsträngade grindar efter matsmältningen. Nicking ställen placeras sedan så att enzymer skapar skåror på toppsträngen för att skapa de slutliga ndsDNA grindar. Slutligen är de återstående sekvenserna väljs så att oberoende domäner är ortogonala mot varandra och inte uppvisar sekundärstruktur.

  1. Placera Nt.BstNBI nickstället fyra nukleotider från 3'-änden av varje lång domän (a, b, c, r och i). Placera Nb.BsrDI nickstället på 5 'änden av varje lång domän (a, b, c, och r. Notera att domänen i saknar någon Nb.BsrDI nickstället). Figur 2C visar den detaljerade sekvensen vy av AB och gaffel BC grindar.
  2. Placera PvuII-restriktionsstället i båda ändarna av ndsDNA grindar så att PvuII-digerering kan frigöra grindarna från plasmider (se figur 2C).
  3. Plan andra obegränsade sekvenser genom att följa två principer: (a) delarna bör inte uppvisa sekundära strukturer (DNA-strukturer kan förutsägas med användning NuPack 41), och (b) alla områden bör vara ortogonala för att minimera överhörning.
  4. Placera ndsDNA sekvenser i centrum av en grind mall. Placera 30-40 bp slumpspacersekvenser i båda ändarna av grind mallen, tjänar varje distansorgan som en unik bindningsställe för följande polymeraskedjereaktion (PCR).

2. Kloning av NdsDNA Gates i plasmider

Obs: Detta avsnitt beskriver Gibson kloningsmetod för att sätta in 4 kopior av porten i en plasmid ryggrad.

  1. Beställ ndsDNA gate mallar som dubbelsträngade genomiska kvarter från en DNA-tillverkare (gate templatsekvenser visasi tabell 1; strängarna förekommer i ndsDNA grindar är visade i tabell 2; domännivå sekvenser visas i tabell 3).
  2. Efter att ha mottagit den ordnade DNA snurra rören innehållande genomiska block vid 10,000-14,000 xg under 1 min för att säkerställa att alla torkade DNA är i botten av röret.
  3. Resuspendera torkade genomiska blocken i DNas-fritt vatten för att uppnå en slutlig koncentration av 10 ng / ul.
    Anmärkning: Alternativt kan DNA återsuspenderades med användning av 1x Tris etylendiamintetraättiksyra (EDTA) buffert (TE-buffert: 10 mM Tris och 1 mM EDTA, pH 8,0). Dock är EDTA en kelatbildare för tvåvärda katjoner och kunde inhibera PCR.
  4. Generera 4 gate fragment med olika överlappande regioner genom en standard-PCR med en hifi-DNA-polymeras (se figur 3A). Primersekvenserna anges i detalj i tabell 4 (smälttemperaturen för dessa primrar är 62 ° C).
  5. Kör ett 2% agarosgel vid ett40 V under 30 min vid RT (för en detaljerad agarosgelelektrofores protokoll se 42) och skär banden motsvarande varje PCR-amplifierade fragmentet ut från gelén. Renar sedan gelskivorna användning av en gelextraktionskit (se Material) genom att följa tillverkarens instruktioner.
  6. Smälta en plasmid med högt kopietal ryggraden (se material) med PvuII-HF och Pstl-HF vid 37 ° C under 1 timme (se tabell 5) enligt tillverkarens protokoll. PvuII-HF och Pstl-HF är high fidelity restriktionsenzymer, som dramatiskt minskar ospecifika nedskärningar.
  7. Kör ett 1,5% agarosgel och skära den linjäriserade ryggraden (typiskt kör gelén vid 140 V under 30-40 min vid RT). Extrahera sedan DNA: t från gelskivan med användning gelextraheringskit enligt tillverkarens instruktioner.
  8. Utför Gibson aggregatet 43 med den linjäriserade vektorn och renade PCR-fragment (se tabell 6 och figur 3B
  9. Omvandla Gibson aggregatet produkten från steg 2,8 i Escherichia coli (E. coli) och plattan på ett lysogeni Broth (LB) agarplatta innehållande ampicillin antibiotika (vid en koncentration av 100 | ig / ml). Utför transformation genom elektroporering eller en värmechock metod 44,45, och använda lämpliga E. coli-stam. Använd till exempel E. coli-stam JM109 för värmechock transformation och använda DH5a elektrokompetent E. coli-celler för elektroporering.
    Obs: Plasmiden ryggrad som används innehåller en Ampicillinresistens kassett. Om du använder en annan selektionsmarkör, använda lämpliga antibiotika i stället för ampicillin.

3. Bakteriekultur förstärkning och kvalitetskontroll

Obs! Det här avsnittet beskriver massproduktion och isolering av plasmider innehållande DNA-grindarna efter kvalitetskontroll.

  1. Välj en enda kolonifrån Ampicillin selektiv platta från steg 2,9 och inkubera en kultur av 3 ml berikat medium innehållande ampicillin antibiotika (vid en koncentration av 100 | ig / ml). Markera kolonin så att den kan användas igen i efterföljande experimentella steg. Odla kulturen vid 37 ° CO / N under kraftig skakning (200-300 varv per minut). Typiskt inkubera i 16-24 timmar.
  2. Extrahera plasmid-DNA från bakteriekulturen med hjälp av en Mini-prep-kitet enligt tillverkarens instruktioner.
  3. Mät den renade plasmid-DNA med användning av en spektrofotometer enligt tillverkarens instruktioner. Typiska varierar avkastning från 50-1000 ng / l.
  4. Få det extraherade plasmid-DNA sekvensbestämdes genom att skicka provet för en DNA-sekvenseringsföretag. Sekvenseringsprimrar bör placeras ca 100 nukleotider uppströms och nedströms i regionen som skall sekvenseras; sekvenseringsprimern för plasmiden (se material för plasmiden) har följande sekvens: ATTACCGCCTTTGAGTGAGC.
    Nejte: Om det finns sekvens fel eller rekombination i den införda ndsDNA grindar, välja en annan koloni från plattan från steg 2.9. Följ steg 3,1-3,4 för att verifiera att sekvenserna av de insatta grindarna är korrekta.
  5. Efter att ha kontrollerat att sekvenserna är korrekta, plocka motsvarande koloni från Ampicillin selektiv platta (från steg 2,9), och inkubera en kultur av 800 ml Terrific Broth (TB) innehållande ampicillin antibiotika (vid en koncentration av 100 | ig / ml). Odla kulturen vid 37 ° C under 16-24 h med kraftig skakning (200-300 rpm). TB särskilt lämpar sig väl för hög avkastning plasmid produktion.
    Obs: Alternativt kan LB också användas för att odla bakterier även plasmiden avkastning kan vara ett problem.
  6. Rena DNA med användning av en Maxi-prep-kit enligt tillverkarens instruktioner.
  7. Följ steg 3,3-3,4 för att kontrollera om sekvenserna är korrekta. Om någon rekombination inträffade, se följande anmärkning. Annars, gå vidare till steg 4. <br /> Obs: En möjlig frågan här är att multipla kopior av insatta portar i plasmiden kan rekombinera på grund av DNA-reparation. För att lösa problemet genom att använda en E. coli-stam som saknar recA proteinet (ett protein i samband med DNA-reparation), såsom JM109 eller DH5a att omvandla en tidigare sekvens-verifierades plasmid (dvs utan några sekvens fel och rekombination). Sedan plocka en koloni från denna platta och verifiera plasmidsekvensen genom att skicka provet till ett DNA-sekvensering företag.

4. Enzymatisk Bearbetning

Obs! Det här avsnittet beskriver processen för att smälta plasmiderna så att de skärs och trasiga på rätt platser och redo att användas för kinetiska experiment.

  1. Smälta den renade plasmid-DNA från steg 3,7 med restriktionsenzymet PvuII-HF under 1 h vid 37 ° C (se tabell 7). Typiskt smälta plasmiden med 4 enheter PvuII-HF per 1 mg av plasmid. Hög fidelity restriktionsenzymer rekommenderas för användning eftersom de dramatiskt minska ospecifika nedskärningar.
  2. Utför etanolutfällning på provet.
    1. Tillsätt 2 ekvivalenta volymer iskall absolut etanol till provet.
    2. Inkubera blandningen vid -80 ° C under minst en timme (denna blandning kan också sitta vid -80 ° C i O / N).
    3. Centrifugera vid 10,000-14,000 xg vid 0 ° C under 30 minuter.
    4. Avlägsna supernatanten.
    5. Lägg 1.000 il RT 95% etanol till provet, och invertera 10-15 gånger.
    6. Centrifugera vid 10,000-14,000 xg vid 4 ° C under 10 minuter.
    7. Avlägsna supernatanten och lufttorka på bänken under 10-20 min.
    8. Resuspendera DNA pellets i en lämplig volym av Nukleasfritt fritt H2O (typiskt 100-200 il). Lägga till mer än 200 ^ i allmänhet göra provet spädas för användning i kinetiska experiment.
  3. Mät återsuspenderade DNA: t med användning av en spektrofotometer efter manufacturer anvisningar.
  4. Digest ansluter portar med nicking enzym Nb.BsrDI vid 65 ° C under 1 h med användning av 4 enheter enzym per 1 | j, g av plasmid (se tabell 8); smälta gaffel grindar med nicking enzym Nt.BstNBI vid 55 ° C under 1 h med användning av 8 enheter av enzym per 1 | j, g av plasmid (se tabell 9).
    Obs: Steg 4,2 avlägsnar enzymdigestion buffert och hjälper koncentrera portarna för kinetiska experiment. Steg 4.2 kan hoppas över för gå grindar eftersom både restriktionsenzymet PvuII-HF och nicking enzym Nb.BsrDI samma matsmältningen buffert. I steg 4.2.8 är Nukleasfritt fritt H2O används i stället för TE eftersom EDTA är en kelatbildare för divalenta katjoner och kan hämma restriktionsenzymer som behöver dessa joner att fungera.
    Obs: Tillsats av överskottsmängder av enzymer kan leda till höga halter av initial kretsläckage (Figur 4), som är mest sannolikt orsakas av över digestion 46. Denna fråga can åtgärdas genom att optimera enzym mängder (se Figur 4). Typiskt intervall av enzymer är från 1-10 enheter / 1 ^ g plasmid.

5. Beredning av enkelsträngade oligonukleotider

Obs: Detta avsnitt beskriver protokoll för återsuspendering och kvantifiera kemiskt syntetiseras enkelsträngat DNA (ssDNA) som kommer att användas för signal strängar och hjälp strängar. För strängsekvenserna se tabell 10. Observera att följande protokoll är ett exempel på att förbereda 10 iM ssDNA. Andra koncentrationer av ssDNA kan framställas på liknande sätt.

  1. Efter att ha fått oligos från DNA tillverkare, snurra rören innehållande DNA vid 10,000-14,000 xg under 1 min för att säkerställa att alla torkade DNA är i botten av röret.
  2. Resuspendera DNA med användning 1x Tris etylendiamintetraättiksyra (EDTA) buffert (TE-buffert: 10 mM Tris och 1 mM EDTA, pH 8,0) för att uppnå en slutlig koncentration av 100 | iM. Förexempel resuspendera 8 nmol DNA i 80 | il TE-buffert.
  3. Blanda 10 pl av DNA vid 100 pM med 90 pl av molekyl vatten i ett mikrocentrifugrör, som bör uppnå en slutlig koncentration av 10 | iM.
  4. Mät den exakta koncentrationen av DNA-provet med användning av en spektrofotometer enligt tillverkarens instruktioner. Följande protokoll ger ett exempel på hur DNA-koncentration kan mätas.
    1. Blank spektrofotometern med 2 pl av molekylär vatten.
    2. Mät absorbansen vid 260 nm (A 260) av DNA-provet. Använd följande ekvation för att beräkna stamkoncentration.
      Obs: provkoncentrationen är M = A 260 / extinktionskoefficient. Extinktionskoefficienten kan hittas på specifikationen databladet av DNA tillverkaren.

6. Beredning av fluorescerande Reportrar

Obs: Detta avsnitt beskriverprotokoll för framställning av Reporter C, kan andra fluorescerande reportrar monteras på samma sätt.

  1. Beställa högpresterande vätskekromatografi (HPLC) renade oligonukleotiderna ROX- <c * tc *> (den övre strängen av Reporter C) och <c> -RQ (bottensträngen av Reporter C) från DNA-tillverkare (se tabell 10 för sekvenser ).
  2. Efter att ha mottagit den syntetiserade oligonukleotider, resuspendera och kvantifiera prover som förklaras i steg 5.
  3. Blanda reportern topp- och bottensträngar (dvs ROX- <c * tc *> och <c> -RQ) i 1x Tris-acetat-EDTA (TAE) med 12,5 mM Mg 2 + (se tabell 11 för detaljerade receptet ). Observera att här 30% överskott släckare märkt sträng <c> -RQ sätts att montera reportern, vilket säkerställer att alla fluoroformärkta strängarna släcktes även med ofullständig stökiometri.
  4. Glödga Reporter C komplexet med användning av en anordning för cyklisk värmebehandling, kylning från 95 ° C till 20 ° C med en hastighet av 1 ° C / minut. Proverna kan förvaras vid 4 ° C.

7. Fluorescensmätningar

Obs: Avsnittet beskriver ett allmänt protokoll för fluorescens kinetik mätningar (se Figur 5 för den experimentella proceduren), och detta protokoll kommer att användas i steg 8, 9, och 10. Observera också att detta protokoll är för användning av en spektrofluorimeter. Alternativt kan dessa experiment också utföras i en plattläsare även känslighet, well-to-brunn variationer och bristande kontroll temperatur i långtidsförsök kan vara ett problem.

  1. Ställ temperaturstyrenheten till 25 ° C, och vänta på att temperaturen stabiliseras. Med hjälp av en temperaturregulator kan minska variabiliteten i signalen som kan orsakas av temperaturvariationer.
  2. Ställ rätt parametrar for kinetik mätningar i datainsamling programvara för spektrofluorimeter. Detaljerade exempel på inställningar är som följer:
    1. Ställ in spaltbredden till 2,73 nm för både excitations- och emissions monokromatorer.
    2. Ställ in integrationstiden till 10 sek för varje 60 sek tidspunkt. Ställ den totala mättiden till 24 timmar.
    3. Ställ in excitation / emissionsvåglängder för att matcha de fluoroforer som används i experimentet. Exempel våglängder är följande: ROX (588 nm / 608 nm), och TAMRA (559 nm / 583 nm).
  3. Lägg Nukleasfritt fritt H2O och 10x Tris-acetat-EDTA-buffert innehållande 125 mM Mg2 + (10x TAE / Mg2 +) till en syntetisk kvartscell. Se tabellerna 12, 13 och 14 till exempel volymer att använda.
  4. Lägg polyT strängar för att uppnå en slutlig koncentration av ~ 1 iM (se tabell 12, 13 och 14 för volymer), och sedan virvel syntetiskakvartsceller för 10-15 sek. I allmänhet kommer pipettspetsar ospecifikt binda DNA. Lägga höga koncentrationer av polyT strängarna kan reducera denna icke-specifika bindningen fel.
  5. Lägg till reportrar och hjälp trådar. Se Tabell 12, 13, och 14 till exempel volymer att använda. Observera att för reporter kalibrering, inga extra trådar behövs.
  6. Lägg 10% natriumdodecylsulfat (SDS) för att uppnå en slutlig koncentration av 0,15% SDS. Obs: SDS används för att dissociera enzymer från plasmiden härrörande grindar eftersom enzymer kan störa strängförskjutningsreaktionen (se figur 6). SDS rekommenderas här i stället för värmedenaturering av enzymer för att undvika dissociation och felaktig rekombination grind strängar, som negativt kan påverka kretsfunktion.
  7. [Hoppa över detta steg för reporter kalibrering.]
    1. Lägg gå och gaffel grindar (se tabell 13 och 14 för volymer)den syntetiska kvartscell och blanda lösningen genom att pipettera upp och ned under minst 20 gånger (inte virvel kyvetten eftersom virvelbildning lösningar med SDS kan leda till bubblor som kommer att påverka fluorescens kinetik mätning).
    2. Dessutom, flytta till följande mätnings steg så snart som möjligt eftersom läckan reaktionen initierar omedelbart efter tillsättningen av gå och gaffel portarna till det syntetiska kvartscell.
  8. Placera de syntetiska kvartscellerna i kammaren av en spektrofluorimeter.
  9. Starta kinetik mätning.
  10. Efter 5 minuter av mätning, tillsätt ingångssträngar (se tabell 12, 13 och 14 för volymer) till den syntetiska kvartscell och blanda reaktionen genom att pipettera upp och ned under minst 20 gånger. Observera att provet ska blandas försiktigt för att undvika bubblor. Utför detta steg medan datainsamlingsprogram pausas för att undvika mätsignaler utlöses av externaljus.
  11. Spela reaktionskinetiken tills den når stationärt tillstånd. Reaktionskinetiken visas på datorn.

8. Kalibrera Fluorescerande Reportrar

Obs: Detta avsnitt beskriver protokoll för att göra kalibreringskurvor av fluorescerande reportrar. Kalibreringskurvor kommer användas för att omvandla godtyckliga fluorescensenheter till molar signal koncentration.

  1. Kalibrera fluorescerande reportrar efter det protokoll som beskrivs i steg 7. Använd volymer reaktanter och buffertar som sammanfattas i tabell 12 standardkoncentration för detta exempel är 50 nM (1x). reportrar är på 3x; ingången är 1x. För de fall där ingången <tc c> är vid 0,25 x, 0,5x, 0,75x, justera volymen på Nukleasfritt fritt H2O motsvarande för att hålla den slutliga volymen av varje reaktion att vara 600 l. Ett exempel data visas i figur 7A.
  2. Gör en kalibreringskurvaReporter C genom en linjär anpassning av de slutliga fluorescensvärdena mot den ursprungliga koncentrationen av signalen C (Ett exempel kalibreringskurva visas i figur 7B). Denna kalibreringskurva kan användas för att omvandla godtyckliga fluorescensenheter till dess motsvarande signal koncentration.

9. Kvantifiera koncentration av plasmid-härledda ndsDNA Gates

Obs: Varje oberoende bearbetad sats av plasmid-härledda ndsDNA grindar resulterar i en annan utbyte av funktionella grindar, och detta avsnitt beskriver ett protokoll för att kvantifiera koncentrationen av plasmid-härledda ndsDNA grindar.

  1. Kvantifiera koncentrationen av plasmid-härledda ndsDNA grindar efter det protokoll som beskrivs i steg 7. Använd de volymer av reagens som sammanfattas i tabell 13 Anm. Tabell 13 beskriver ett exempel recept för Fork BC kvantifiering Gå. AB och andra portar kan utföras på liknande sätt men med användning av olika ingångs strängar, extra strängar och reportrar.
  2. Omvandla den slutliga fluorescensvärdet mätt i detta experiment till en koncentration av signal C med användning av kalibreringskurvan från steg 8,2. Sedan tillbaka-beräkna ndsDNA gate koncentrationen. Till exempel kan en slutlig fluorescensvärde för porten kvantifiering experimentet motsvarar 25 nM signalen C (0,5x) baserat på kalibreringskurvan i figur 7B. Eftersom beståndet av Fork BC späds 40 gånger i denna reaktion, är beståndet koncentrationen av Fork BC grinden 1 iM.

10. Kinetics Mätningar för reaktion A + B-> B + C

Obs! Det här avsnittet beskriver ett protokoll för att testa DNA förverkligandet av en formell kemisk reaktion med hjälp av fluorescens kinetik mätningar.

  1. Performulär kinetik mätning genom att följa protokollet som beskrivs i steg 7. Använd volymer av reagens och buffertar som sammanfattas i tabell 14.

Representative Results

För en funktionstest, var en DNA genomförandet av bimolekylära katalytiska reaktionen (dvs A + B-> B + C) skapas. Prestandan hos plasmid-härledda grindar jämfördes med grindar sammansatta av syntetiska DNA. Katalytiska reaktioner är ett bra test för gate renhet eftersom en felaktig grind kan irreversibelt fälla en katalysator, vilket orsakar en oproportionerlig effekt på mängden produkt som tillverkas 18,19. Samtidigt kommer en liten läcka reaktion som leder till den untriggered frisättning av den katalytiska signalen vara linjärt amplifieras, vilket leder till en oproportionerligt stor felsignal. Experimentella data för plasmid-härledda och syntetiserades grindar visas i fig 8B och 8C, respektive. I experimenten, är koncentrationen av signalsträng Ett fast medan mängden av den katalytiska signalen B varieras. Signalen C används för att läsa ut reaktionens fortskridande utan att avbryta den katalytiskacykel. Katalys kan observeras i data, eftersom reaktionerna närmar slutförande även med mängder katalysator B mycket mindre än mängden A. Eftersom SDS inte sattes experiment gjorda med den syntetiserade systemet, är reaktionshastighet (som kan påverkas genom tillsats av SDS) inte jämföras och den analytiska fokus ligger istället på katalytisk omsättning (detaljerat som följer).

Ytterligare analys av den katalytiska omsättningen för denna reaktion utfördes. Omsättningen är definierad som den mängd signalen C som produceras för varje katalysator B vid en given tidpunkt. Specifikt var omsättningen beräknades från våra experimentella data genom att dela läckan subtraheras signalen C från den ursprungliga mängden katalysator B tillsattes. För en ideal katalytiskt system bör detta omsättningstalet linjärt ökar med tiden och att vara oberoende av mängden katalysator så länge som substratet inte begränsande. I ett verkligt system kan felaktiga grindar inaktivera katt alysts och omsättningen kommer att uppgå till högst värde, även om inte alla tillgängliga substrat omvandlas till produkt. Det maximala värdet omsättning anger hur många substrat (signal A) en katalysator (signalen B) kan konvertera innan han blev inaktive. Här är det konstateras att den syntetiserade systemet avviker från den ideala linjära ökningen av omsättningen mycket tidigare än plasmiden härrörande systemet gör, vilket indikerar beslag av katalysatorn genom en oönskad sido reaktion (Figur 8D). Jämförelse Omsättningen visas endast för låga koncentrationer på grund vid höga koncentrationer av katalysatorer kommer alla portar att utlösas och släpp signalen C. Kretsen läckage jämförs också, och det observeras att förhållandet mellan läcksignal med hjälp av plasmid-härledda grindar är ca 8% mindre än det som använder syntetiserade grindar efter 10 h av reaktion (figur 8E).

iles / ftp_upload / 53.087 / 53087fig1.jpg "/>
Figur 1. (A) CRNs fungera som en normativ programmeringsspråk. DNA reaktions nätverk kan manipuleras för att närma dynamiken i en formell CRN (B) DNA genomförandet av ett exempel kemisk instruktion. A + B-> B + C. DNA-strängarna är ritade som linjer med pilar vid 3-änden och * indikerar komplementaritet. Alla signal strängar A (<ta a>, grön), B (<tb b>, orange) och C (<tc c>, röd) är bestod av en fotfäste domän (märkt TA, tb, och tc) och ett identitets domän (märkt som a, b och c). Den bimolekylära reaktion A + B-> B + C kräver två multi trängade komplexen AB och gaffel f.Kr., och fyra hjälp strängar <tr r>, <b tr>, <c tb> och <i tc>. Reaktionen fortsätter genom sju steg för strängförskjutning, där varje startstegets med toehold bindning. (C) Reporter strategi. Reaktionen följes med användning av en reporter i vilken bottensträngen är märkt med en fluorofor (röd punkt) och den övre strängen är fäst till en utsläckare (svart punkt). På grund av samlokaliseringen av fluoroforen och släckare, är reporter fluorescens släckes i den intakta reporter. Signalen C kan ersätta den övre strängen av reportern, vilket leder till en ökning av fluorescens. (Denna siffra har modifierats Ref 29.) Klicka här för att se en större version av denna siffra.

Figur 2
Figur 2. (A) NdsDNA grindar tillverkade av bakteriell plasmid DNA. Flera kopior av den dubbelsträngade ndsDNA grind mall klonas in i en plasmid. De klonade plasmidema är den transformerades in i E. coli-celler och kolonier på plattan är sekvens verifieras. När väl sekvensen har bekräftats, är plasmid-DNA amplifieras och extraherades. Slutligen är den dubbelsträngade plasmiden som bearbetas till de önskade ndsDNA grindarna genom enzymatisk bearbetning. (B) Enzymatisk behandling av ndsDNA grindar. Restriktionsenzymet PvuII används för att frigöra porten från plasmiden. De frigjorda grindar bearbetas ytterligare med hjälp nicking enzymer: Nb.BsrDI används för att generera hack för AB (panel i); Nt.BstNBI används för att generera hack för gaffel BC (Panel II). Restriktions och nicking områden anges som färgkodade lådor. (C) Sekvens utsikt över porten mall AB (Panel i) och gaffel BC (Panel ii). Den PvuII restriktionsställe (markerad i lila rutan) är i båda ändar av ndsDNA grindar. Den Nb.BsrDI och Nt.BstNBI Nicking platser är markerade i rött och svart lådor, respektive. Platserna skär markeras med pilar. Sekvens N är vilken nukleotid som helst. (Denna siffra har ändrats med tillstånd från Ref 29.) Klicka Vänligen här för att se en större version av denna siffra.

Figur 3
Figur 3. (A) PCR av en DNA-gate mall. En DNA-gate mall innehåller ndsDNA grind sekvenserna i centrum (en blå region), och distanssekvenser på båda ändar (svarta regioner, dessa två ändsekvensema är ortogonala). Primers kan binda till spacersekvenser i porten mall och generera fyra överlappande DNA-fragment genom PCR (överlappande sekvenser är färgkodade i figuren). (B) Gibson montering. De fyra förstärkta DNA-fragmenteringts sedan samman till en lineariserad plasmid ryggrad genom Gibson monteringsmetod 43. (Denna siffra har ändrats med tillstånd från Ref 29.) Klicka Vänligen här för att se en större version av denna siffra.

Figur 4
Figur 4. Krets prestanda med olika enzym belopp. (A) En förenklad representation av gate, reporter, hjälp strängar, och signal strängar som används för motsvarande experiment. (B) Kinetics experiment med plasmid-härledda AB behandlas med olika enzymmängder . jag. 10 enheter PvuII-HF och 45 enheter Nb.BsrDI per 1 mikrogram av plasmid; II. 10 enheter PvuII-HF och 4 enheter Nb.BsrDI per 1 pg av plasmiden; III. 4 enheter PvuII-HF och 4 enheter Nb.BsrDI per 1 mikrogram av plasmid. Alla hjälp strängar var på 2x (1x = 10 nM). Grinden komplexa var 1,5x, och experimenten utfördes vid 35 ° C i 1 x TAE / Mg2 +. (Denna siffra har ändrats med tillstånd från Ref 29.) Klicka Vänligen här för att se en större version av denna siffra.

Figur 5
. Figur 5 Flödesschema av kinetiska experiment Blå. Material för att lägga till kyvett (0,875 ml syntetisk kvarts cell). Referens Tabell 14 för specifika volymer att lägga för kinetisk experiment A + B -> B + C. Grön: Instruktioner för en spektrofluorimeter (märkt som SPEX). Röd: Blandning instruktioner.53087fig5large.jpg "target =" _ blank "> Klicka här för att se en större version av denna siffra.

Figur 6
Figur 6. Enzym dissociation och krets beteende. (A) En förenklad representation av gate, reporter, hjälp strängar, och signal strängar som används för motsvarande experiment. (B) Kinetics experiment av plasmiden härrörande AB använder 80 ° C värme inaktive (gröna spår), 0,15% natriumdodecylsulfat (SDS) (röd) och en kontroll utan värmeinaktivering eller tillsättning av SDS (blå). Den standardkoncentration var 1x = 10 nM, och alla extra strängar och ingång B var på 2x. Grinden komplexa var 1,5x, och experimenten utfördes vid 35 ° C i 1 x Tris-acetat-EDTA-buffert innehållande 12,5 mM Mg2 + (1x TAE / Mg2 + 29.) Klicka här för att se en större version av denna siffra.

Figur 7
Figur 7. Reporter kalibrering. (A) Reporter C kinetik. Reportern Koncentrationen var vid 3x (1x = 50 nM), och den ursprungliga koncentrationen av signalen C indikeras i figuren. (B) Fluorescensnivåer signal C vid mätning ändpunkt (40 min) visar ett linjärt förhållande med initial koncentration av signal C. I en kvantifiering exempel på Fork BC gate (grön streckad linje), fluorescensvärdet för Fork BC var åtgärdd som 3 x 10 6 (au), vilket motsvarar 25 nM (0,5x) baserat på kalibreringskurvan. Klicka här för att se en större version av denna siffra.

Figur 8
Figur 8. Bimolekylär katalytiska reaktionskinetik (A + B-> B + C). (A) En förenklad representation av grinden, reporter, hjälp strängar, och signal strängar som används för motsvarande experiment. Experiment kördes i 1 x Tris-acetat-EDTA-buffert innehållande 12,5 mM Mg2 + (1x TAE / Mg2 +). Samtliga grind komplexen var vid 75 nM koncentration (1,5x), och hjälp strängarna var vid 100 nM koncentration (2x). Kinetik data för plasmid-härledda grindar och data för syntetiserade grindar visas i (B) och (C) (D) Plasmid-härledda grindar uppvisade högre omsättning än syntetiserade DNA grindar när låga mängder inmatning tillsattes. (E) Omfattningen av läckage. Stapeldiagrammet visar förhållandet mellan den slutliga läckage till slutsignalen (C B0 = 0 / C B0 = 1) vid ändpunkterna (10 h). (Denna siffra har modifierats Ref 29.) Klicka här för att se en större version av denna siffra.

Gate mallar Sekvenser Längd (nt)
JoinAB TCTAGTTCGATCAGAGCGTTATTACCAGTAGTCGATTGCTCAGCTGCTACATTGCTTCTACGAGTCATCCTTCCACCATTGCACCTTAGAGTCCGAATCCTACCATTGCTTAACCGAGTCTCACAACCAGCTGTCATTATGGACTTGACACACAGATTACACGGGAAAGTTGC 173
FORKBC TCTAGTTCGATCAGAGCGTTATTACCAGTAGTCGATTGCTCAGCTGCCATCATAAGAGTCACCATACCCACATTGCCACATCGAGTCCCTTTTCCACCATTGCACCTTAGAGTCCGAATCCTACCATTGCTTAACCGAGTCTCACAACCAGCTGTCATTATGGACTTGACACACAGATTACACGGGAAAGTTGC 194

Tabell 1. Sekvenser av ndsDNA gate mallar.

Gate Strand Längd nedre strängen (nt)
JoinAB JoinAB-Bottom <a tb>, <b tr> <r tq> 87
ForkBC ForkBC-Bottom, <i>, <tc c>, <tb b>, <tr r> 108

Tabell 2. Strands omfattande AB och gaffel BC. (Denna tabell har ändrats från Ref 29).

Domän Sekvens Längd (nt)
TA CTGCTA 6
tb TTCCAC 6
tc TACCCA 6
tr TCCTAC 6
tq AACCAG 6
en CATTGCTTCTACGAGTCATCC 21
b CATTGCACCTTAGAGTCCGAA 21
c CATTGCCACATCGAGTCCCTT 21
r CATTGCTTAACCGAGTCTCAC 21
jag CTGCCATCATAAGAGTCACCA 21
jove_content "fo: keep-together.within-page =" always "fo: keep-med-previous.within-page =". alltid "> Tabell 3 nivå sekvenser Domain för att genomföra den kemiska reaktionen A + B -> B + C . (Denna tabell har ändrats från Ref 29).

Primersträngen Sekvenser Längd (nt)
Framåtriktad primer-1 AAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAG CGTTATTACCAGTAGTCGATTGC 60
Omvänd primer-1 ACTACTATTTACTAATCCCATTGCGTGTTCTTATT TAATCTGTGTGTCAAGTCCATAATG 60
Framåtriktad primer-2 AATAAGAACACGCAATGGGATTAGTAAATAGTAGT CGTTATTACCAGTAGTCGATTGC 58
Omvänd primer-2 GCGAAACTAGCTTGTGGTGATATTGTCTCGTGTGT TAATCTGTGTGTCAAGTCCATAATG 60
Framåtriktad primer-3 ACACACGAGACAATATCACCACAAGCTAGTTTCGC CGTTATTACCAGTAGTCGATTGC 58
Omvänd primer-3 ACATTGTACGCCTAAATCATCAAGAATAATTGTTG TAATCTGTGTGTCAAGTCCATAATG 60
Framåtriktad primer-4 CAACAATTATTCTTGATGATTTAGGCGTACAATGT CGTTATTACCAGTAGTCGATTGC 58
Omvänd primer-4 GAGCGCAGCGAGTCAGTGAGCGAGGAAGCCTGCAG TAATCTGTGTGTCAAGTCCATAATG 60

Tabell 4. Primersekvenser för PCR av ndsDNA gate mallar.

Reagens Volymen för 1x reaktion (il)
Hög kopia plasmidryggrad (~ 300 ng / l) 10
PvuII-HF (20.000 enheter / ml) 2
Pstl-HF (20.000 enheter / ml) 2
10x Cut smarta buffert 2
H2O 4
Total volym 20 d>

Tabell 5. Protokoll för plasmidskelettet digere.

Reagens Volymen för 1x reaktion (il)
DNA-vektorn (~ 50 ng / ul) 1
PCR-amplifierat fragment-1 (~ 50 ng / ul) 1
PCR-amplifierat fragment-2 (~ 50 ng / ul) 1
PCR-amplifierat fragment-3 (~ 50 ng / ul) 1
PCR-amplifierat fragment-4 (~ 50 ng / ul) 1
2x Gibson Assembly mästare Mix 5
Total volym 10
s "fo: keep-med-previous.within-page =" always "> Tabell 6 Protokoll för Gibson montering..

Reagens Volymen för 1x reaktion (il)
Plasmid-DNA (~ 1 | ig / | il koncentration) 1000
PvuII-HF (20.000 enheter / ml) 200
10x Cut smarta buffert 133,3
Total volym 1333,3

Tabell 7. Protokoll för ndsDNA grindar insatta plasmid smälta med restriktionsenzym PvuII-HF.

Reagens Volym (^ il)
Gå med grindar (~ 5 mikrogram / l koncentration) 150
Nb.BsrDI (10.000 enheter / ml) 300
10x Cut smarta buffert 50
Total volym 500

Tabell 8. Protokoll för gå grindar smälta med hack enzym Nb.BsrDI.

Reagens Volym (^ il)
Gaffel grindar (~ 5 mikrogram / l koncentration) 150
Nt.BstNBI (10.000 enheter / ml) 600
10x NEB buffert 3,1 83,3
Total volym 833,3

Tabell 9 Protokoll för gaffel portar smälta med hack enzym Nt.BstNBI.

Strand Domän Sekvens Längd (nt)
JoinAB-Botten tq * r * st * b * tb * a * ta * CTGGTT GTGAGACTCGGTTAAGCAATG GTAGGA TTCGGACTCTAAGGTGCAATG GTGGAA GGATGACTCGTAGAAGCAATG TAGCAG 87
FORKBC-Botten tq * r * st * b * tb * c * tc * i * CTGGTT GTGAGACTCGGTTAAGCAATG GTAGGA TTCGGACTCTAAGGTGCAATG GTGGAA AAGGGACTCGATGTGGCAATG TGGGTA TGGTGACTCTTATGATGGCAG 108
<ta a> CTGCTA CATTGCTTCTACGAGTCATCC 27
<tb b> TA en TTCCAC CATTGCACCTTAGAGTCCGAA 27
<tc c> tb b TACCCA CATTGCCACATCGAGTCCCTT 27
<a tb> tc c CATTGCTTCTACGAGTCATCC TTCCAC 27
<b tr> en tb CATTGCACCTTAGAGTCCGAA TCCTAC 27
<r tq> B tr CATTGCTTAACCGAGTCTCAC AACCAG 27
<i> r tq CTGCCATCATAAGAGTCACCA 21
<tr r> jag TCCTAC CATTGCTTAACCGAGTCTCAC 27
<i tc> tr r CTGCCATCATAAGAGTCACCA TACCCA 27
<c tr> Jag tC CATTGCCACATCGAGTCCCTT TCCTAC 27
<c tb> c tr CATTGCCACATCGAGTCCCTT TTCCAC 27
<b tr> c tb CATTGCACCTTAGAGTCCGAA TCCTAC 27
<i tb> B tr CTGCCATCATAAGAGTCACCA TTCCväxelström 27
<b tb> Jag tb CATTGCACCTTAGAGTCCGAA TTCCAC 27
<b tc> b tb CATTGCACCTTAGAGTCCGAA TACCCA 27
<c tr> b tc CATTGCCACATCGAGTCCCTT TCCTAC 27
<b tr> c tr CATTGCACCTTAGAGTCCGAA TCCTAC 27
ROX- <c * tc *> B tr / 56-ROXN / AAGGGACTCGATGTGGCAATG TGGGTA 27
<c> -RQ c * tc * CATTGCCACATCGAGTCCCTT / 3IAbRQSp / 21
<tq * R *> - TAMRA CTGGTT GTGAGACTCGGTTAAGCAATG / 36-TAMTSp / 27
RQ- <r> tq * r * / 5IAbRQ / CATTGCTTAACCGAGTCTCAC 21
r

. Tabell 10 Strand sekvenser för att genomföra den kemiska reaktionen A + B -.> B + C (. Denna tabell har ändrats från Ref 29)

Reagens Volym (^ il) Slutlig koncentration
ROX- <c * tc *> på 100 iM 10 10 ^ M (1x)
<c> -RQ på 100 μ; M 13 13 ^ M (1,3x)
10x TAE med 125 mM Mg 2+ 10 1x TAE med 12,5 mM Mg 2+
H2O 67 -
Total volym 100 10 ^ M (1x)

Tabell 11. Protokoll för montering Reporter C.

Reagens Volym (^ il) Slutlig koncentration
H2O 514 -
10x TAE med 125 mM Mg 2+ 60 1x TAE med 12,5 mM Mg 2+
PolyT på 300 μ; M 2 1 ^ M
Reporter C vid 10 ^ M 9 150 nM (3x)
10% SDS 9 0,15%
<tc c> vid 5 pM 6 50 nM (1x)
Total volym 600 -

Tabell 12. Protokoll för kalibrering av Reporter C. De volymer som tillhandahålls här är för en total reaktionsvolym av 600 | il (motsvarande användning av en 0,875 ml syntetisk kvartscell), men kan justeras för att arbeta med olika storlek celler.

<td> 600
Reagens Volym (^ il) Slutlig concentra
H2O 493 -
10x TAE med 125 mM Mg 2+ 60 1x TAE med 12,5 mM Mg 2+
polyT på 300 pM 2 1 ^ M
Reporter C vid 10 ^ M 9 150 nM (3x)
<i tC> på 100 iM 3 10x
<c tb> på 100 iM 3 10x
<b tr> på 100 iM 3 10x
10% SDS 9 0,15%
Gaffel BC på ~ 1 iM (koncentration ålder) 15 ~ 0,5x
<r tq> på 100 iM 3 10x
Total volym -

Tabell 13. Protokoll för kalibrering av gaffel BC. De volymer som tillhandahålls här är för en total reaktionsvolym av 600 | j, l, men kan justeras för att arbeta med olika storlek celler.

Reagens Volym (^ il) Slutlig koncentration
H2O 407,2 -
10x TAE med 125 mM Mg 2+ 52,8 12,5 mM Mg2 +
polyT på 300 pM 2 1 ^ M
Reporter C vid 10 ^ M 9 150 nM (3x)
<i tC> på 10 | iM 6 100 nM (2x)
<c tb> vid 10 iM 6 100 nM (2x)
<b tr> vid 10 iM 6 100 nM (2x)
<tr r> vid 10 iM 6 100 nM (2x)
10% SDS 9 0,15%
AB på 1 iM 45 75 nM (1,5x)
Gaffel BC på en iM 45 75 nM (1,5x)
<ta a> vid 10 iM 3 50 nM (1x)
<tb b> 10 iM 3 50 nM (1x)
Total volym 600 -

Tabell 14. Protokoll för en kemisk reaktion A + B-> B + C. Volymerna ges här är en total reaktionsvolym på 600 ul, men kan justeras för att arbeta med olika storlek celler.

Syntetiserade grindar Plasmid-härledda grindar
Beskrivning Kosta Gå grindar Gaffel grindar
PAGE renad lång strand (100 nt, fungerade som de nedre delarna av en grind) ~ $ 75 Beskrivning </ strong> Kosta Beskrivning Kosta
PAGE renad kort sträng (~ 30 nt, tjänstgjorde som topp strängar av en grind) ~ $ 185 Gate-mall ~ $ 100 Gate-mall ~ $ 100
Total ~ $ 260 Plasmiden Extraction Kit ~ $ 26 Plasmiden Extraction Kit ~ $ 26
Restriktionsenzym (Pvull-HF) ~ $ 11 Restriktionsenzym (Pvull-HF) ~ $ 11
Nicking enzym (Nt.BsrDI, Gå grindar) ~ $ 29 Nicking enzym (Nt.BstNBI, Gaffel grindar) ~ $ 62
Total ~ $ 166 Total ~ $ 199

fo:.. keep-med-previous.within-page = "always"> Tabell jämförelse 15 Kostnad mellan plasmid-härledda grindar och syntetiserade grindar (. Denna tabell har ändrats från Ref 29)

Syntetiserade grindar Plasmid-härledda grindar
Bearbetning Handläggningstiden Bearbetning Handläggningstiden
Glödgning 1 tim Kloning 5 tim
PAGE-rening 2 tim Plasmiden extraktion 2 tim
Total 3 h Två steg av enzymdigerering 0,5 h
Etanolutfällning
Total 8,5 h

Tidsjämförelsetabell 16. Bearbetning mellan plasmid-härledda grindar och syntetiska grindar. (Denna tabell har ändrats från Ref 29).

Discussion

Detta dokument beskriver en metod för att härleda ndsDNA portar från mycket ren plasmid DNA. Dessutom är ett protokoll som presenteras för att karakterisera gate prestanda när du använder ett fluorescens kinetik analys. Experimentella data visar att plasmiden härledda systemet överträffar dess syntetiska motsvarighet, även om det syntetiska systemet är sammansatt av trådar som renats med användning av polyakrylamidgelelektrofores (PAGE). Troligtvis är den förbättrade prestandan av plasmid-härledda grindar främst på grund av mycket hög renhet av den biologiska DNA. Syntetiskt DNA innehåller en mängd fel, i synnerhet deletioner som resulterar i oligonukleotider med längd n-1, och sådana sidoprodukter är typiskt inte fullständigt avlägsnas i PAGE eller högpresterande vätskekromatografi (HPLC) reningsförfaranden. Liknande förbättringar de redovisas här observerades också i en tidigare studie av en katalyserade hårnål förstärkare som används DNA härlett från biologiska källor 21.

fig 4). För det andra, i dessa experiment, de flesta inmatningar och hjälp strängarna var syntetiska DNA och sålunda innehöll deletioner och mutationer. I princip kan alla enkelsträngad ingång och hjälp strängarna också erhållas från fagemid-DNA genom en hackenzymdigerering av den förkodade m13 virala genomet 26. Kanske den kretsprestanda kan förbättras ytterligare med hjälp av ssDNA härledd från det bakteriella genomet.

Medan användningen av plasmid-härledda grindar befanns förbättra kretsprestanda, en analysav kostnads- och handläggningstiderna visade att medan produktionen av plasmid-härledda grindar är något billigare (tabell 15), tar det 2-3 gånger längre handläggningstiden jämfört med montering och rening av grindar från kommersiellt syntetiserade oligonukleotider (tabell 16). De primära kostnaderna för plasmid-härledda grindar är gensyntes och användningen av restriktionsenzymer. För 300 pmol portar (tillräckligt för 15 reaktioner vid 30 nM), den beräknade kostnaden för Gå portar är ca $ 170 och $ 200 för Fork portar, kostnadsskillnaden är på grund av användningen av olika nicking enzymer. I motsats, den kemiska syntesen av strängarna för samma gate kostar ca $ 260, inklusive en sida reningsavgift. Den primära engångskostnad för plasmid-härledda portar i kloningsförfarandet, som, precis som DNA-syntes, kan läggas ut på entreprenad till en gen syntes företag. Men när hopfogade, plasmid-härledda grindar har fördelen att värd plasmiderna enkelt kan replikeras ennd kan lagras i form av bakteriella glycerol lager. Detta gör det möjligt att återanvända grindarna många gånger om.

Ser fram emot, kan den förbättrade prestandan hos plasmid-härledda grindar möjliggöra en mycket större utbud av dynamik beteenden än har experimentellt visat hittills med DNA CRNs. Till exempel föreslog nyligen teoretiskt arbete 47,48 som självorganiserade rumsliga mönster på makronivå kan realiseras med DNA CRNs genom en reaktion diffusionsmekanism. Den metod som presenteras här ger en livskraftig väg för att konstruera de underliggande molekylära komponenter för sådana själv mönstring DNA material. Även utmanande, skulle utveckla makro skala morfologier i ett programmerbart sätt har betydande konsekvenser inom områden som sträcker sig från biomaterial forskning till regenerativ medicin.

Acknowledgements

Figurerna 1, 2, 3, 4, 6, 8 och tabellerna 2, 3, 10, 15, 16 är modifierade från Ref 29. Detta arbete stöddes av National Science Foundation (NSF bevilja-CCF 1117143 och NSF-CCF 1.162.141 till GS). Y.-JC stöddes av taiwanesiska regeringsstipendier. SDR stöddes av National Science Foundation Graduate Research Fellowship Program (GRFP).

Materials

Name Company Catalog Number Comments
Phusion High-Fidelity PCR Master Mix with HF Buffer NEB M0531S
PvuII-HF NEB R3151L
PstI-HF NEB R3140S
Gibson Assembly Master Mix NEB E2611S
Terrific Broth, Modified SIGMA-ALDRICH T0918-250G
QIAprep Spin Miniprep Kit (250) QIAGEN 27106
QIAGEN Hispeed Maxi-prep Kit QIAGEN 12662
Nb.BsrDI NEB R0648L
Nt.BstNBI NEB R0607L
NanoDrop 2000c Thermo Scientific
Double-stranded Genomic Blocks IDT
Horiba Jobin-Yvon Spex Fluorolog-3 Fluorimeter Horiba/Jobin Yvon
Synthetic Quartz Cells  Starna 23-5.45-S0G-5
QIAGEN Gel Extraction Kit QIAGEN 28706
Plasmid Backbones BioBrick E0240-pSB1A2 High copy number plasmid with Ampicillin resistance. Sequence can be found from http://parts.igem.org

DOWNLOAD MATERIALS LIST

References

  1. Zhang, D. Y., Seelig, G. Dynamic DNA nanotechnology using strand-displacement reactions. Nat. Chem. 3, 103-113 (2011).
  2. Krishnan, Y., Simmel, F. C. Nucleic acid based molecular devices. Angew. Chem. Int. Ed. Engl. 50, 3124-3156 (2011).
  3. Zhang, D. Y., Winfree, E. Control of DNA strand displacement kinetics using toehold exchange. J. Am. Chem. Soc. 131, 17303-17314 (2009).
  4. Qian, L., Winfree, E., Bruck, J. Neural network computation with DNA strand displacement cascades. Nature. 475, 368-372 (2011).
  5. Qian, L., Winfree, E. Scaling up digital circuit computation with DNA strand displacement cascades. Science. 332, 1196-1201 (2011).
  6. Zadegan, R. M., Jepsen, M. D., Hildebrandt, L. L., Birkedal, V., Kjems, J. Construction of a fuzzy and boolean logic gates based on DNA. Small. 11, 1811-1817 (2015).
  7. Seelig, G., Soloveichik, D., Zhang, D. Y., Winfree, E. Enzyme-free nucleic acid logic circuits. Science. 314, 1585-1588 (2006).
  8. Zadegan, R. M., et al. Construction of a 4 zeptoliters switchable 3D DNA box origami. ACS Nano. 6, 10050-10053 (2012).
  9. Andersen, E. S., et al. Self-assembly of a nanoscale DNA box with a controllable lid. Nature. 459, 73-76 (2009).
  10. Zhang, D. Y., Hariadi, R. F., Choi, H. M., Winfree, E. Integrating DNA strand-displacement circuitry with DNA tile self-assembly. Nat. Commun. 4, (1965).
  11. Yurke, B., Turberfield, A. J., Mills, A. P., Simmel, F. C., Neumann, J. L. A DNA-fuelled molecular machine made of DNA. Nature. 406, 605-608 (2000).
  12. Green, S. J., Lubrich, D., Turberfield, A. J. DNA hairpins: fuel for autonomous DNA devices. Biophys. J. 91, 2966-2975 (2006).
  13. Venkataraman, S., Dirks, R. M., Rothemund, P. W., Winfree, E., Pierce, N. A. An autonomous polymerization motor powered by DNA hybridization. Nat. Nanotechnol. 2, 490-494 (2007).
  14. Green, S. J., Bath, J., Turberfield, A. J. Coordinated chemomechanical cycles: a mechanism for autonomous molecular motion. Phys. Rev. Lett. 101, 238101 (2008).
  15. Omabegho, T., Sha, R., Seeman, N. C. A bipedal DNA Brownian motor with coordinated legs. Science. 324, 67-71 (2009).
  16. Turberfield, A. J., et al. DNA fuel for free-running nanomachines. Phys. Rev. Lett. 90, 118102 (2003).
  17. Dirks, R. M., Pierce, N. A. Triggered amplification by hybridization chain reaction. Proc. Natl. Acad. Sci. U. S. A. 101, 15275-15278 (2004).
  18. Seelig, G., Yurke, B., Winfree, E. Catalyzed relaxation of a metastable DNA fuel. J. Am. Chem. Soc. 128, 12211-12220 (2006).
  19. Zhang, D. Y., Turberfield, A. J., Yurke, B., Winfree, E. Engineering entropy-driven reactions and networks catalyzed by DNA. Science. 318, 1121-1125 (2007).
  20. Yin, P., Choi, H. M., Calvert, C. R., Pierce, N. A. Programming biomolecular self-assembly pathways. Nature. 451, 318-322 (2008).
  21. Chen, X., Briggs, N., McLain, J. R., Ellington, A. D. Stacking nonenzymatic circuits for high signal gain. Proc. Natl. Acad. Sci. U. S. A. 110, 5386-5391 (2013).
  22. Phillips, A., Cardelli, L. A programming language for composable DNA circuits. J. R. Soc. Interface. 6, Suppl 4. S419-S436 (2009).
  23. Lakin, M. R., Youssef, S., Polo, F., Emmott, S., Phillips, A. Visual DSD: a design and analysis tool for DNA strand displacement systems. Bioinformatics. 27, 3211-3213 (2011).
  24. Lakin, M. R., Youssef, S., Cardelli, L., Phillips, A. Abstractions for DNA circuit design. J. R. Soc. Interface. 9, 470-486 (2012).
  25. Zhang, D. Y., Winfree, E. Robustness and modularity properties of a non-covalent DNA catalytic reaction. Nucleic Acids Res. 38, 4182-4197 (2010).
  26. Ducani, C., Kaul, C., Moche, M., Shih, W. M., Hogberg, B. Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides. Nat. Methods. 10, 647-652 (2013).
  27. Lin, C., et al. In vivo cloning of artificial DNA nanostructures. Proc. Natl. Acad. Sci. U. S. A. 105, 17626-17631 (2008).
  28. Bhatia, D., et al. Icosahedral DNA nanocapsules by modular assembly. Angew. Chem. Int. Ed. Engl. 48, 4134-4137 (2009).
  29. Chen, Y. J., et al. Programmable chemical controllers made from DNA. Nat. Nanotechnol. 8, 755-762 (2013).
  30. Arkin, A., Ross, J. Computational functions in biochemical reaction networks. Biophys. J. 67, 560-578 (1994).
  31. Érdi, P., Tóth, J. Mathematical models of chemical reactions: theory and applications of deterministic and stochastic models. Manchester University Press. (1989).
  32. Magnasco, M. O. Chemical kinetics is Turing universal. Phys. Rev. Lett. 78, 1190 (1997).
  33. Oishi, K., Klavins, E. Biomolecular implementation of linear I/O systems. IET Syst. Biol. 5, 252-260 (2011).
  34. Senum, P., Riedel, M. Rate-independent constructs for chemical computation. PLoS One. 6, (2011).
  35. Soloveichik, D., Cook, M., Winfree, E., Bruck, J. Computation with finite stochastic chemical reaction networks. Natural Computing. 7, 615-633 (2008).
  36. Soloveichik, D., Seelig, G., Winfree, E. DNA as a universal substrate for chemical kinetics. Proc. Natl. Acad. Sci. U. S. A. 107, 5393-5398 (2010).
  37. Tyson, J. J., Chen, K. C., Novak, B. Sniffers, buzzers, toggles and blinkers: dynamics of regulatory and signaling pathways in the cell. Curr. Opin. Cell. Biol. 15, 221-231 (2003).
  38. Cardelli, L. Two-domain DNA strand displacement. Math. Struct. Comput. Sci. 23, 247-271 (2013).
  39. Angluin, D., Aspnes, J., Eisenstat, D. A simple population protocol for fast robust approximate majority. Distrib. Comput. 21, 87-102 (2008).
  40. Cardelli, L., Csikasz-Nagy, A. The cell cycle switch computes approximate majority. Sci. Rep. 2, 656 (2012).
  41. Zadeh, J. N., et al. NUPACK: Analysis and design of nucleic acid systems. J. Comput. Chem. 32, 170-173 (2011).
  42. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. J. Vis. Exp. (2012).
  43. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods. 6, 343-345 (2009).
  44. Froger, A., Hall, J. E. Transformation of plasmid DNA into E. coli using the heat shock method. J. Vis. Exp. e253 (2007).
  45. Lessard, J. C. Transformation of E. coli via electroporation. Methods Enzymol. 529, 321-327 (2013).
  46. Nasri, M., Thomas, D. Alteration of the specificity of PvuII restriction endonuclease. Nucleic Acids Res. 15, 7677-7687 (1987).
  47. Dalchau, N., Seelig, G., Phillips, A. Computational design of reaction-diffusion patterns using DNA-based chemical reaction networks. DNA Computing and Molecular Programming. 84-99 (2014).
  48. Scalise, D., Schulman, R. Designing modular reaction-diffusion programs for complex pattern formation. Technology. 2, 55-66 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics