Plasmide afkomstig DNA Strand Displacement Gates Uitvoeringsbesluit Chemical Reaction Networks

Biology
 

Cite this Article

Copy Citation | Download Citations

Chen, Y. J., Rao, S. D., Seelig, G. Plasmid-derived DNA Strand Displacement Gates for Implementing Chemical Reaction Networks. J. Vis. Exp. (105), e53087, doi:10.3791/53087 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

De voorspelbaarheid van Watson-Crick baseparing is toegestaan ​​dynamische DNA nanotechnologie te voorschijn als een programmeerbare manier om moleculaire apparaten te ontwerpen met dynamische eigenschappen 1,2. Met name DNA strengverplaatsing - een programmeerbare, competitieve hybridisatie reacties - heeft bewezen een krachtig mechanisme voor engineering van DNA dynamische systemen. In een DNA-streng verdringingsreactie, een inkomende oligonucleotide verdringt een eerder gebonden "output" streng van een complementaire bindingspartner. Meerdere dergelijke reacties kunnen aan elkaar worden gekoppeld in meerdere stappen reactiecascades met een hoge mate van controle over de volgorde en timing van afzonderlijke reactiestappen 3. DNA strengvervanging cascades zijn gebruikt voor digitale en analoge moleculaire schakelingen 4-7, omschakelbaar nanostructuren 8-10, autonome moleculaire motoren 11-15 en non-covalente katalytische versterkers 13,16-21 maken. Bovendien DNA apparaten met strengverplaatsing reacties kunnen worden gesimuleerd en ontworpen voor uiteenlopende toepassingen met behulp van computer-assisted design software 22-24.

Momenteel, chemisch gesynthetiseerd DNA fungeert als het belangrijkste materiaal voor DNA nanotechnologie. Echter, fouten in het DNA syntheseproces en de resulterende onvolmaakte oligonucleotiden, wordt aangenomen dat de prestaties van dynamische DNA inrichtingen te beperken door het veroorzaken foutieve nevenreacties. Bijvoorbeeld, "lek" reacties kunnen resulteren in het vrijkomen van een uitgang oligonucleotide zelfs in afwezigheid van een reactie trekker. Dergelijke effecten zijn het duidelijkst in autokatalytische reactiecascades waar zelfs een minimale hoeveelheid aanvankelijke lekkage uiteindelijk leidt tot volledige activatie van de cascade 19,20. Omgekeerd reacties vaak niet het verwachte niveau van activering bereikt omdat sommige componenten niet leiden, zelfs in aanwezigheid van de beoogde invoer 7,25. Om de prestaties te maken DNA-gebaseerdenanodevices vergelijkbaar hun biologische eiwit gebaseerde tegenhangers, moet een dergelijke fout modi drastisch verminderd.

Bacteriële plasmiden of andere biologische DNA zou kunnen dienen als een relatief goedkope bron van zeer zuiver DNA voor nanotechnologie toepassingen. Grote hoeveelheden DNA kan worden gegenereerd door replicatie in bacteriën en de intrinsieke capaciteiten proeflezen van levende systemen garanderen de zuiverheid van het verkregen DNA. In feite hebben een aantal recente papers het potentieel nut van biologische DNA voor nanotechnologie toepassingen 21,26-28. Echter, de volledig dubbelstrengs karakter plasmide DNA dusver verboden het gebruik als materiaal voor het maken dynamische DNA inrichtingen, die typisch bestaan ​​uit meerdere oligonucleotiden en bevatten zowel dubbelstrengs en enkelstrengs domeinen. In een recent artikel 29 dit probleem werd aangepakt en een nieuwe DNA-poort architectuur die bestaat voornamelijk uit nicked dubbelstrengs DNA (ndsDNA) was introducerend.

Belangrijker is, kunnen systemen ndsDNA poorten zijn ontworpen dat de door enige formele chemische reactie netwerk (CRN) 29 dynamiek te realiseren. ndsDNA poorten kan dus worden gebruikt, in beginsel dynamische systemen oscillaties en chaos, bistabiliteit en geheugen, Booleaanse logica of algoritmische 30-38 gedrag vertonen creëren. Bijvoorbeeld, Ref. 29 vertoonde een drie-reactie CRN een moleculaire implementatie van een "consensus" protocol, een soort gedistribueerde computer algoritme 29,39,40 voorzien. Dit werk eerste toonde een nieuwe toepassing voor de CRN formalisme als een "programmeertaal" voor het snel synthetiseren van functionele moleculaire systemen (Figuur 1A).

Hier wordt een gedetailleerd protocol voor het afleiden ndsDNA gates uit plasmide-DNA voorzien. Eerste is een herziening van de reeks ontwerpproces. Daarna volgt een uitleg over hoe de synthetische oligonucleotiden diede poort sequenties worden gekloneerd in plasmiden en de sequentie geverifieerd en geamplificeerd via bacteriekweek. Vervolgens wordt getoond hoe ndsDNA poorten kunnen worden afgeleid van de plasmiden door enzymatische behandeling (zie figuur 2). Tenslotte wordt een werkwijze voor het testen gate gedrag via fluorescentie kinetiek assays beschreven.

Reactiemechanisme
Als voorbeeld, het protocol staat de katalytische chemische reactie A + B-> B + C. De soort A, B en C ("signaal", figuur 1B) Alle corresponderen met een ander enkelstrengs DNA-molecuul. De sequenties van deze moleculen zijn volledig onafhankelijk en de strengen niet met elkaar reageren direct. De sequenties van alle signalen twee verschillende functionele domeinen, namelijk subsequenties die samenwerken in strengverplaatsing reacties: 1) een korte toehold domein (labels ta, tb, tc) die wordt gebruikt voor de initiatie van strengverplaatsing reaction, en 2) een lange domein (labels a, b, c) de identiteit signaal bepaalt.

Interacties tussen signaal strengen worden gemedieerd door ingekerfd dubbelstrengs DNA (ndsDNA) poort complexen (genoemd lid van AB en vork BC) en hulpstoffen enkelstrengs species (<tr r>, <b tr>, <c tb> en <i tc >). De formele reactie A + B-> B + C wordt uitgevoerd door een reeks van strengverplaatsing reactiestappen, waarbij elke reactiestap bloot een steunpunt voor een volgende reactie (Figuur 1B). In dit voorbeeld zijn de signalen A en B aanvankelijk vrij in oplossing terwijl signaal C is gebonden aan de vork gate. Na afloop van de reactie B en C in oplossing. Meer in het algemeen signalen die zijn gebonden aan een poort zijn inactief terwijl signalen die vrij zijn in oplossing actief, dat wil zeggen, ze kunnen deelnemen aan een strengverplaatsing reactie alseen ingang. Het tijdsverloop van de reactie wordt gevolgd met gebruik van een fluorescerende reporter strategie (figuur 1C). In eerder werk 29, werd aangetoond dat dit reactiemechanisme realiseert niet alleen de juiste stoïchiometrie ook de kinetiek van de beoogde reactie.

Protocol

1. Sequence ontwerp

Opmerking: Sequence ontwerp overzicht: In deze paragraaf wordt de strategie voor het ontwerpen van plasmide afkomstig DNA poorten beschreven. Enzymplaatsen geplaatst aan beide zijden van de poorten om de vrijlating volledig dubbelstrengig poorten na digestie. Nicking sites worden vervolgens zodanig geplaatst dat enzymen creëren nicks op de bovenste streng naar de finale ndsDNA poorten te creëren. Tenslotte worden de resterende sequenties zodanig gekozen dat onafhankelijke domeinen orthogonaal aan elkaar en vertonen geen secondaire structuur.

  1. Plaats de Nt.BstNBI nicking plaats vier nucleotiden van het 3 'uiteinde van elke lange domein (a, b, c, r, en i). Plaats de Nb.BsrDI nicking plaats op elk uiteinde van de lange domein 5 (a, b, c, en r. Merk op dat het domein i niet elk Nb.BsrDI inkeping site). Figuur 2C toont de gedetailleerde weergave van sequentie Join AB en Vork BC poorten.
  2. Plaats de PvuII-restrictieplaats aan beide uiteinden van ndsDNA poorten zodat PvuII digestie kan loslaten gates van plasmiden (zie figuur 2C).
  3. Ontwerp ongedwongen andere sequenties door twee volgende principes: (a) onderdelen mag vertonen secundaire structuren (DNA structuren kunnen worden voorspeld met behulp Nupack 41), en (b) alle domeinen moeten loodrecht overspraak te minimaliseren.
  4. Plaats ndsDNA sequenties in het midden van een poort template. Plaats 30-40 bp willekeurige spacersequenties aan beide uiteinden van de matrijs poort elke afstandhouder als uniek bindingsplaats voor de volgende Polymerase Chain Reaction (PCR).

2. Klonen van NdsDNA Gates in plasmiden

Opmerking: Dit deel beschrijft de Gibson klonen methode voor het invoegen van 4 exemplaren van de poort in een plasmide backbone.

  1. Om ndsDNA poort templates als dubbelstrengs genomische blokken van een DNA-fabrikant (gate template sequenties worden getoondin tabel 1; strengen komen in ndsDNA poorten zijn getoond in tabel 2; level domein sequenties worden getoond in Tabel 3).
  2. Na ontvangst van de bestelde DNA, draaien de buizen die genoom blocks 10,000-14,000 xg gedurende 1 minuut om te verzekeren dat alle gedroogde DNA op de bodem van de buis.
  3. Resuspendeer de gedroogde genomische regel in DNase-vrij water tot een uiteindelijke concentratie van 10 ng / pl te bereiken.
    Opmerking: Als alternatief kan DNA worden geresuspendeerd door middel 1x Tris ethyleendiaminetetraazijnzuur (EDTA) buffer (TE-buffer: 10 mM Tris en 1 mM EDTA, pH 8,0). Echter, EDTA is een chelerend middel voor divalente kationen en PCR kan remmen.
  4. Genereren 4 poort fragmenten met verschillende overlap regio's door middel van een standaard PCR met een High-Fidelity DNA polymerase (zie figuur 3A). De primersequenties zijn vermeld in Tabel 4 (smelttemperatuur van deze primers is 62 ° C).
  5. Voer een 2% agarosegel in 140 V gedurende 30 minuten bij kamertemperatuur (voor een gedetailleerde agarosegelelektroforese protocol zie 42) en snijd de band van elke PCR geamplificeerde fragment uit de gel. Zuiveren dan de gel plakken met behulp van een gelextractiekit (zie de Materials) volgens de instructies van de fabrikant.
  6. Digest een hoog kopie-aantal plasmide backbone (zie materialen) met PvuII en PstI-HF-HF bij 37 ° C gedurende 1 uur (zie tabel 5) volgens het protocol van de fabrikant. PvuII-HF en Pstl-HF zijn high-fidelity restrictie enzymen, die drastisch verminderen niet-specifieke bezuinigingen.
  7. Voer een 1,5% agarosegel en snijd de gelineariseerde backbone (meestal draaien de gel bij 140 V gedurende 30-40 min bij RT). Extract dan het DNA uit de gel slice behulp gelextractiekit de instructies van de fabrikant.
  8. Voer Gibson samenstel 43 met de gelineariseerde vector en gezuiverde PCR-fragmenten (zie tabel 6 en figuur 3B
  9. Transformeer de Gibson samenstel product van stap 2.8 in Escherichia coli (E. coli) en plaat op een lysogenie Broth (LB) agar platen bevattende ampicilline antibiotica (bij een concentratie van 100 ug / ml). Voeren transformatie door middel van elektroporatie of heat shock methode 44,45, en gebruik de juiste E. coli stam. Gebruik bijvoorbeeld E. coli-stam JM109 voor heat shock transformatie, en gebruik DH5a elektrocompetente E. coli-cellen voor elektroporatie.
    Opmerking: De plasmideskelet gebruikt bevat een ampicilline resistentie cassette. Bij gebruik van een andere selectie marker, gebruik de juiste antibiotica in plaats van ampicilline.

3. Bacteriële Cultuur Amplification en Quality Control

Opmerking: Dit deel beschrijft de massaproductie en isolatie van plasmiden die de DNA-poorten na kwaliteitscontrole.

  1. Kies een enkele kolonievan Ampicillin selectieve plaat uit stap 2,9 en incuberen van een kweek van 3 ml verrijkt medium dat ampicilline antibiotica (bij een concentratie van 100 ug / ml). Markeer de kolonie zodat het opnieuw kan worden gebruikt in daaropvolgende experimentele stappen. Groeien de cultuur bij 37 ° CO / N met krachtig schudden (200-300 rpm). Typisch, incubeer 16-24 uur.
  2. Extraheer het plasmide DNA uit de bacteriecultuur behulp van een mini-prep kit volgens de instructies van de fabrikant.
  3. Meet het gezuiverde plasmide-DNA onder toepassing van een spectrofotometer volgens de instructies van de fabrikant. Typische opbrengst varieert van 50-1000 ng / ul.
  4. Verkrijg de geëxtraheerde plasmide-DNA gesequentieerd door verzending van het monster met een DNA sequencing bedrijf. Sequencing primers moet zich ongeveer 100 nucleotiden stroomopwaarts en stroomafwaarts van het gebied waarvan de sequentie; de sequencing primer voor het plasmide (zie materialen plasmide) heeft de volgende sequentie: ATTACCGCCTTTGAGTGAGC.
    Neete: Als er reeks fouten of recombinatie in de geplaatste ndsDNA poorten, selecteer een andere kolonie van de plaat uit stap 2.9. Volg de stappen 3,1-3,4 om te controleren of de sequenties van de geplaatste poorten correct zijn.
  5. Na verificatie van de sequenties correct zijn, kies de corresponderende kolonie van Ampicilline selectieve plaat (uit stap 2.9) en incubeer een cultuur van 800 ml Terrific Broth (TB) dat ampicilline antibiotica (bij een concentratie van 100 ug / ml). Groeien de kweek bij 37 ° C gedurende 16-24 uur onder krachtig schudden (200-300 rpm). TB bijzonder is zeer geschikt voor high yield plasmide productie.
    Opmerking: Als alternatief LB kan ook worden gebruikt om bacteriën te kweken, hoewel de opbrengst plasmide een probleem kan zijn.
  6. Zuiver het DNA met een Maxi-prep kit volgens de instructies van de fabrikant.
  7. Volg stap 3,3-3,4 om te controleren of de sequenties correct zijn. Als een recombinatie plaatsgevonden, zie de volgende noot. Anders is, ga naar stap 4. <br /> Opmerking: Een mogelijk probleem hier is dat meerdere exemplaren van de ingebrachte poorten in de plasmide kunnen recombineren als gevolg van DNA-herstel. Om dit probleem aan te pakken, maken gebruik van een E. coli stam zonder het recA-eiwit (een eiwit gerelateerd aan DNA herstel) zoals JM109 of DH5a een eerder sequentie geverifieerd plasmide transformatie (dwz zonder sequentiefouten en recombinatie). Kies dan een kolonie van deze plaat en controleer het plasmide sequentie door het sturen van het monster aan een DNA-sequencing bedrijf.

4. Enzymatische Processing

Opmerking: Dit hoofdstuk beschrijft het proces van het verteren van de plasmiden zodanig dat zij worden gesneden en gejat in de juiste locaties en klaar om te worden gebruikt voor de kinetiek experimenten.

  1. Digest het gezuiverde plasmide-DNA uit stap 3.7 met restrictie-enzym PvuII-HF gedurende 1 uur bij 37 ° C (zie tabel 7). Typisch verteren het plasmide met 4 eenheden PvuII-HF per 1 mg plasmide. Hoge FIDelity restrictie-enzymen worden aanbevolen voor gebruik, omdat ze drastisch verminderen van niet-specifieke bezuinigingen.
  2. Voer ethanolprecipitatie op het monster.
    1. Voeg 2 gelijke volumes ijskoude absolute ethanol aan het monster.
    2. Incubeer het mengsel bij -80 ° C gedurende ten minste 1 uur (dit mengsel kan ook plaatsnemen bij -80 ° C O / N).
    3. Centrifugeer bij 10,000-14,000 xg bij 0 ° C gedurende 30 min.
    4. Verwijder het supernatant.
    5. Naar 1000 pl RT 95% ethanol aan het monster en zwenken 10-15 maal.
    6. Centrifugeer bij 10,000-14,000 xg bij 4 ° C gedurende 10 min.
    7. Verwijder het supernatant en de lucht drogen op de bank voor 10-20 min.
    8. Resuspendeer de DNA pellets in een geschikt volume van Nuclease vrije H 2 O (gewoonlijk 100-200 pl). Het toevoegen van meer dan 200 gl algemeen maakt het monster te verdund voor gebruik in kinetiek experimenten.
  3. Meet de geresuspendeerde DNA onder toepassing van een spectrofotometer volgens de minstructies producent behoudt's.
  4. Digest mee poorten met knikken Nb.BsrDI enzym bij 65 ° C gedurende 1 uur onder toepassing van 4 eenheden enzym per 1 ug plasmide (zie tabel 8); digest vork poorten met knikken Nt.BstNBI enzym bij 55 ° C gedurende 1 uur met behulp 8 eenheden enzym per 1 ug plasmide (zie Tabel 9).
    Opmerking: Stap 4,2 verwijdert enzymdigestie buffer en helpt concentraat poorten voor kinetiek experimenten. Stap 4.2 kan worden overgeslagen voor de poorten te sluiten, omdat beide restrictie-enzym PvuII-HF en jatten enzym Nb.BsrDI dezelfde spijsvertering buffer delen. In stap 4.2.8, wordt Nuclease vrij H2O gebruikt in plaats van TE omdat EDTA is een chelerend middel voor tweewaardige kationen en kan restrictie-enzymen die deze ionen moeten functioneren remmen.
    Opmerking: De toevoeging van overmaat enzymen kunnen leiden tot grote hoeveelheden initiële circuit lekken (Figuur 4), die waarschijnlijk wordt veroorzaakt door over-digestie 46. Deze kwestie can door het optimaliseren van het enzym worden gericht bedragen (zie figuur 4). Typische bereik van enzymen is 1-10 eenheden / 1 ug plasmide.

5. Voorbereiding van de Single-oligonucleotiden

Opmerking: Dit deel beschrijft het protocol voor resuspenderen en kwantificeren van de chemisch gesynthetiseerde enkelstrengs DNA (ssDNA), die zal worden gebruikt voor het signaal strengen en extra strengen. Voor streng sequenties zie Tabel 10. Merk op dat het volgende protocol is een voorbeeld van bereiding 10 uM ssDNA. Andere concentraties ssDNA kan op soortgelijke wijze worden bereid.

  1. Na ontvangst van oligo DNA fabrikant, draaien de buizen met DNA bij 10,000-14,000 xg gedurende 1 minuut om te verzekeren dat alle gedroogde DNA op de bodem van de buis.
  2. Resuspendeer de DNA behulp 1x Tris ethyleendiaminetetraazijnzuur (EDTA) buffer (TE-buffer: 10 mM Tris en 1 mM EDTA, pH 8,0) tot een uiteindelijke concentratie van 100 uM. VoorBijvoorbeeld, resuspendeer 8 nmol DNA in 80 ui TE-buffer.
  3. Meng 10 gl van het DNA bij 100 uM met 90 gl moleculaire water in een microcentrifugebuis, waarbij een eindconcentratie van 10 uM moet worden gehaald.
  4. Meet de precieze concentratie van het DNA monster met behulp van een spectrofotometer de instructies van de fabrikant. Het volgende protocol toont een voorbeeld van hoe DNA-concentratie kan worden gemeten.
    1. Blanco de spectrofotometer met 2 pl moleculaire water.
    2. Meet de absorptie bij 260 nm (A260) van het DNA-monster. Gebruik de volgende vergelijking om de voorraad concentratie te berekenen.
      Opmerking: Het monster concentratie is M = A 260 / extinctiecoëfficiënt. De extinctiecoëfficiënt is te vinden op de specificatie datasheet door het DNA fabrikant.

6. Voorbereiding van de TL-Reporters

Opmerking: Dit deel beschrijft deprotocol voor het bereiden van Reporter C, kunnen andere fluorescerende reporters op dezelfde manier worden gemonteerd.

  1. Bestellen high-performance vloeistofchromatografie (HPLC) gezuiverd oligonucleotiden ROX- <c * tc *> (de bovenste streng van Reporter C) en <c> -RQ (de onderste streng van Reporter C) uit DNA fabrikant (zie Tabel 10 voor sequenties ).
  2. Na ontvangst van de gesynthetiseerde oligonucleotiden, resuspendeer en kwantificeren monsters zoals beschreven in stap 5.
  3. Meng de verslaggever boven- en onderkant strengen (dwz ROX- <c * tc *> en <c> -RQ) in 1x Tris-acetaat-EDTA (TAE) met 12,5 mM Mg 2+ (zie Tabel 11 voor de gedetailleerde recept ). Merk op dat hier 30% overmaat deactiveringsmiddel gemerkte streng <c> -RQ wordt toegevoegd aan de reporter, die ervoor zorgt dat alle fluorofoor gemerkte strengen worden gedoofd, zelfs met imperfecte stoichiometrie monteren.
  4. Gloeien de Reporter C complex met een thermische cycler, koelen van 95 ° C tot 20 ° C met een snelheid van 1 ° C / min. De monsters kunnen worden opgeslagen bij 4 ° C.

7. Fluorescentie metingen

Opmerking: Het gedeelte wordt een algemeen protocol voor fluorescentie kinetiek metingen (zie figuur 5 voor de experimentele procedure), en dit protocol worden gebruikt in de stappen 8, 9 en 10. Merk ook op dat het protocol voor het gebruik van een spectrofluorimeter. Als alternatief, deze experimenten kan ook worden in een plaat reader uitgevoerd hoewel gevoeligheid, well-to-well variaties en het gebrek aan controle van de temperatuur op de lange termijn experimenten een probleem kan zijn.

  1. Stel de temperatuurregelaar tot 25 ° C, en wacht tot de temperatuur te stabiliseren. Met behulp van een temperatuurregelaar kan verminderen variabiliteit in het signaal die kunnen voortvloeien uit temperatuurvariatie.
  2. Stel de juiste parameters for kinetica metingen in het data acquisitie software van de spectrofluorimeter. Gedetailleerd voorbeeld zijn als volgt:
    1. Stel de spleetbreedte tot 2,73 nm voor zowel excitatie en emissie monochromatoren.
    2. Stel de integratie tijd tot 10 seconden voor elke 60 seconden time-point. Stel de totale meettijd tot 24 uur.
    3. Stel de excitatie / emissie golflengten de fluoroforen gebruikt in het experiment passen. Voorbeeld golflengten zijn: ROX (588 nm / 608 nm) en TAMRA (559 nm / 583 nm).
  3. Voeg Nuclease vrij H2O en 10x Tris-acetaat-EDTA-buffer bevattende 125 mM Mg2 + (10 x TAE / Mg2 +) om een synthetische kwarts cel. Zie de tabellen 12, 13 en 14 bijvoorbeeld volumes te gebruiken.
  4. Voeg polyT strengen tot een uiteindelijke concentratie van ~ 1 uM (zie tabel 12, 13 en 14 voor volumes) bereikt, en vervolgens de vortex synthetischekwarts cellen gedurende 10-15 sec. In het algemeen zal pipetpunten aspecifiek DNA binden. Het toevoegen van hoge concentraties polyT strengen kan deze niet-specifieke binding fouten te verminderen.
  5. Verslaggevers en hulpstoffen strengen voegen. Zie Tabel 12, 13 en 14 bijvoorbeeld volumes te gebruiken. Merk op dat voor reporter kalibratie geen extra draden nodig.
  6. Voeg 10% natriumdodecylsulfaat (SDS) tot een eindconcentratie van 0,15% SDS realiseren. Opmerking: SDS wordt gebruikt om enzymen uit het plasmide afgeleide poorten dissociëren omdat enzymen kunnen interfereren met de strengverplaatsing reactie (zie figuur 6). SDS Hier wordt aanbevolen in plaats van de warmte denaturatie van enzymen om de dissociatie en onjuiste recombinatie van poort strengen, hetgeen nadelig kan zijn het circuit functie te voorkomen.
  7. [Sla deze stap voor reporter kalibratie.]
    1. Voeg mee en vork poorten (zie tabel 13 en 14 voor volumes)de synthetische kwarts cel en meng de oplossing door pipetteren op en neer ten minste 20 keer (niet vortex de cuvette omdat vortexen oplossingen SDS kan leiden tot bellen die invloed fluorescentie kinetiek metingen).
    2. Ook naar de volgende meetstappen zo spoedig mogelijk door het lek reactie initieert onmiddellijk na de toevoeging van sluiten en vork poorten van het synthetische kwarts cel.
  8. Plaats de synthetische kwarts cellen in de kamer van een spectrofluorimeter.
  9. Start de kinetiek meting.
  10. Na 5 min metingen, voeg ingang strengen (zie tabel 12, 13 en 14 voor volumes) om de synthetische kwarts cel en meng de reactie door pipetteren op en neer ten minste 20 maal. Merk op dat het monster voorzichtig moeten worden gemengd om luchtbellen te vermijden. Voer deze stap, terwijl de data-acquisitie programma wordt onderbroken om te voorkomen dat het meten van signalen getriggerd door externelicht.
  11. Noteer de reactiekinetiek totdat steady state bereikt. De reactie kinetiek worden weergegeven op de computer.

8. Calibrate Fluorescent Reporters

Opmerking: Dit deel beschrijft het protocol voor het maken van kalibratiecurves van fluorescerende verslaggevers. Kalibratiecurven worden gebruikt om willekeurige fluorescentie-eenheden om te zetten signaal molaire concentratie.

  1. Kalibreren fluorescerende verslaggevers na de in Stap 7. Gebruik de volumes van de reagentia en buffers beschreven protocol zoals samengevat in Tabel 12 De standaard concentratie voor dit voorbeeld is 50 Nm (1x).; verslaggevers zijn dan 3x; input 1x. Voor gevallen waarin de inbreng <tc c> zijn dan 0,25x, 0,5x, 0,75x, past het volume van de Nuclease gratis H 2 O navenant aan de uiteindelijke volume van elke reactie te houden tot 600 pi. Een voorbeeld data worden getoond in figuur 7A.
  2. Maak een ijkkromme van deReporter C met een lineaire regressie van de uiteindelijke fluorescentiewaarden tegen de beginconcentratie van signaal C (een voorbeeld kalibratiekromme is weergegeven in figuur 7B). Deze kalibratiecurve kan worden gebruikt om willekeurige fluorescentie-eenheden om te zetten naar zijn overeenkomstig signaal concentratie.

9. kwantificeren van de concentratie van plasmide-afgeleide ndsDNA Gates

Let op: elk onafhankelijk verwerkte partij van plasmide afgeleid ndsDNA poorten resultaten in een andere opbrengst van functionele poorten, en dit deel beschrijft een protocol voor het kwantificeren van de concentratie van plasmide afgeleid ndsDNA poorten.

  1. Kwantificeren van de concentratie van plasmide afgeleid ndsDNA poorten naar aanleiding van de in Stap 7. Gebruik de volumes van de reagentia beschreven als samengevat in tabel 13 protocol Opmerking:. Tabel 13 beschrijft een voorbeeld recept voor Fork BC kwantificering Deelnemen. AB en andere poorten kunnen op soortgelijke wijze worden uitgevoerd, maar via verschillende input strengen ondersteunende strengen en reporters.
  2. Zet de uiteindelijke fluorescentie gemeten in dit experiment tot een concentratie van signaal C behulp van de ijkgrafiek van stap 8,2. Dan terug berekenen van de ndsDNA poort concentratie. Bijvoorbeeld, een uiteindelijke fluorescentie waarde voor de gate kwantificering experiment correspondeert met 25 nM signaal C (0.5x) op basis van de kalibratiecurve figuur 7B. Omdat de voorraad van Fork BC 40 maal in deze reactie verdund voorraad concentratie van de vork BC poort 1 uM.

10. Kinetics Metingen voor de reactie A + B-> B + C

Opmerking: Dit hoofdstuk beschrijft een protocol voor het testen van de DNA realisatie van een formele chemische reactie met behulp van fluorescentie kinetiek metingen.

  1. Pervorm kinetische metingen door de in stap 7. Gebruik volumina van reagentia en buffers beschreven protocol zoals samengevat in Tabel 14.

Representative Results

Voor een functionele test, een DNA-uitvoering van de bimoleculaire katalytische reactie (dwz, A + B-> B + C) is gemaakt. De prestaties van plasmide afgeleide poorten vergeleken met gates samengesteld uit synthetische DNA. Katalytische reacties zijn een goede test voor de poort zuiverheid omdat een defecte poort kan irreversibel vangen een katalysator, waardoor een onevenredig effect op de hoeveelheid geproduceerd product 18,19. Tegelijkertijd wordt een klein lek reactie resulteert in de untriggered afgifte van het katalytische signaal lineair versterkt, wat leidt tot een onevenredige foutsignaal. Experimentele gegevens voor plasmide afgeleid, gesynthetiseerd poorten zijn getoond in figuur 8B en 8C respectievelijk. In de experimenten wordt het gehalte van signaal onderdeel A vast terwijl de hoeveelheid van het katalytische signaal B wordt gevarieerd. Signaal C wordt gebruikt voor het uitlezen van de voortgang van de reactie zonder onderbreking van de katalytischecyclus. Katalyse kan worden waargenomen in de data sinds reacties naderen voltooiing zelfs hoeveelheden katalysator B veel kleiner dan de hoeveelheid A. Omdat SDS niet toegevoegd aan experimenten gedaan met het systeem gesynthetiseerd wordt reactiesnelheid (die kunnen worden beïnvloed door de toevoeging van SDS) niet vergeleken en de analytische nadruk in plaats daarvan op katalytische omzet (als hieronder beschreven).

Verdere analyse van de katalytische omzet van deze reactie werd uitgevoerd. De omzet is gedefinieerd als de hoeveelheid signaal C geproduceerd voor elke katalysator B op een bepaald moment. Specifiek, werd de omzet berekend op basis van onze experimentele gegevens die door het lek afgetrokken signaal C te delen door het aanvankelijke bedrag van katalysator B toegevoegd. Voor een ideale katalytisch systeem, moet deze omzet getal lineair toenemen met de tijd en onafhankelijk van de hoeveelheid katalysator zolang het substraat niet beperkend. In een echt systeem, kan defecte poorten kat uitschakelen alysts, en de omzet zal een maximale waarde, zelfs indien niet alle beschikbare substraat wordt omgezet naar het product te bereiken. De maximale omzet waarde geeft aan hoeveel substraten (signaal A) een katalysator (signaal B) kan omzetten voordat hij geïnactiveerd. Hier wordt opgemerkt dat de gesynthetiseerde systeem afwijkt van het ideale lineaire toename van de omzet veel eerder dan het plasmide afgeleide systeem doet, aangeeft vastlegging van de katalysator door een ongewenste nevenreactie (Figuur 8D). De omzet vergelijking is alleen zichtbaar voor lage concentraties, omdat bij hoge concentraties van katalysatoren, zullen alle poorten worden geactiveerd en laat het signaal C. Het circuit lekkage wordt ook vergeleken en wordt opgemerkt dat de verhouding leksignaal gebruik plasmide afgeleide gates ongeveer 8% lager dan die gebruikt gesynthetiseerde poorten na 10 h reactie (figuur 8E).

iles / ftp_upload / 53.087 / 53087fig1.jpg "/>
Figuur 1. (A) CRNs dienen als een normatief programmeertaal. DNA reactienetwerken kan worden gemanipuleerd om de dynamiek van een formele CRN benaderen (B) DNA uitvoering van een voorbeeld chemische instructie. A + B-> B + C. DNA-strengen worden getekend als lijnen met pijlen aan het 3 'uiteinde en * geeft complementariteit. Alle signaal strengen A (<ta a>, groen), B (<tb b>, oranje) en C (<tc c>, red) worden bestond uit een steunpunt domein (gelabeld als ta, tb en tc) en een identiteit domein (aangeduid als a, b en c). De bimoleculaire reactie A + B-> B + C vereist twee multi-stranded complexen Doe AB en Vork voor Christus, en vier extra strengen <tr r>, <b tr>, <c tb> en <i tc>. De reactie verloopt door zeven stappen strengverplaatsing, waarbij elke stap starts met steunpunt bindend. (C) Reporter strategie. De reactie wordt gevolgd met behulp van een verslaggever die de onderste streng wordt gelabeld met een fluorofoor (rode stip) en de bovenste streng is een quencher (zwarte stip) bevestigd. Door de co-lokalisatie van de fluorofoor en de quencher, wordt de fluorescentie gedoofd reporter in het intacte reporter. Het signaal C kan de bovenste streng van de reporter te vervangen, wat leidt tot een toename van fluorescentie. (Dit cijfer is aangepast van 29 Ref.) Klik hier om een grotere versie van deze figuur te bekijken.

Figuur 2
Figuur 2. (A) NdsDNA gates uit bacterieel plasmide DNA. Meerdere exemplaren van de dubbelstrengs ndsDNA poort template worden gekloond in een plasmide. De gekloneerde plasmiden zijnn getransformeerd in E. coli-cellen en kolonies op de plaat zijn sequentie geverifieerd. Nadat de sequentie is bevestigd, wordt plasmide-DNA geamplificeerd en gewonnen. Tenslotte wordt het dubbelstrengs plasmide verwerkt tot de gewenste ndsDNA poorten door middel van enzymatische behandeling. (B) Enzymatische behandeling van ndsDNA poorten. De PvuII restrictie-enzym wordt gebruikt om het hek te openen uit het plasmide. De vrijgekomen poorten zijn verder verwerkt met behulp van enzymen nicking: Nb.BsrDI wordt gebruikt om namen te genereren voor Word lid van AB (Panel i); Nt.BstNBI wordt gebruikt om nicks voor Fork BC (Panel ii) te genereren. Beperking en nicking sites worden aangeduid als kleurgecodeerde dozen. (C) Sequence uitzicht op de poort template van Join AB (Panel i) en Vork BC (Panel ii). Het PvuII restrictieplaats (gemarkeerd paarse doos) is aan beide uiteinden van de ndsDNA poorten. De Nb.BsrDI en NT.BstNBI Nicking sites zijn gemarkeerd in rood en zwarte dozen, respectievelijk. De locaties van de snede zijn gemarkeerd met pijlpunten. Sequence N elk nucleotide. (Dit cijfer is gewijzigd met toestemming van Ref. 29) Klik hier om een grotere versie van deze figuur te bekijken.

Figuur 3
Figuur 3. (A) PCR van een DNA matrijs poort. Een DNA-poort template bevat de ndsDNA poort sequenties in het centrum (een blauwe regio) en spacer sequenties aan beide uiteinden (zwarte regio's; deze twee eindsequenties orthogonaal). Primers kunnen binden aan de spacersequenties van de template poort, en het genereren van vier overlappende DNA-fragmenten door middel van PCR (overlappende sequenties kleurcode in de figuur). (B) Gibson samenstel. De vier versterkte DNA Fragments worden vervolgens samengevoegd tot gelineariseerde plasmide ruggengraat door middel Gibson montagemethode 43. (Dit cijfer is gewijzigd met toestemming van Ref. 29) Klik hier om een grotere versie van deze figuur te bekijken.

Figuur 4
Figuur 4. Circuit prestaties met verschillende hoeveelheden enzym. (A) een vereenvoudigde voorstelling van de poort reporter, hulp- draden en strengen signaal voor het corresponderende experimenten. (B) Kinetiek experimenten met plasmide afgeleide Word AB verwerkt met verschillende hoeveelheden enzym . ik. 10 eenheden PvuII-HF en 45 eenheden van Nb.BsrDI per 1 ug plasmide; ik ik. 10 eenheden PvuII-HF en 4 eenheden van Nb.BsrDI per 1 ug plasmide; iii. 4 eenheden PvuII-HF en 4 eenheden van Nb.BsrDI per 1 ug plasmide. Alle extra strengen waren 2x (1x = 10 nM). De poort complex was 1,5x, en de experimenten werden uitgevoerd bij 35 ° C in 1 x TAE / Mg2 +. (Dit cijfer is gewijzigd met toestemming van Ref. 29) Klik hier om een grotere versie van deze figuur te bekijken.

Figuur 5
. Figuur 5 Flow grafiek van de kinetiek experimenten Blue. Materialen te voegen aan cuvette (0,875 ml synthetische kwarts cel). Referentietabel 14 specifieke volumes te voegen voor kinetische experiment A + B -> B + C. Groen: Aanwijzingen van een spectrofluorimeter (aangeduid als SPEX). Rood: Het mengen van instructies.53087fig5large.jpg "target =" _ blank "> Klik hier om een ​​grotere versie van deze figuur te bekijken.

Figuur 6
Figuur 6. Enzym dissociatie en circuit gedrag. (A) Een vereenvoudigde weergave van de poort reporter, hulp- draden en strengen signaal voor het corresponderende experimenten. (B) Kinetiek van de experimenten plasmide afgeleide uzelf AB gebruik 80 ° C verwarmen inactivatie (groene sporen), 0,15% natriumdodecylsulfaat (SDS) (rood), en een controle zonder warmte-inactivatie of toevoeging van SDS (blauw). De standaard concentratie 1x = 10 nM, en alle ondersteunende strengen en ingang B waren 2x. De poort complex was 1,5x, en de experimenten werden uitgevoerd bij 35 ° C in 1 x Tris-acetaat-EDTA-buffer bevattende 12,5 mM Mg2 + (1 x TAE / Mg2 29 Ref.) Klik hier om een grotere versie van deze figuur te bekijken.

Figuur 7
Figuur 7. Reporter kalibratie. (A) Reporter C kinetiek. De reporter concentratie aan 3x (1x = 50 nM), en de initiële concentratie van het signaal C wordt aangegeven in de figuur. (B) De fluorescentie niveaus van signaal C aan de meting eindpunt (40 min) toont een lineair verband met de beginconcentratie signaal C. In een kwantificering voorbeeld van Fork BC poort (groene stippellijn), de fluorescentie waarde van Fork BC was maatregeld als 3 x 10 6 (au), wat overeenkomt met 25 nm (0.5x) op basis van de kalibratiecurve. Klik hier om een grotere versie van deze figuur te bekijken.

Figuur 8
Figuur 8. Bimoleculaire katalytische reactie kinetiek (A + B-> B + C). (A) Een vereenvoudigde weergave van de poort reporter, hulp- draden en strengen signaal voor het corresponderende experimenten. Experimenten werden uitgevoerd in 1 x Tris-acetaat-EDTA-buffer bevattende 12,5 mM Mg2 + (1 x TAE / Mg2 +). Alle gate complexen waren 75 nM concentratie (1,5 x) en ondersteunende strengen waren 100 nM concentratie (2x). Kinetics gegevens plasmide afgeleide poorten en gegevens gesynthetiseerde poorten zijn getoond in (B) en (C) (D) Plasmide-afgeleide poorten hadden hogere omzet dan gesynthetiseerd DNA poorten wanneer lage hoeveelheden input toegevoegd. (E) Omvang lekkage. Het diagram geeft de verhouding van de uiteindelijke lekkage naar het eindsignaal (C B0 = 0 / C B0 = 1) aan de eindpunten (10 uur). (Dit cijfer is aangepast van 29 Ref.) Klik hier om een grotere versie van deze figuur te bekijken.

Poort Templates Opeenvolgingen Lengte (nt)
JoinAB TCTAGTTCGATCAGAGCGTTATTACCAGTAGTCGATTGCTCAGCTGCTACATTGCTTCTACGAGTCATCCTTCCACCATTGCACCTTAGAGTCCGAATCCTACCATTGCTTAACCGAGTCTCACAACCAGCTGTCATTATGGACTTGACACACAGATTACACGGGAAAGTTGC 173
FORKBC TCTAGTTCGATCAGAGCGTTATTACCAGTAGTCGATTGCTCAGCTGCCATCATAAGAGTCACCATACCCACATTGCCACATCGAGTCCCTTTTCCACCATTGCACCTTAGAGTCCGAATCCTACCATTGCTTAACCGAGTCTCACAACCAGCTGTCATTATGGACTTGACACACAGATTACACGGGAAAGTTGC 194

Tabel 1. Sequences van ndsDNA poort templates.

Poort Streng Lengte van de onderste streng (nt)
JoinAB JoinAB-Bottom, <a tb>, <b tr>, <r tq> 87
ForkBC ForkBC-Bottom, <i>, <tc c>, <tb b>, <tr r> 108

Tabel 2. Strands bestaande Doe AB en Vork voor Christus. (Deze tabel is gewijzigd van Ref. 29)

Domein Sequentie Lengte (nt)
ta CTGCTA 6
tb TTCCAC 6
tc TACCCA 6
tr TCCTAC 6
tq AACCAG 6
een CATTGCTTCTACGAGTCATCC 21
b CATTGCACCTTAGAGTCCGAA 21
c CATTGCCACATCGAGTCCCTT 21
r CATTGCTTAACCGAGTCTCAC 21
ik CTGCCATCATAAGAGTCACCA 21
jove_content "fo: keep-together.within-page =" always "fo: keep-met-previous.within-page =." always "> Tabel 3 Domein niveau sequenties voor de uitvoering van de chemische reactie A + B -> B + C . (Deze tabel is gewijzigd van Ref. 29)

Primer streng Opeenvolgingen Lengte (nt)
Forward primer-1 AAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAG CGTTATTACCAGTAGTCGATTGC 60
Reverse primer-1 ACTACTATTTACTAATCCCATTGCGTGTTCTTATT TAATCTGTGTGTCAAGTCCATAATG 60
Forward primer-2 AATAAGAACACGCAATGGGATTAGTAAATAGTAGT CGTTATTACCAGTAGTCGATTGC 58
Reverse primer-2 GCGAAACTAGCTTGTGGTGATATTGTCTCGTGTGT TAATCTGTGTGTCAAGTCCATAATG 60
Forward primer-3 ACACACGAGACAATATCACCACAAGCTAGTTTCGC CGTTATTACCAGTAGTCGATTGC 58
Reverse primer-3 ACATTGTACGCCTAAATCATCAAGAATAATTGTTG TAATCTGTGTGTCAAGTCCATAATG 60
Forward primer-4 CAACAATTATTCTTGATGATTTAGGCGTACAATGT CGTTATTACCAGTAGTCGATTGC 58
Reverse primer-4 GAGCGCAGCGAGTCAGTGAGCGAGGAAGCCTGCAG TAATCTGTGTGTCAAGTCCATAATG 60

Tabel 4. Primer sequenties voor de PCR van ndsDNA gate templates.

Reagens Volume voor 1x reactie (pl)
High-copy plasmide backbone (~ 300 ng / ul) 10
PvuII-HF (20.000 eenheden / ml) 2
PstI-HF (20.000 eenheden / ml) 2
10x Cut slimme buffer 2
H 2 O 4
Totaal volume 20 d>

Tabel 5. Protocol voor plasmide ruggengraat digest.

Reagens Volume voor 1x reactie (pl)
DNA vector (~ 50 ng / ul) 1
PCR geamplificeerde fragment-1 (~ 50 ng / ul) 1
PCR geamplificeerde fragment-2 (~ 50 ng / ul) 1
PCR geamplificeerde fragment-3 (~ 50 ng / ul) 1
PCR geamplificeerde fragment-4 (~ 50 ng / ul) 1
2x Gibson Vergadering meester Mix 5
Totaal volume 10
s "fo: keep-met-previous.within-page =" always "> Tabel 6 Protocol voor Gibson montage..

Reagens Volume voor 1x reactie (pl)
Plasmide DNA (~ 1 ug / ul concentratie) 1000
PvuII-HF (20.000 eenheden / ml) 200
10x Cut slimme buffer 133,3
Totaal volume 1333,3

Tabel 7. Protocol voor ndsDNA hekken geplaatst plasmide verteren met restrictie-enzym PvuII-HF.

Reagens Volume (pl)
Join poorten (~ 5 ug / ul concentratie) 150
Nb.BsrDI (10.000 eenheden / ml) 300
10x Cut slimme buffer 50
Totaal volume 500

Tabel 8. Protocol mee poorten verteren met jatten enzym Nb.BsrDI.

Reagens Volume (pl)
Vork poorten (~ 5 ug / ul concentratie) 150
Nt.BstNBI (10.000 eenheden / ml) 600
10x NEB buffer 3.1 83.3
Totaal volume 833,3

Tabel 9 Protocol voor de vork poorten verteren met jatten enzym Nt.BstNBI.

Streng Domein Sequentie Lengte (nt)
JoinAB-Bottom tq * r * tr * b * tb * a * ta * CTGGTT GTGAGACTCGGTTAAGCAATG GTAGGA TTCGGACTCTAAGGTGCAATG GTGGAA GGATGACTCGTAGAAGCAATG TAGCAG 87
FORKBC-Bottom tq * r * tr * b * tb * c * tc * i * CTGGTT GTGAGACTCGGTTAAGCAATG GTAGGA TTCGGACTCTAAGGTGCAATG GTGGAA AAGGGACTCGATGTGGCAATG TGGGTA TGGTGACTCTTATGATGGCAG 108
<ta a> CTGCTA CATTGCTTCTACGAGTCATCC 27
<tb b> ta een TTCCAC CATTGCACCTTAGAGTCCGAA 27
<tc c> tb b TACCCA CATTGCCACATCGAGTCCCTT 27
<a tb> tc c CATTGCTTCTACGAGTCATCC TTCCAC 27
<b tr> een tb CATTGCACCTTAGAGTCCGAA TCCTAC 27
<r tq> b tr CATTGCTTAACCGAGTCTCAC AACCAG 27
<i> r tq CTGCCATCATAAGAGTCACCA 21
<tr r> ik TCCTAC CATTGCTTAACCGAGTCTCAC 27
<i tc> tr r CTGCCATCATAAGAGTCACCA TACCCA 27
<c tr> i tc CATTGCCACATCGAGTCCCTT TCCTAC 27
<c tb> c tr CATTGCCACATCGAGTCCCTT TTCCAC 27
<b tr> c tb CATTGCACCTTAGAGTCCGAA TCCTAC 27
<i tb> b tr CTGCCATCATAAGAGTCACCA TTCCAC 27
<b tb> i tb CATTGCACCTTAGAGTCCGAA TTCCAC 27
<b tc> b tb CATTGCACCTTAGAGTCCGAA TACCCA 27
<c tr> b tc CATTGCCACATCGAGTCCCTT TCCTAC 27
<b tr> c tr CATTGCACCTTAGAGTCCGAA TCCTAC 27
ROX- <c * tc *> b tr / 56-ROXN / AAGGGACTCGATGTGGCAATG TGGGTA 27
<c> -RQ c * tc * CATTGCCACATCGAGTCCCTT / 3IAbRQSp / 21
<tq * r *> - TAMRA CTGGTT GTGAGACTCGGTTAAGCAATG / 36-TAMTSp / 27
RQ- <r> tq * r * / 5IAbRQ / CATTGCTTAACCGAGTCTCAC 21
r

. Tabel 10 Strand sequenties voor de uitvoering van de chemische reactie A + B -.> B + C (. Deze tabel is gewijzigd van Ref 29)

Reagens Volume (pl) Eindconcentratie
ROX- <c * tc *> 100 uM 10 10 uM (1x)
<c> -RQ bij 100 μ; M 13 13 uM (1.3x)
10x TAE met 125 mm Mg 2+ 10 1x TAE met 12,5 mM Mg 2+
H 2 O 67 -
Totaal volume 100 10 uM (1x)

Tabel 11. Protocol voor het assembleren Reporter C.

Reagens Volume (pl) Eindconcentratie
H 2 O 514 -
10x TAE met 125 mm Mg 2+ 60 1x TAE met 12,5 mM Mg 2+
PolyT bij 300 μ; M 2 1 uM
Reporter C bij 10 uM 9 150 nM (3x)
10% SDS 9 0,15%
<tc c> 5 uM 6 50 Nm (1x)
Totaal volume 600 -

Tabel 12. Protocol voor het kalibreren van Reporter C. De volumes die hier voor een totaal reactievolume van 600 pi (overeenkomend met het gebruik van een 0,875 ml synthetisch kwarts cel), maar kan worden aangepast om te werken met verschillende grootte cellen.

<td> 600
Reagens Volume (pl) Final concentratie
H 2 O 493 -
10x TAE met 125 mm Mg 2+ 60 1x TAE met 12,5 mM Mg 2+
polyT bij 300 uM 2 1 uM
Reporter C bij 10 uM 9 150 nM (3x)
<i tc> bij 100 uM 3 10x
<c tb> bij 100 uM 3 10x
<b tr> 100 uM 3 10x
10% SDS 9 0,15%
Vork BC bij ~ 1 uM (concentratie onbekend) 15 ~ 0,5x
<r tq> bij 100 uM 3 10x
Totaal volume -

Tabel 13. Protocol voor het kalibreren van Fork BC. De volumes die hier voor een totaal reactievolume van 600 pi, maar kan worden aangepast om te werken met verschillende grootte cellen.

Reagens Volume (pl) Eindconcentratie
H 2 O 407,2 -
10x TAE met 125 mm Mg 2+ 52.8 12,5 mM Mg2
polyT bij 300 uM 2 1 uM
Reporter C bij 10 uM 9 150 nM (3x)
<i tc> bij 10 uM 6 100 nM (2x)
<c tb> bij 10 uM 6 100 nM (2x)
<b tr> 10 uM 6 100 nM (2x)
<tr r> bij 10 uM 6 100 nM (2x)
10% SDS 9 0,15%
Join AB 1 uM 45 75 nm (1,5x)
Vork BC 1 uM 45 75 nm (1,5x)
<ta a> bij 10 uM 3 50 Nm (1x)
<tb b> 10 uM 3 50 Nm (1x)
Totaal volume 600 -

Tabel 14. Protocol voor een chemische reactie A + B-> B + C. De volumes die hier voor een totaal reactievolume van 600 pi, maar kan worden aangepast om te werken met verschillende grootte cellen.

Gesynthetiseerd poorten Plasmide afgeleid poorten
Beschrijving Kosten Join poorten Vork poorten
PAGE gezuiverde lange streng (100 nt, diende als de bodem strengen van een poort) ~ $ 75 Beschrijving </ strong> Kosten Beschrijving Kosten
PAGE gezuiverde korte streng (~ 30 nt, diende als top strengen van een poort) ~ $ 185 Poort template ~ $ 100 Poort template ~ $ 100
Totaal ~ $ 260 Plasmide extractiekit ~ $ 26 Plasmide extractiekit ~ $ 26
Restrictie-enzym (PvuII-HF) ~ $ 11 Restrictie-enzym (PvuII-HF) ~ $ 11
Inkeping enzym (Nt.BsrDI, Join poorten) ~ $ 29 Inkeping enzym (Nt.BstNBI, Fork poorten) ~ $ 62
Totaal ~ $ 166 Totaal ~ $ 199

fo:.. keep-met-previous.within-page = "always"> Tabel 15 Kosten vergelijking tussen plasmide afgeleid poorten en gesynthetiseerd poorten (. Deze tabel is gewijzigd van Ref 29)

Gesynthetiseerd poorten Plasmide afgeleid poorten
Verwerking Verwerkingstijd Verwerking Verwerkingstijd
Gloeien 1 hr Klonen 5 uur
PAGE zuivering 2 hr Plasmide-extractie 2 hr
Totaal 3 hr Twee stappen enzymdigestie 0,5 hr
Ethanolprecipitatie
Totaal 8,5 hr

Tabel 16. Verwerking tijd vergelijking tussen plasmide afgeleid poorten en synthetische poorten. (Deze tabel is gewijzigd van Ref. 29)

Discussion

Dit document beschrijft een werkwijze voor het afleiden ndsDNA gates van zeer zuiver plasmide-DNA. Bovendien wordt een protocol voorgesteld voor het karakteriseren gate prestaties met fluorescentie kinetiek-assay. Experimentele gegevens tonen aan dat het plasmide afgeleide systeem overtreft de synthetische tegenhanger zelfs indien het synthetische systeem is samengesteld uit strengen gezuiverd via polyacrylamidegelelektroforese (PAGE). Waarschijnlijk de verbeterde prestaties van plasmide afgeleide poorten voornamelijk vanwege de hoge zuiverheid van het biologische DNA. Synthetisch DNA bevat een aantal fouten, met name deleties die resulteren in oligonucleotiden met lengte n-1, en ​​dergelijke bijproducten worden meestal niet volledig verwijderd PAGE of High-Performance Liquid Chromatography (HPLC) zuiveringsprocedures. Ook werden soortgelijke verbeteringen aan de hier gerapporteerde waargenomen in een eerdere studie van een gekatalyseerd haarspeld versterker dat DNA afkomstig van biologische bronnen 21 gebruikt.

(zie figuur 4). Ten tweede, in deze experimenten, aantal ingangen en ondersteunende strengen werden synthetisch DNA en bevatte aldus deleties en mutaties. In principe kunnen alle enkelstrengs ingang en ondersteunende strengen worden via faagmide DNA door een inkerving enzymdigestie van de vooraf gecodeerde m13 virale genoom 26. Misschien het circuit uitvoering kan verder worden verbeterd middels ssDNA afkomstig van het bacteriële genoom.

Hoewel het gebruik van plasmide afgeleide poorten bleek circuit te verbeteren, een analysede kosten en doorlooptijden gebleken dat terwijl de productie van plasmide afgeleide poorten is iets goedkoper (tabel 15), het duurt 2-3 keer langere verwerkingstijd in vergelijking met de montage en zuivering van poorten van commercieel gesynthetiseerde oligo (Tabel 16). De primaire kosten van plasmide afgeleide poorten gen synthese en het gebruik van restrictie-enzymen. Voor 300 pmol gates (genoeg voor 15 reacties bij 30 nM), de geschatte kosten van uzelf poorten ongeveer 170 $ en 200 $ voor vork poorten, het kostenverschil alvorens het gebruik van verschillende enzymen inkeping. In tegenstelling, de chemische synthese van de strengen voor dezelfde poort kost ongeveer $ 260 inclusief PAGE zuivering vergoeding. De primaire tijd kosten voor plasmide afgeleide poorten in het klonen procedure, die, net als DNA-synthese, kunnen worden uitbesteed aan een gensynthese bedrijf. Echter, eenmaal samengesteld, plasmide afgeleide gates hebben het voordeel dat de host plasmiden gemakkelijk kan worden gerepliceerd eennd kunnen worden opgeslagen in de vorm van bacteriële glycerol voorraden. Dit maakt het mogelijk de poorten, opnieuw vaak.

Vooruitblikkend, zou de verbeterde prestaties van plasmide afgeleid poorten een veel groter scala aan dynamiek gedrag dan zijn experimenteel dusver met DNA CRNs aangetoond schakelen. Bijvoorbeeld recente theoretische werk 47,48 gesuggereerd dat zelf-georganiseerde ruimtelijke patronen op macro-schaal kan worden gerealiseerd met DNA CRNs via een reactie diffusie mechanisme. De hier gepresenteerde methode verschaft een levensvatbaar pad voor het construeren van de onderliggende moleculaire componenten van dergelijke zelfstandige patroneren DNA materialen. Hoewel uitdagend, het ontwikkelen van macro-schaal morfologie in een programmeerbare manier zou aanzienlijke gevolgen in gebieden, variërend van biomaterialen onderzoek naar de regeneratieve geneeskunde.

Acknowledgements

Figuren 1, 2, 3, 4, 6, 8 en de tabellen 2, 3, 10, 15, 16 worden gewijzigd van 29 Ref. Dit werk werd ondersteund door de National Science Foundation (NSF verlenen-CCF 1.117.143 en NSF-CCF 1.162.141 GS). Y.-JC werd ondersteund door de Taiwanese regering beurzen. SDR werd gesteund door de National Science Foundation Graduate Research Fellowship Program (GRFP).

Materials

Name Company Catalog Number Comments
Phusion High-Fidelity PCR Master Mix with HF Buffer NEB M0531S
PvuII-HF NEB R3151L
PstI-HF NEB R3140S
Gibson Assembly Master Mix NEB E2611S
Terrific Broth, Modified SIGMA-ALDRICH T0918-250G
QIAprep Spin Miniprep Kit (250) QIAGEN 27106
QIAGEN Hispeed Maxi-prep Kit QIAGEN 12662
Nb.BsrDI NEB R0648L
Nt.BstNBI NEB R0607L
NanoDrop 2000c Thermo Scientific
Double-stranded Genomic Blocks IDT
Horiba Jobin-Yvon Spex Fluorolog-3 Fluorimeter Horiba/Jobin Yvon
Synthetic Quartz Cells  Starna 23-5.45-S0G-5
QIAGEN Gel Extraction Kit QIAGEN 28706
Plasmid Backbones BioBrick E0240-pSB1A2 High copy number plasmid with Ampicillin resistance. Sequence can be found from http://parts.igem.org

DOWNLOAD MATERIALS LIST

References

  1. Zhang, D. Y., Seelig, G. Dynamic DNA nanotechnology using strand-displacement reactions. Nat. Chem. 3, 103-113 (2011).
  2. Krishnan, Y., Simmel, F. C. Nucleic acid based molecular devices. Angew. Chem. Int. Ed. Engl. 50, 3124-3156 (2011).
  3. Zhang, D. Y., Winfree, E. Control of DNA strand displacement kinetics using toehold exchange. J. Am. Chem. Soc. 131, 17303-17314 (2009).
  4. Qian, L., Winfree, E., Bruck, J. Neural network computation with DNA strand displacement cascades. Nature. 475, 368-372 (2011).
  5. Qian, L., Winfree, E. Scaling up digital circuit computation with DNA strand displacement cascades. Science. 332, 1196-1201 (2011).
  6. Zadegan, R. M., Jepsen, M. D., Hildebrandt, L. L., Birkedal, V., Kjems, J. Construction of a fuzzy and boolean logic gates based on DNA. Small. 11, 1811-1817 (2015).
  7. Seelig, G., Soloveichik, D., Zhang, D. Y., Winfree, E. Enzyme-free nucleic acid logic circuits. Science. 314, 1585-1588 (2006).
  8. Zadegan, R. M., et al. Construction of a 4 zeptoliters switchable 3D DNA box origami. ACS Nano. 6, 10050-10053 (2012).
  9. Andersen, E. S., et al. Self-assembly of a nanoscale DNA box with a controllable lid. Nature. 459, 73-76 (2009).
  10. Zhang, D. Y., Hariadi, R. F., Choi, H. M., Winfree, E. Integrating DNA strand-displacement circuitry with DNA tile self-assembly. Nat. Commun. 4, (1965).
  11. Yurke, B., Turberfield, A. J., Mills, A. P., Simmel, F. C., Neumann, J. L. A DNA-fuelled molecular machine made of DNA. Nature. 406, 605-608 (2000).
  12. Green, S. J., Lubrich, D., Turberfield, A. J. DNA hairpins: fuel for autonomous DNA devices. Biophys. J. 91, 2966-2975 (2006).
  13. Venkataraman, S., Dirks, R. M., Rothemund, P. W., Winfree, E., Pierce, N. A. An autonomous polymerization motor powered by DNA hybridization. Nat. Nanotechnol. 2, 490-494 (2007).
  14. Green, S. J., Bath, J., Turberfield, A. J. Coordinated chemomechanical cycles: a mechanism for autonomous molecular motion. Phys. Rev. Lett. 101, 238101 (2008).
  15. Omabegho, T., Sha, R., Seeman, N. C. A bipedal DNA Brownian motor with coordinated legs. Science. 324, 67-71 (2009).
  16. Turberfield, A. J., et al. DNA fuel for free-running nanomachines. Phys. Rev. Lett. 90, 118102 (2003).
  17. Dirks, R. M., Pierce, N. A. Triggered amplification by hybridization chain reaction. Proc. Natl. Acad. Sci. U. S. A. 101, 15275-15278 (2004).
  18. Seelig, G., Yurke, B., Winfree, E. Catalyzed relaxation of a metastable DNA fuel. J. Am. Chem. Soc. 128, 12211-12220 (2006).
  19. Zhang, D. Y., Turberfield, A. J., Yurke, B., Winfree, E. Engineering entropy-driven reactions and networks catalyzed by DNA. Science. 318, 1121-1125 (2007).
  20. Yin, P., Choi, H. M., Calvert, C. R., Pierce, N. A. Programming biomolecular self-assembly pathways. Nature. 451, 318-322 (2008).
  21. Chen, X., Briggs, N., McLain, J. R., Ellington, A. D. Stacking nonenzymatic circuits for high signal gain. Proc. Natl. Acad. Sci. U. S. A. 110, 5386-5391 (2013).
  22. Phillips, A., Cardelli, L. A programming language for composable DNA circuits. J. R. Soc. Interface. 6, Suppl 4. S419-S436 (2009).
  23. Lakin, M. R., Youssef, S., Polo, F., Emmott, S., Phillips, A. Visual DSD: a design and analysis tool for DNA strand displacement systems. Bioinformatics. 27, 3211-3213 (2011).
  24. Lakin, M. R., Youssef, S., Cardelli, L., Phillips, A. Abstractions for DNA circuit design. J. R. Soc. Interface. 9, 470-486 (2012).
  25. Zhang, D. Y., Winfree, E. Robustness and modularity properties of a non-covalent DNA catalytic reaction. Nucleic Acids Res. 38, 4182-4197 (2010).
  26. Ducani, C., Kaul, C., Moche, M., Shih, W. M., Hogberg, B. Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides. Nat. Methods. 10, 647-652 (2013).
  27. Lin, C., et al. In vivo cloning of artificial DNA nanostructures. Proc. Natl. Acad. Sci. U. S. A. 105, 17626-17631 (2008).
  28. Bhatia, D., et al. Icosahedral DNA nanocapsules by modular assembly. Angew. Chem. Int. Ed. Engl. 48, 4134-4137 (2009).
  29. Chen, Y. J., et al. Programmable chemical controllers made from DNA. Nat. Nanotechnol. 8, 755-762 (2013).
  30. Arkin, A., Ross, J. Computational functions in biochemical reaction networks. Biophys. J. 67, 560-578 (1994).
  31. Érdi, P., Tóth, J. Mathematical models of chemical reactions: theory and applications of deterministic and stochastic models. Manchester University Press. (1989).
  32. Magnasco, M. O. Chemical kinetics is Turing universal. Phys. Rev. Lett. 78, 1190 (1997).
  33. Oishi, K., Klavins, E. Biomolecular implementation of linear I/O systems. IET Syst. Biol. 5, 252-260 (2011).
  34. Senum, P., Riedel, M. Rate-independent constructs for chemical computation. PLoS One. 6, (2011).
  35. Soloveichik, D., Cook, M., Winfree, E., Bruck, J. Computation with finite stochastic chemical reaction networks. Natural Computing. 7, 615-633 (2008).
  36. Soloveichik, D., Seelig, G., Winfree, E. DNA as a universal substrate for chemical kinetics. Proc. Natl. Acad. Sci. U. S. A. 107, 5393-5398 (2010).
  37. Tyson, J. J., Chen, K. C., Novak, B. Sniffers, buzzers, toggles and blinkers: dynamics of regulatory and signaling pathways in the cell. Curr. Opin. Cell. Biol. 15, 221-231 (2003).
  38. Cardelli, L. Two-domain DNA strand displacement. Math. Struct. Comput. Sci. 23, 247-271 (2013).
  39. Angluin, D., Aspnes, J., Eisenstat, D. A simple population protocol for fast robust approximate majority. Distrib. Comput. 21, 87-102 (2008).
  40. Cardelli, L., Csikasz-Nagy, A. The cell cycle switch computes approximate majority. Sci. Rep. 2, 656 (2012).
  41. Zadeh, J. N., et al. NUPACK: Analysis and design of nucleic acid systems. J. Comput. Chem. 32, 170-173 (2011).
  42. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. J. Vis. Exp. (2012).
  43. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods. 6, 343-345 (2009).
  44. Froger, A., Hall, J. E. Transformation of plasmid DNA into E. coli using the heat shock method. J. Vis. Exp. e253 (2007).
  45. Lessard, J. C. Transformation of E. coli via electroporation. Methods Enzymol. 529, 321-327 (2013).
  46. Nasri, M., Thomas, D. Alteration of the specificity of PvuII restriction endonuclease. Nucleic Acids Res. 15, 7677-7687 (1987).
  47. Dalchau, N., Seelig, G., Phillips, A. Computational design of reaction-diffusion patterns using DNA-based chemical reaction networks. DNA Computing and Molecular Programming. 84-99 (2014).
  48. Scalise, D., Schulman, R. Designing modular reaction-diffusion programs for complex pattern formation. Technology. 2, 55-66 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics