Plasmide dérivé d'ADN Strand Displacement Gates Réseaux de réaction d'exécution chimiques

Biology
 

Cite this Article

Copy Citation | Download Citations

Chen, Y. J., Rao, S. D., Seelig, G. Plasmid-derived DNA Strand Displacement Gates for Implementing Chemical Reaction Networks. J. Vis. Exp. (105), e53087, doi:10.3791/53087 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

La prévisibilité de Watson-Crick a permis l'ADN dynamique nanotechnologie à émerger comme un moyen programmable de concevoir des dispositifs moléculaires avec des propriétés dynamiques 1,2. En particulier, le déplacement de brin d'ADN -, une réaction d'hybridation compétitive programmable - est révélée être un mécanisme puissant pour l'ingénierie des systèmes d'ADN dynamiques. Dans une réaction de déplacement de brin d'ADN, un oligonucléotide entrant déplace une "sortie" brin précédemment lié à un partenaire de liaison complémentaire. Plusieurs de ces réactions peuvent être enchaînés en plusieurs étapes cascades de réactions avec un degré élevé de contrôle sur l'ordre et le moment de réaction individuelle étapes 3. ADN cascades de déplacement de brin ont été utilisées pour créer des circuits numériques et analogiques moléculaires 4-7, 8-10 nanostructures commutables, moteurs moléculaires autonomes 11-15, et amplificateurs catalytiques non-covalentes 13,16-21. En outre, DNA dispositifs utilisant des réactions de déplacement de brin peuvent être simulés et conçus pour des applications diverses en utilisant un logiciel de conception assistée par ordinateur 22-24.

Actuellement, l'ADN synthétisé chimiquement sert comme matériau principal pour nanotechnologie de l'ADN. Toutefois, des erreurs dans le processus de synthèse de l'ADN, et les oligonucléotides imparfaits qui en résultent, sont soupçonnés de limiter la performance des dispositifs dynamiques d'ADN en provoquant des réactions erronées secondaires. Par exemple, des réactions «fuite» peuvent donner lieu à la libération d'un oligonucléotide de sortie même en l'absence d'un déclencheur de réaction. Ces effets sont plus évidents dans cascades de réactions autocatalytiques où même une quantité minimale de fuite initial finira par conduire à la pleine activation de la cascade de 19,20. Inversement, les réactions ne parviennent souvent pas à atteindre le niveau attendu de l'activation parce que certains composants ne déclenchent pas, même en présence de l'entrée prévue de 7,25. Base d'ADN pour faire la performance denanodispositifs comparables à leurs homologues biologiques à base de protéines, ces modes d'erreur doivent être considérablement réduit.

Plasmides bactériens ou autre ADN biologique pourraient servir de source relativement pas cher de l'ADN de haute pureté pour les applications de la nanotechnologie. De grandes quantités d'ADN peuvent être générés par la réplication dans les bactéries et les capacités intrinsèques de relecture des systèmes vivants assurer la pureté de l'ADN résultant. En fait, plusieurs études récentes ont reconnu l'utilité potentielle de l'ADN biologique pour les applications des nanotechnologies 21,26-28. Cependant, la nature entièrement double brin de l'ADN plasmidique a jusqu'ici interdit son utilisation en tant que matériau pour la fabrication de dispositifs dynamiques de l'ADN, qui se composent généralement de plusieurs oligonucleotides et contiennent à la fois des domaines double brin et simple brin. Dans un récent article 29 de cette question a été abordée et une nouvelle architecture de la porte d'ADN qui se compose principalement de l'ADN double brin entaillé (ndsDNA) était d'introduireré.

Surtout, systèmes de portes ndsDNA peuvent être conçus qui réalisent la dynamique spécifiées par tout réseau de réaction chimique formelle (CRN) 29. portes ndsDNA pourraient ainsi être utilisés, en principe, de créer des systèmes dynamiques qui présentent des oscillations et le chaos, bistabilité et de la mémoire, la logique booléenne ou comportements algorithmiques 30-38. Par exemple, Réf. 29 ont démontré une CRN trois réaction qui a fourni une mise en œuvre d'un protocole moléculaire "de consensus", un type d'algorithme de calcul distribué 29,39,40. Ce travail d'abord démontré une nouvelle utilisation pour le formalisme CRN comme un "langage de programmation" pour synthétiser rapidement les systèmes moléculaires fonctionnels (figure 1A).

Ici, un protocole détaillé pour dériver portes ndsDNA de l'ADN de plasmide est fourni. Le premier est un examen du processus de conception de la séquence. Puis suit une explication de la façon dont oligonucléotides synthétiques contenantles séquences de grille sont clonées dans des plasmides et la séquence vérifiées et amplifiés par culture bactérienne. Ensuite, il est montré comment ndsDNA portes peuvent être obtenues à partir des plasmides par traitement enzymatique (voir la figure 2). Enfin, un procédé pour tester le comportement de grille en utilisant les dosages cinétiques de fluorescence est décrite.

Mécanisme réaction
A titre d'exemple, le protocole met l'accent sur ​​la réaction chimique catalytique A + B-> B + C. Les espèces A, B, et («signaux», figure 1B) C correspondent toutes à une autre molécule d'ADN simple brin. Les séquences de ces molécules sont totalement indépendants et les brins ne réagissent pas directement avec l'autre. Les séquences de tous les signaux ont deux domaines fonctionnels différents, à savoir, séquences qui agissent ensemble dans des réactions de déplacement de brins: 1) un domaine de prendre pied court (étiquettes TA, TB, TC) qui est utilisé pour l'initiation de déplacement de brin reaction, et 2) un domaine de temps (étiquettes a, b, c) qui détermine l'identité du signal.

Interactions entre les brins de signaux sont médiés par ADN (ndsDNA) complexes de porte à double brin entaillés (appelé jointure AB et Fork BC) et les espèces simple brin auxiliaires (<tr r>, <b tr>, <c tb> et <i tc >). La réaction A + B- formel> B + C est exécutée par une série d'étapes de réaction de déplacement de brin, où chaque étape de réaction expose un pied pour une réaction ultérieure (figure 1B). Dans cet exemple, les signaux A et B sont d'abord libre en solution tandis que le signal C est lié à la grille fourche. A la fin de la réaction B et C sont en solution. Plus généralement, les signaux qui sont liés à une porte sont inactifs alors que les signaux qui sont libres en solution sont actifs, ce qui signifie qu'ils peuvent participer à une réaction de déplacement de brin queune entrée. L'évolution dans le temps de la réaction est suivi en utilisant une stratégie de rapporteur fluorescent (figure 1C). 29 Dans des travaux antérieurs, il a été démontré que ce mécanisme de réaction ne réalise pas la stoechiométrie correcte mais également la cinétique de la réaction visée.

Protocol

1. Séquence Conception

Remarque: aperçu de la conception de la séquence: Dans cette section, la stratégie pour la conception de portes d'ADN plasmide dérivé est décrite. Des sites d'enzymes placés à chaque extrémité de la porte pour permettre la libération de doubles portes entièrement bloqués après digestion. Les sites d'entailler sont ensuite placés tels que les enzymes créent entailles sur le brin supérieur pour créer les portes finales de ndsDNA. Enfin, les séquences restantes sont choisies de telle sorte que les domaines indépendants sont orthogonaux les uns aux autres et ne présentent pas de structure secondaire.

  1. Placer le site de coupure simple brin Nt.BstNBI quatre nucleotides loin de l'extrémité 3 'de chaque domaine de temps (a, b, c, r, et i). Placer le site de coupure simple brin Nb.BsrDI sur l'extrémité 5 'de chaque domaine de temps (a, b, c, et r. A noter que le domaine i n'a pas de site de coupure simple brin Nb.BsrDI). Figure 2C montre la vue détaillée de la séquence de Rejoignez AB et BC Fork portes.
  2. Placer le site de restriction PvuII sur les deux extrémités de portes ndsDNA sorte que la digestion PvuII peut libérer les portes de plasmides (voir figure 2C).
  3. Concevoir d'autres séquences sans contrainte en suivant deux principes: (a) brins ne doivent pas exposer des structures secondaires (structures d'ADN peuvent être prédits en utilisant Nupack 41), et (b) tous les domaines doivent être orthogonale à minimiser la diaphonie.
  4. Placez séquences ndsDNA dans le centre d'un modèle de grille. Passer 30-40 pb des séquences aléatoires d'espacement sur les deux extrémités du gabarit de grille, chaque élément d'espacement sert de site de liaison unique pour la réaction en chaîne de la polymérase suivant (PCR).

2. Clonage de plasmides dans NdsDNA portes

Remarque: Cette section décrit la méthode de clonage Gibson pour insérer 4 exemplaires de la porte dans un squelette plasmidique.

  1. Afin ndsDNA grille des modèles que des blocs double brin génomiques provenant d'un fabricant d'ADN (séquences de modèles de porte sont présentésdans le tableau 1; volets se produisent dans ndsDNA portes sont montrées dans le tableau 2; des séquences de domaine de niveau sont présentés dans le tableau 3).
  2. Après avoir reçu l'ADN ordonné, tourner les tubes contenant des blocs génomiques à 10,000-14,000 g pendant 1 min pour garantir que tout l'ADN séché est au fond du tube.
  3. Remettre en suspension les blocs génomiques secs dans de l'eau exempte de DNase pour obtenir une concentration finale de 10 ng / ul.
    Remarque: En variante, l'ADN peut être remis en suspension en utilisant du Tris 1x acide éthylènediaminetétraacétique (EDTA) tampon (tampon TE: Tris 10 mM et EDTA 1 mM, pH 8,0). Cependant, l'EDTA est un chélateur de cations divalents et pourrait inhiber la PCR.
  4. Générer 4 fragments de grille avec différentes zones de recouvrement à travers un PCR standard avec une polymérase haute fidélité de l'ADN (voir la figure 3A). Les séquences d'amorces sont détaillés dans le tableau 4 (température de fusion de ces amorces est de 62 ° C).
  5. Exécutez un gel d'agarose à 2% à 140 V pendant 30 min à température ambiante (pour un protocole d'agarose par électrophorèse sur gel détaillée, voir 42) et couper les bandes correspondant à chaque fragment de PCR amplifié du gel. Puis purifier les tranches de gel en utilisant un kit d'extraction de gel (s'il vous plaît se référer aux Matériaux) en suivant les instructions du fabricant.
  6. Digérer un certain nombre squelette plasmidique élevé de copies (voir matériaux) avec PvuII-HF et PstI-HF à 37 ° C pendant 1 heure (voir tableau 5) selon le protocole du fabricant. PvuII-HF et PstI-HF sont des enzymes de restriction de haute fidélité, qui réduisent considérablement les coupures non spécifiques.
  7. Exécutez un gel d'agarose à 1,5% et de couper la colonne vertébrale linéarisé (généralement exécuter le gel à 140 V pour 30-40 min à température ambiante). Ensuite, l'ADN extrait à partir de la tranche de gel en utilisant le kit d'extraction sur gel en suivant les instructions du fabricant.
  8. Effectuer Gibson ensemble 43 avec le vecteur linéarisé et fragments PCR purifiés (voir tableau 6 et la figure 3B
  9. Transformer le produit d'assemblage de l'étape 2.8 Gibson dans Escherichia coli (E. coli) et la plaque sur un Lysogénie Broth (LB) contenant des antibiotiques plaque de gélose à l'ampicilline (à une concentration de 100 ug / ml). Effectuer la transformation par électroporation ou une méthode de choc thermique 44,45, et utiliser le E. appropriée coli. Par exemple, utiliser E. coli souche JM109 pour la transformation de choc thermique, et d'utiliser DH5a électrocompétentes E. coli pour l'électroporation des cellules.
    Remarque: le squelette de plasmide utilisé comporte une cassette de résistance à l'ampicilline. Si vous utilisez un marqueur de sélection différent, utilisez les antibiotiques appropriés au lieu d'ampicilline.

3. culture bactérienne Amplification et contrôle de la qualité

Remarque: Cette section décrit la production de masse et l'isolement de plasmides contenant les portes d'ADN après contrôle de la qualité.

  1. Choisissez une seule colonieà partir de la plaque de l'étape sélectif Ampicillin 2,9 et incuber une culture de 3 ml de milieu enrichi contenant des antibiotiques ampicilline (à une concentration de 100 ug / ml). Marquer la colonie de telle sorte qu'il peut être utilisé de nouveau par étapes expérimentales suivantes. Cultiver la culture à 37 ° CO / N avec agitation vigoureuse (200-300 rpm). Typiquement, incuber pendant 16-24 h.
  2. Extraire l'ADN plasmidique à partir de la culture bactérienne en utilisant un kit Mini-prep selon les instructions du fabricant.
  3. Mesurer l'ADN plasmidique purifié en utilisant un spectrophotomètre en suivant les instructions du fabricant. Fourchettes de rendement typiques de 50-1000 ng / ul.
  4. Obtenir l'ADN plasmidique extrait séquence par l'envoi de l'échantillon à une société de séquençage d'ADN. Les amorces de séquençage doivent se trouver à environ 100 nucleotides en amont et en aval de la région à séquencer; l'amorce de séquençage du plasmide (voir matériaux pour plasmide) a la séquence suivante: ATTACCGCCTTTGAGTGAGC.
    Nonte: Si il ya erreur de séquence ou par recombinaison dans le ndsDNA portes inséré, sélectionnez une colonie différente de la plaque de l'étape 2.9. Suivez les étapes 3.1-3.4 pour vérifier que les séquences des portes insérées sont correctes.
  5. Après avoir vérifié que les séquences sont corrects, ramasser la colonie correspondante de la plaque sélective ampicilline (de l'étape 2.9), et incuber une culture de 800 ml Terrific Broth (TB) contenant des antibiotiques (ampicilline à une concentration de 100 pg / ml). Cultiver la culture à 37 ° C pendant 16-24 heures avec une agitation vigoureuse (200 à 300 rpm). TB est particulièrement bien adapté pour la production de plasmide à haut rendement.
    Remarque: Alternativement, LB pourrait également être utilisé pour cultiver des bactéries bien que le rendement de plasmide peut être un problème.
  6. On purifie l'ADN en utilisant un kit Maxi-prep selon les instructions du fabricant.
  7. Suivez l'étape 3.3-3.4 pour vérifier si les séquences sont corrects. Si une recombinaison a eu lieu, voir la note suivante. Sinon, passez à l'étape 4. <br /> Remarque: Un problème possible ici est que plusieurs copies de portes insérées dans le plasmide peuvent se recombiner en raison de réparation de l'ADN. Pour résoudre ce problème, utilisez un E. coli souche dépourvue de la protéine recA (une protéine liée à la réparation d'ADN) tel que JM109 ou DH5a pour transformer une séquence de plasmide préalablement vérifiée (par exemple, sans aucune erreur de séquence et la recombinaison). Ensuite, prenez une colonie de cette plaque et de vérifier la séquence du plasmide en envoyant l'échantillon à une société de séquençage de l'ADN.

4. Traitement enzymatique

Remarque: Cette section décrit le processus de digestion des plasmides tels qu'ils sont coupés et entaillés dans les emplacements corrects et prêts à être utilisés pour des expériences de cinétique.

  1. Digérer l'ADN plasmidique purifié de l'étape 3.7 avec l'enzyme de restriction PvuII-HF pendant 1 heure à 37 ° C (voir tableau 7). Typiquement digérer le plasmide avec 4 unités de PvuII-HF pour 1 mg de plasmide. Haute fiddes enzymes de restriction de elity sont recommandés pour une utilisation parce qu'ils réduisent considérablement les coupures non spécifiques.
  2. Effectuer précipitation à l'éthanol sur l'échantillon.
    1. Ajouter 2 équivalents volumes d'éthanol absolu refroidi à la glace de l'échantillon.
    2. Incuber le mélange à -80 ° C pendant au moins 1 heure (ce mélange peut également siéger à -80 ° C pour O / N).
    3. Centrifuger à 10,000-14,000 xg à 0 ° C pendant 30 min.
    4. Retirer le surnageant.
    5. Ajouter 1000 pi d'éthanol à 95% RT de l'échantillon, et inverser 10-15 fois.
    6. Centrifuger à 10,000-14,000 xg à 4 ° C pendant 10 min.
    7. Retirer le surnageant et l'air sec sur le banc pendant 10-20 min.
    8. Reprendre les culots d'ADN dans un volume approprié de nucléase libre H 2 O (typiquement 100-200 pi). Ajout de plus de 200 pi sera généralement faire l'échantillon trop diluée pour une utilisation dans des expériences de cinétique.
  3. Mesurer l'ADN remis en suspension en utilisant un spectrophotomètre suivant la mles instructions abricant.
  4. Digest rejoindre portes avec entailler enzyme Nb.BsrDI à 65 ° C pendant 1 heure avec 4 unités d'enzyme par 1 pg de plasmide (voir tableau 8); digérer fourche portes avec entailler enzyme Nt.BstNBI à 55 ° C pendant 1 heure en utilisant 8 unités d'enzyme par 1 pg de plasmide (voir le tableau 9).
    Nota: L'étape 4.2 supprime tampon de digestion enzymatique et contribue à concentrer les portes pour les expériences de cinétique. Etape 4.2 peut être ignorée pour rejoindre portes parce que les deux enzymes de restriction PvuII-HF et l'enzyme entailler Nb.BsrDI partagent le même tampon de digestion. A l'étape 4.2.8, Nuclease libre H 2 O est utilisé à la place de TE parce que l'EDTA est un chélateur de cations divalents et peut inhiber les enzymes de restriction qui ont besoin de ces ions pour fonctionner.
    Remarque: L'ajout de quantités excessives d'enzymes peut conduire à des quantités élevées de fuite de circuit initial (figure 4), qui est probablement causé par une sur-digestion 46. Cette question can être adressée par l'optimisation des quantités d'enzymes (voir Figure 4). Gamme typique des enzymes est de 1-10 unités / 1 pg de plasmide.

5. Préparation d'oligonucléotides simple brin

Remarque: Cette section décrit le protocole de remise en suspension et en quantifiant l'ADN simple brin synthétisé chimiquement (ADNss) qui sera utilisé pour les brins de signaux et des brins auxiliaires. Pour les séquences de brins voir le tableau 10. Notez que le protocole suivant est un exemple de préparation 10 uM ssADN. D'autres concentrations d'ADN à un brin peuvent être préparés de manière similaire.

  1. Après avoir reçu du producteur oligos d'ADN, tourner les tubes contenant de l'ADN à 10,000-14,000 g pendant 1 min pour garantir que tout l'ADN séché est au fond du tube.
  2. Remettre en suspension l'ADN en utilisant 1x Tris acide éthylènediaminetétraacétique (EDTA) tampon (tampon TE: Tris 10 mM et EDTA 1 mM, pH 8,0) pour obtenir une concentration finale de 100 uM. Pourpar exemple, remettre en suspension 8 nmol de l'ADN dans 80 ul de tampon TE.
  3. Mélanger 10 ul de l'ADN à 100 uM avec 90 ul d'eau moléculaire dans un tube de microcentrifugation, qui doivent atteindre une concentration finale de 10 uM.
  4. Mesurer la concentration exacte de l'échantillon d'ADN à l'aide d'un spectrophotomètre en suivant les instructions du fabricant. Le protocole ci-dessous donne un exemple de la façon dont la concentration d'ADN peut être mesurée.
    1. Blank le spectrophotomètre avec 2 pi d'eau moléculaire.
    2. Mesurer l'absorbance à 260 nm (A 260) de l'échantillon d'ADN. Utilisez l'équation suivante pour calculer la concentration de stock.
      Remarque: La concentration de l'échantillon est un coefficient M = 260 / extinction. Le coefficient d'extinction peut être trouvé sur la spécification Fiche par le fabricant de l'ADN.

6. Préparation de Reporters fluorescentes

Remarque: Cette section décrit laprotocole de préparation Reporter C, d'autres reporters fluorescents peut être assemblé de façon similaire.

  1. Commandez chromatographie liquide à haute performance (CLHP) oligonucléotides purifiés ROX- <c * tc *> (le brin supérieur de Reporter C) et <c> -rq (le brin inférieur de Reporter C) depuis le fabricant de l'ADN (voir le tableau 10 pour les séquences ).
  2. Après avoir reçu le oligonucléotides synthétisée, remettre en suspension et de quantifier des échantillons comme expliqué à l'étape 5.
  3. Mélanger le haut de journaliste et de brins de fond (c.-à-ROX- <c * tc *> et <c> -rq) à 1x Tris-Acétate-EDTA (TAE) avec 12,5 mM Mg 2+ (voir le tableau 11 pour la recette détaillée ). Notez qu'ici 30% d'excès brin extincteur marqué <c> -rq est ajouté à assembler le journaliste, qui assure que tous les brins de fluorophores marqués sont trempés même avec stoechiométrie imparfaite.
  4. Recuire le complexe Reporter C en utilisant un cycleur thermique, le refroidissement de 95 ° C à 20 ° C à une vitesse de 1 ° C / min. Les échantillons peuvent être conservés à 4 ° C.

7. Les mesures de fluorescence

Remarque: La section décrit un protocole général pour la cinétique de fluorescence mesures (voir figure 5 pour la procédure expérimentale), et ce protocole sera utilisé dans les étapes 8, 9 et 10. A noter également que ce protocole est à l'usage d'un spectrofluorimètre. Alternativement, ces expériences pourraient également être effectuées dans un lecteur de plaque bien que des variations de sensibilité, bien au bien-et le manque de contrôle de la température dans des expériences à long terme peut être un problème.

  1. Réglez le régulateur de température à 25 ° C, et d'attendre que la température se stabilise. L'utilisation d'un régulateur de température peut réduire la variabilité dans le signal qui peut résulter de la variation de température.
  2. Paramètres appropriés fixés FOcinétique r mesures dans le logiciel d'acquisition de données de l'spectrofluorimètre. Détaillées des exemples de paramètres sont comme suit:
    1. Réglez la largeur de la fente à 2,73 nm pour les deux monochromateurs d'excitation et d'émission.
    2. Réglez le temps d'intégration de 10 secondes pour chaque 60 secondes point dans le temps. Réglez le temps total de mesure à 24 h.
    3. Définissez les longueurs d'onde d'excitation / émission pour faire correspondre les fluorophores utilisés dans l'expérience. Exemple longueurs d'onde sont les suivantes: ROX (588 nm / 608 nm), et TAMRA (559 nm / 583 nm).
  3. Ajouter Nuclease libre H 2 O et 10x tampon Tris-acétate-EDTA contenant 125 mM de Mg2 + (10x TAE / Mg 2+) à une cellule de quartz synthétique. Voir les tableaux 12, 13 et 14, par exemple des volumes à utiliser.
  4. Ajouter brins polyT pour obtenir une concentration finale de 1 uM ~ (voir le tableau 12, 13 et 14 pour des volumes), puis le vortex synthétiquecellules de quartz pour 10-15 sec. Généralement, des embouts de pipette seront non spécifiquement lier à l'ADN. L'ajout de concentrations élevées de brins polyT peut réduire cette erreur liaison non spécifique.
  5. Ajouter les journalistes et les brins auxiliaires. Voir le tableau 12, 13 et 14 par exemple des volumes à utiliser. Notez que pour l'étalonnage de journaliste, pas de brins auxiliaires sont nécessaires.
  6. Ajouter 10% de dodécylsulfate de sodium (SDS) pour obtenir une concentration finale de 0,15% de SDS. Remarque: SDS est utilisé pour dissocier les enzymes des portes dérivées du plasmide car les enzymes peuvent interférer avec la réaction de déplacement de brin (voir Figure 6). SDS est recommandé ici au lieu de dénaturation thermique des enzymes pour éviter la dissociation et de recombinaison incorrecte de brins de grille, ce qui peut nuire à la fonction de circuit.
  7. [Passer cette étape pour l'étalonnage de journaliste.]
    1. Ajouter rejoindre et portes fourche (voir tableau 13, et 14 pour les volumes)à la cellule de quartz synthétique et mélanger la solution par pipetage de haut en bas pendant au moins 20 fois (ne pas vortexer la cuvette car les solutions homogénéisation par vortex avec SDS peuvent entraîner des bulles qui auront une incidence sur la cinétique de fluorescence mesures).
    2. Aussi, passer aux étapes suivantes de mesure dès que possible parce que la réaction de fuite déclenche immédiatement après l'ajout de rejoindre et de fourche portes à la cellule de quartz synthétique.
  8. Placez les cellules de quartz synthétiques dans la chambre d'un spectrofluorimètre.
  9. Démarrez la mesure de la cinétique.
  10. Après 5 min de mesure, ajouter des brins d'entrée (voir le tableau 12, 13 et 14 pour des volumes) à la cellule de quartz synthétique et mélanger la réaction par pipetage de haut en bas pendant au moins 20 fois. A noter que l'échantillon doit être mélangé doucement pour éviter les bulles. Effectuez cette étape alors que le programme d'acquisition de données est en pause à éviter de mesurer des signaux déclenchés par externelumière.
  11. Enregistrer la cinétique de réaction jusqu'à ce qu'il atteigne l'état d'équilibre. La cinétique de réaction sont affichées sur l'ordinateur.

8. Calibrer fluorescentes Reporters

Remarque: Cette section décrit le protocole pour faire des courbes d'étalonnage des journalistes fluorescentes. Les courbes de calibrage seront utilisés pour convertir les unités arbitraires de fluorescence à la concentration molaire de signal.

  1. Calibrer rapporteurs fluorescents suivant le protocole décrit à l'étape 7. Utilisation des volumes des réactifs et des tampons tels que résumés dans le tableau 12 La concentration de l'étalon pour cet exemple est de 50 nM (1x). les journalistes sont à 3x; entrée est 1x. Pour les cas où l'entrée <tc c> sont à 0.25x, 0.5x, 0.75x, régler le volume de la nucléase libre H 2 O en conséquence de maintenir le volume final de chaque réaction à être 600 pi. Un exemple de données sont représentés sur la figure 7A.
  2. Ajouter une courbe d'étalonnage de laReporter C par un ajustement linéaire des valeurs de fluorescence finale contre la concentration initiale d'un signal C (courbe Un exemple d'étalonnage est représentée sur la figure 7B). Cette courbe d'étalonnage peut être utilisé pour convertir des unités arbitraires de fluorescence à sa concentration de signal correspondante.

9. quantifier la concentration du plasmide dérivé ndsDNA Portes

Remarque: Chaque lot traité indépendamment de portes ndsDNA plasmide dérivé des résultats dans un autre rendement de portes fonctionnelles, et cette section décrit un protocole pour quantifier la concentration de portes ndsDNA plasmide dérivé.

  1. Quantifier la concentration de portes ndsDNA plasmide dérivé suivant le protocole décrit à l'étape 7. Utilisation des volumes de réactifs tels que résumés dans le tableau 13. Remarque: Le tableau 13 décrit un exemple de recette fourche BC quantification Rejoindre. AB et d'autres portes peuvent être effectuées de manière similaire mais en utilisant différents volets d'entrée, volets auxiliaires et des journalistes.
  2. Convertir la valeur de fluorescence mesurée finale dans cette expérience à une concentration d'un signal C en utilisant la courbe d'étalonnage de l'étape 8.2. Puis retour-calculer la concentration de porte ndsDNA. Par exemple, une valeur de fluorescence finale pour l'expérience de quantification de grille correspond à 25 nM signal de C (0,5) sur la base de la courbe d'étalonnage sur la figure 7B. Depuis le stock de Fork BC est dilué 40 fois dans cette réaction, la concentration de l'action de la porte Fork BC est de 1 uM.

10. Mesures Kinetics pour la réaction A + B> B + C

Remarque: Cette section décrit un protocole pour tester l'ADN réalisation d'une réaction chimique à l'aide formelle cinétique de fluorescence mesures.

  1. ParMesure forme cinétique en suivant le protocole décrit à l'étape 7. Utilisez les volumes de réactifs et tampons telles que résumées dans le tableau 14.

Representative Results

Pour un test fonctionnel, une mise en œuvre de l'ADN de la réaction catalytique bimoléculaire (ie, A + B> B + C) a été créée. La performance de portes plasmide dérivé a été comparée à portes assemblés à partir de l'ADN synthétique. Réactions catalytiques sont un bon test pour portail pureté car une porte défectueuse peut irréversiblement piège un catalyseur, provoquant un effet disproportionné sur la quantité de produit fabriqué 18,19. Dans le même temps, une petite fuite de réaction qui entraîne la libération du signal non déclenché catalytique sera amplifié linéairement, ce qui conduit à un signal d'erreur disproportionnée. Les données expérimentales pour les portes de plasmides dérivés synthétisés et sont présentés sur la figure 8B et 8C, respectivement. Dans les expériences, la concentration d'un signal volet A est fixe tandis que le montant du signal catalytique B est modifiée. Signal C est utilisée pour lire l'état d'avancement de la réaction catalytique sans interrompre lecycle. La catalyse peut être observé dans les données puisque les réactions se rapprochent achèvement, même avec des quantités de catalyseur B beaucoup plus petites que la quantité de A. Depuis SDS n'a pas été ajouté à des expériences effectuées avec le système de synthèse, la vitesse de réaction (qui pourraient être affectés par l'ajout de SDS) ne sont pas comparés et l'accent analytique est plutôt sur le chiffre d'affaires catalytique (détaillées comme suit).

Une analyse plus poussée du chiffre d'affaires de cette réaction catalytique a été réalisée. Changement est défini comme le signal de quantité produite C pour chaque catalyseur B à un instant donné. Plus précisément, le chiffre d'affaires a été calculé à partir de nos données expérimentales en divisant la fuite soustrait le signal C par le montant initial de catalyseur B ajouté. Pour un système catalytique idéal, ce nombre de rotation doit augmenter de façon linéaire avec le temps et d'être indépendant de la quantité de catalyseur aussi longtemps que le substrat est pas limitative. Dans un système réel, portes défectueuses peuvent désactiver chat alysts, et le chiffre d'affaires atteindra une valeur maximale, même si pas tous disponibles substrat est converti en produit. La valeur maximale de rotation indique combien de substrats (signal A) un catalyseur (B) signaux peuvent convertir avant d'être inactivé. Ici, on observe que le système de synthèse diffère de la croissance linéaire idéal de rotation beaucoup plus tôt que le système de plasmide dérivé ne, ce qui indique la séquestration du catalyseur par une réaction secondaire indésirable (Figure 8D). La comparaison du chiffre d'affaires est indiqué uniquement pour les faibles concentrations, car à des concentrations élevées de catalyseurs, toutes les portes seront déclenchées et libèrent le signal C. Le circuit de fuite est également comparée, et on observe que le rapport de signal de fuite utilisant des portes de plasmide dérivé est d'environ 8% de moins que ce que les portes synthétisé en utilisant 10 h après la réaction (Figure 8E).

iles / ftp_upload / 53087 / 53087fig1.jpg "/>
Figure 1. (A) RRC servent comme un langage de programmation prescriptive. Réseaux de réaction d'ADN peuvent être conçus pour rapprocher la dynamique d'une mise en œuvre formelle CRN (B) de l'ADN d'un exemple instruction chimique:. A + B> B + C. Brins d'ADN sont dessinées comme des lignes avec des flèches à l'extrémité 3 'et * indique la complémentarité. Tout signal de brins A (<TA a>, vert), B (<tb b>, orange), et C (<tc c>, rouge) sont constituées d'un domaine de prendre pied (étiqueté comme TA, TB et TC) et un domaine ayant une identité (appelée a, b, et c). La réaction bimoléculaire A + B> B + C nécessite deux complexes multi-brin Rejoignez AB et BC Fork, et quatre brins auxiliaires <tr r>, <b tr>, <c tb> et <i tc>. La réaction se déroule à travers sept étapes de déplacement de brin, où chaque démarrage de l'étapes avec la liaison (C) stratégie de Reporter prendre pied.. La réaction est suivie par un journaliste dans laquelle le brin inférieur est marqué avec un fluorophore (point rouge) et le brin supérieur est attaché à un extincteur (point noir). En raison de la co-localisation du fluorophore et l'extincteur, la fluorescence reporter est désactivé dans le reporter intact. Le signal C peut remplacer le brin supérieur de la journaliste, conduisant à une augmentation de la fluorescence. (Ce chiffre a été modifié depuis 29 Réf.) S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 2
Figure 2. portes (A) de NdsDNA fabriqués à partir de l'ADN plasmidique bactérienne. Plusieurs exemplaires du double brin ndsDNA porte modèle sont clonées dans un plasmide. Les plasmides clonés sont len transformé en E. les cellules et les colonies sur la plaque coli sont séquence vérifiée. Une fois que la séquence est confirmée, l'ADN plasmidique est amplifié et on l'extrait. Enfin, le double brin plasmide est traitée dans les portes de ndsDNA désirés grâce à un traitement enzymatique. (B) le traitement enzymatique de portes ndsDNA. L'enzyme de restriction PvuII est utilisé pour libérer la porte à partir du plasmide. Les portes libérés sont ensuite traitées en utilisant des enzymes entailler: Nb.BsrDI est utilisé pour générer les pseudos pour Rejoignez AB (Groupe I); Nt.BstNBI est utilisé pour générer les pseudos pour (Groupe II) Fork BC. Les sites de restriction et entailler sont indiqués comme des boîtes de couleur. (C) Vue Séquence du modèle de grille Rejoignez AB (Groupe i) et Fork BC (Groupe II). Le site de restriction PvuII (surligné en boîte violette) est à deux extrémités des portes de ndsDNA. Le Nb.BsrDI et NTLes sites d'entailler .BstNBI sont mis en évidence dans des boîtes rouges et noirs, respectivement. Les emplacements de coupe sont marqués avec des pointes de flèches. Séquence N est un nucléotide quelconque. (Ce chiffre a été modifié avec la permission de 29 Réf.) S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 3
Figure 3. (A) par PCR d'un modèle de grille d'ADN. Un modèle de grille d'ADN contient les séquences ndsDNA porte dans le centre (une région bleue), et séquences d'espacement sur les deux extrémités (régions noires; ces deux séquences d'extrémité sont orthogonales). Amorces peuvent se lier à des séquences d'espacement du modèle de grille, et de générer des quatre fragments d'ADN qui se chevauchent par PCR (séquences chevauchantes sont codés par couleur sur la figure). Assemblage (B) Gibson. Les quatre fragmen d'ADN amplifiésts sont ensuite assemblés dans un squelette plasmidique linéarisé par Gibson procédé d'assemblage 43. (Ce chiffre a été modifié avec la permission de 29 Réf.) S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 4
Figure performances 4. Circuit avec différentes quantités d'enzymes. (A) Une représentation simplifiée de la porte, journaliste, brins auxiliaires, et de signaux brins utilisés pour les expériences correspondantes. (B) des expériences de cinétique avec le plasmide dérivé Rejoignez AB traitées avec différentes quantités d'enzymes . je. 10 unités de PvuII-HF et 45 unités de Nb.BsrDI par 1 pg de plasmide; je je. 10 unités de PvuII-HF et 4 unités de Nb.BsrDI par 1 ug de plasmide; iii. 4 unités de PvuII-HF et 4 unités de Nb.BsrDI par 1 pg de plasmide. Tous les brins auxiliaires étaient à 2x (1x = 10 nM). Le complexe de grille est 1,5 fois, et les expériences ont été effectuées à 35 ° C dans 1 x TAE / Mg 2+. (Ce chiffre a été modifié avec la permission de 29 Réf.) S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 5
. Figure 5 Diagramme des expériences de cinétique Bleu:. Matières à ajouter à la cuvette (cellule de quartz 0.875 ml synthétique). Tableau de référence 14 pour des volumes spécifiques à ajouter pour l'expérience cinétique de A + B -> B + C. Verts: Instructions d'un spectrofluorimètre (étiqueté comme SPEX). Rouge: Mélange instructions.53087fig5large.jpg "target =" _ blank "> S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 6
Figure 6. Enzyme comportement de dissociation et le circuit. (A) une représentation simplifiée de la porte, journaliste, brins auxiliaires, et de signaux brins utilisés pour les expériences correspondantes. (B) expériences cinétique de la 80 ° C de chaleur dérivé d'un plasmide Rejoignez AB aide inactivation (traces vertes), 0,15% de dodécylsulfate de sodium (SDS) (rouge), et un contrôle sans inactivation par la chaleur ou l'addition de SDS (bleu). La concentration standard était 1x = 10 nM, et tous les volets auxiliaires et l'entrée B étaient à 2x. Le complexe de grille est 1,5 fois, et les expériences ont été effectuées à 35 ° C dans du tampon Tris-acétate 1x-EDTA contenant 12,5 mM de Mg2 + (1x TAE / Mg 2+ 29 Réf.) S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 7
Figure 7. Reporter étalonnage. (A) Reporter C cinétique. La concentration de journaliste était à 3x (1x = 50 nM), et la concentration initiale d'un signal C est indiqué dans la figure. (B) Les niveaux de fluorescence de signaux C au point (40 min) de fin de mesure montre une relation linéaire avec le concentration initiale de signaux C. Dans un exemple de quantification de Fork BC porte (vert de ligne en pointillés), la valeur de fluorescence de Fork BC était mesureD comme 3 x 10 6 (UA), qui correspond à 25 nm (0.5x) sur la base de la courbe d'étalonnage. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 8
Figure 8. Bimoléculaires de cinétique de réaction catalytique (A + B> B + C). (A) Une représentation de la porte, journaliste, brins auxiliaires, et des brins de signal utilisé pour les expériences correspondantes simplifiée. Expériences ont été effectuées dans un tampon Tris-acétate 1x-EDTA contenant 12,5 mM Mg 2+ (TAE 1X / Mg 2+). Tous les complexes de grille étaient à 75 nM concentration (1.5x), et des brins auxiliaires étaient à une concentration de 100 nM (2x). Kinetics données pour les portes et les données plasmide dérivé pour portails synthétisés sont présentés dans (B) et (C) (D) plasmide dérivés exposés chiffre d'affaires supérieur portes d'ADN synthétisés lorsque de faibles quantités d'entrée ont été ajoutés. (E) Étendue de fuite. Le diagramme montre le ratio de la fuite finale au signal final (C = 0 B0 / C B0 = 1) au niveau des points d'extrémité (10 h). (Ce chiffre a été modifié depuis 29 Réf.) S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Modèles de grille Séquences Longueur (nt)
JoinAB TCTAGTTCGATCAGAGCGTTATTACCAGTAGTCGATTGCTCAGCTGCTACATTGCTTCTACGAGTCATCCTTCCACCATTGCACCTTAGAGTCCGAATCCTACCATTGCTTAACCGAGTCTCACAACCAGCTGTCATTATGGACTTGACACACAGATTACACGGGAAAGTTGC 173
FORKBC TCTAGTTCGATCAGAGCGTTATTACCAGTAGTCGATTGCTCAGCTGCCATCATAAGAGTCACCATACCCACATTGCCACATCGAGTCCCTTTTCCACCATTGCACCTTAGAGTCCGAATCCTACCATTGCTTAACCGAGTCTCACAACCAGCTGTCATTATGGACTTGACACACAGATTACACGGGAAAGTTGC 194

Tableau 1. Séquences de ndsDNA grille modèles.

porte Brin Longueur du brin inférieur (nt)
JoinAB JoinAB-Bas, <a tb>, <b tr>, <r tq> 87
ForkBC ForkBC-Bas, <i>, <tc c>, <tb b>, <tr r> 108

Tableau 2. Strands comprenant Rejoignez AB et BC Fork. (Ce tableau a été modifié à partir de 29 Réf.)

Domaine Séquence Longueur (nt)
TA CTGCTA 6
tb TTCCAC 6
tc TACCCA 6
tr TCCTAC 6
tq AACCAG 6
un CATTGCTTCTACGAGTCATCC 21
b CATTGCACCTTAGAGTCCGAA 21
c CATTGCCACATCGAGTCCCTT 21
r CATTGCTTAACCGAGTCTCAC 21
je CTGCCATCATAAGAGTCACCA 21
jove_content "fo: keep-together.within-page =" always "fo: keep-with-previous.within-page =". toujours »> Tableau 3 séquences de domaine de niveau pour la mise en œuvre de la réaction chimique A + B -> B + C . (Ce tableau a été modifié depuis 29 Réf.)

Amorce de brin Séquences Longueur (nt)
Amorce-1 AAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAG CGTTATTACCAGTAGTCGATTGC 60
Amorce-1 ACTACTATTTACTAATCCCATTGCGTGTTCTTATT TAATCTGTGTGTCAAGTCCATAATG 60
Amorce-2 AATAAGAACACGCAATGGGATTAGTAAATAGTAGT CGTTATTACCAGTAGTCGATTGC 58
Amorce-2 GCGAAACTAGCTTGTGGTGATATTGTCTCGTGTGT TAATCTGTGTGTCAAGTCCATAATG 60
Amorce-3 ACACACGAGACAATATCACCACAAGCTAGTTTCGC CGTTATTACCAGTAGTCGATTGC 58
Amorce-3 ACATTGTACGCCTAAATCATCAAGAATAATTGTTG TAATCTGTGTGTCAAGTCCATAATG 60
Amorce-4 CAACAATTATTCTTGATGATTTAGGCGTACAATGT CGTTATTACCAGTAGTCGATTGC 58
Amorce-4 GAGCGCAGCGAGTCAGTGAGCGAGGAAGCCTGCAG TAATCTGTGTGTCAAGTCCATAATG 60

Tableau 4. Séquences amorce pour la PCR de ndsDNA grille modèles.

Réactif Volume pour la réaction de 1x (ul)
Haute-copie squelette plasmidique (~ 300 ng / ul) 10
PvuII-HF (20.000 unités / ml) 2
Pstl-HF (20.000 unités / ml) 2
Tampon intelligent 10x Cut 2
H 2 O 4
Volume total 20 d>

Tableau 5. Protocole pour le plasmide épine dorsale de digestion.

Réactif Volume pour la réaction de 1x (ul)
Vecteur d'ADN (~ 50 ng / ul) 1
Fragment amplifié par PCR-1 (~ 50 ng / ul) 1
Fragment amplifié par PCR-2 (~ 50 ng / ul) 1
Fragment amplifié par PCR-3 (~ 50 ng / ul) 1
Fragment amplifié par PCR-4 (~ 50 ng / ul) 1
2x Assemblée Gibson Master Mix 5
Volume total 10
s "fo: keep-with-previous.within-page =" always "> Tableau 6 Protocole pour l'assemblage Gibson..

Réactif Volume pour la réaction de 1x (ul)
L'ADN plasmidique (~ 1 pg / pl de concentration) 1000
PvuII-HF (20.000 unités / ml) 200
Tampon intelligent 10x Cut 133,3
Volume total 1333,3

Tableau 7. Protocole pour portails ndsDNA insérées plasmide digérer l'enzyme de restriction PvuII-HF.

Réactif Volume (pi)
Rejoignez portes (~ 5 ug / ul concentration) 150
Nb.BsrDI (10.000 unités / ml) 300
Tampon intelligent 10x Cut 50
Volume total 500

Tableau 8. Protocole pour rejoindre portes digérer avec entailler enzyme Nb.BsrDI.

Réactif Volume (pi)
Fork portes (~ 5 ug concentration / pi) 150
Nt.BstNBI (10.000 unités / ml) 600
Tampon 10x ONE 3.1 83,3
Volume total 833,3

Tableau 9 Protocole pour fourche portes digérer avec entailler enzyme Nt.BstNBI.

Brin Domaine Séquence Longueur (nt)
JoinAB-Bas tq * r * tr * b * tb * a * ta * CTGGTT GTGAGACTCGGTTAAGCAATG GTAGGA TTCGGACTCTAAGGTGCAATG GTGGAA GGATGACTCGTAGAAGCAATG TAGCAG 87
FORKBC-Bas tq * r * tr * b * c * tb * tc * i * CTGGTT GTGAGACTCGGTTAAGCAATG GTAGGA TTCGGACTCTAAGGTGCAATG GTGGAA AAGGGACTCGATGTGGCAATG TGGGTA TGGTGACTCTTATGATGGCAG 108
<TA a> CTGCTA CATTGCTTCTACGAGTCATCC 27
<tb b> ta une TTCCAC CATTGCACCTTAGAGTCCGAA 27
<tc c> tb b TACCCA CATTGCCACATCGAGTCCCTT 27
<a tb> tc c CATTGCTTCTACGAGTCATCC TTCCAC 27
<b tr> tb CATTGCACCTTAGAGTCCGAA TCCTAC 27
<r tq> b tr CATTGCTTAACCGAGTCTCAC AACCAG 27
<i> r TQ CTGCCATCATAAGAGTCACCA 21
<tr r> je TCCTAC CATTGCTTAACCGAGTCTCAC 27
<i tc> tr r CTGCCATCATAAGAGTCACCA TACCCA 27
<c tr> i TC CATTGCCACATCGAGTCCCTT TCCTAC 27
<c tb> c tr CATTGCCACATCGAGTCCCTT TTCCAC 27
<b tr> c tb CATTGCACCTTAGAGTCCGAA TCCTAC 27
<i TB> b tr CTGCCATCATAAGAGTCACCA TTCCUN C 27
<b tb> i tb CATTGCACCTTAGAGTCCGAA TTCCAC 27
<b tc> b tb CATTGCACCTTAGAGTCCGAA TACCCA 27
<c tr> b tc CATTGCCACATCGAGTCCCTT TCCTAC 27
<b tr> c tr CATTGCACCTTAGAGTCCGAA TCCTAC 27
ROX- <c * tc *> b tr / 56-ROXN / AAGGGACTCGATGTGGCAATG TGGGTA 27
<c> -rq c * tc * CATTGCCACATCGAGTCCCTT / 3IAbRQSp / 21
<tq * r *> - TAMRA CTGGTT GTGAGACTCGGTTAAGCAATG / 36-TAMTSp / 27
RQ- <r> tq * r * / 5IAbRQ / CATTGCTTAACCGAGTCTCAC 21
r

. Tableau 10 séquences de Strand pour mettre en œuvre la réaction chimique A + B -.> B + C (. Ce tableau a été modifié depuis Ref 29)

Réactif Volume (pi) La concentration finale
ROX- <c * * tc> à 100 um 10 10 pM (1x)
<c> -rq à 100 μ; M 13 13 pm (1.3x)
10x TAE avec 125 mM Mg 2+ 10 1x TAE avec 12,5 mM de Mg 2+
H 2 O 67 -
Volume total 100 10 pM (1x)

Tableau 11. Protocole pour l'assemblage Reporter C.

Réactif Volume (pi) La concentration finale
H 2 O 514 -
10x TAE avec 125 mM Mg 2+ 60 1x TAE avec 12,5 mM de Mg 2+
PolyT à 300 μ; M 2 1 pM
Reporter C à 10 pm 9 150 nM (3x)
SDS à 10% 9 0,15%
<tc c> à 5 pm 6 50 nM (1x)
Volume total 600 -

Tableau 12. Protocole pour l'étalonnage de Reporter C. Les volumes fournis ici est pour un volume total de réaction de 600 pi (correspondant à l'utilisation d'une cellule ml de quartz synthétique 0,875), mais peut être réglée à travailler avec des cellules de tailles différentes.

<td> 600
Réactif Volume (pi) Con finalcentration
H 2 O 493 -
10x TAE avec 125 mM Mg 2+ 60 1x TAE avec 12,5 mM de Mg 2+
polyT à 300 um 2 1 pM
Reporter C à 10 pm 9 150 nM (3x)
<i TC> à 100 um 3 10x
<c tb> à 100 um 3 10x
<b tr> à 100 um 3 10x
SDS à 10% 9 0,15%
Fork BC à ~ 1 uM (concentration inconnue) 15 ~ 0.5x
<r tq> à 100 um 3 10x
Volume total -

Tableau 13. Protocole pour l'étalonnage de la fourche avant JC. Les volumes fournis ici est pour un volume total de réaction de 600 pi, mais peut être réglée à travailler avec des cellules de tailles différentes.

Réactif Volume (pi) La concentration finale
H 2 O 407,2 -
10x TAE avec 125 mM Mg 2+ 52,8 12,5 mM de Mg 2+
polyT à 300 um 2 1 pM
Reporter C à 10 pm 9 150 nM (3x)
<i TC> à 10 uM 6 100 nM (2x)
<c tb> à 10 uM 6 100 nM (2x)
<b tr> à 10 uM 6 100 nM (2x)
<tr r> à 10 uM 6 100 nM (2x)
SDS à 10% 9 0,15%
Inscrivez-AB à 1 uM 45 75 nM (1.5x)
Fork BC à 1 uM 45 75 nM (1.5x)
<TA a> à 10 uM 3 50 nM (1x)
<tb b> à 10 uM 3 50 nM (1x)
Volume total 600 -

Tableau 14. Protocole pour une réaction chimique A + B> B + C. Les volumes fournis ici est pour un volume total de réaction de 600 pi, mais peut être réglée à travailler avec des cellules de tailles différentes.

Portes synthétisés Portes Plasmide dérivé
Description Coût Rejoignez portes Portes Fork
PAGE long brin purifié (100 nt; servi que les brins de fond d'une porte) ~ $ 75 Description </ strong> Coût Description Coût
PAGE Short Strand purifiée (~ 30 nt, a servi de brins supérieurs d'une porte) ~ $ 185 Porte modèle ~ 100 $ Porte modèle ~ 100 $
Le total ~ $ 260 Kit d'extraction de plasmide ~ 26 $ Kit d'extraction de plasmide ~ 26 $
Enzyme de restriction (PvuII-HF) ~ 11 $ Enzyme de restriction (PvuII-HF) ~ 11 $
Entailler enzyme (Nt.BsrDI, Rejoignez portes) ~ 29 $ Enzyme entaille (Nt.BstNBI, portes Fork) ~ $ 62
Le total ~ $ 166 Le total ~ 199 $

fo:.. keep-with-previous.within-page = "always"> tableau de comparaison des coûts entre 15 portes dérivées du plasmide et portes synthétisés (. Ce tableau a été modifié depuis Ref 29)

Portes synthétisés Portes Plasmide dérivé
En traitement Le temps de traitement En traitement Le temps de traitement
Recuit 1 h Clonage 5 h
PAGE purification 2 h Extraction des plasmides 2 h
Le total 3 h Deux étapes de digestion enzymatique 0,5 h
Précipitation à l'éthanol
Le total 8,5 heures

Tableau comparatif 16. Traitement de temps entre les portes dérivées du plasmide et portes synthétiques. (Ce tableau a été modifié depuis 29 Réf.)

Discussion

Ce document décrit une méthode pour dériver portes ndsDNA d'ADN plasmidique très pur. En outre, un protocole est présentée pour caractériser la performance de porte en utilisant un essai de cinétique de fluorescence. Les données expérimentales montrent que le système de plasmide dérivé surpasse son homologue synthétique même si le système de synthèse est assemblé à partir des brins purifiés en utilisant une électrophorèse sur gel de Polyacrylamide (PAGE). Probablement, l'amélioration de la performance des portes dérivées du plasmide est principalement due à la très haute pureté de l'ADN biologique. ADN synthétique contient un certain nombre d'erreurs, en particulier des deletions qui se traduisent par des oligonucleotides d'une longueur de tels produits secondaires n-1, et ne sont généralement pas complètement éliminé PAGE ou Chromatographie en phase liquide à haute performance (HPLC) des procédures de purification. Des améliorations similaires à ceux rapportés ici ont également été observées dans une étude précédente d'un amplificateur en épingle à cheveux catalysée qui a utilisé de l'ADN provenant de sources biologiques 21.

(voir la figure 4). D'autre part, dans ces expériences, la plupart des entrées auxiliaires et des brins de l'ADN synthétique et sont donc contenues deletions et mutations. En principe, toutes les entrées et simple brin des brins auxiliaires peuvent également être obtenus à partir d'ADN de phagemide à travers une digestion enzymatique coupure simple brin du génome viral m13 pré-codé 26. Peut-être que la performance du circuit peut être encore améliorée en utilisant ADNsb dérivé du génome bactérien.

Bien que l'utilisation de portes de plasmides dérivés n'a été trouvée pour améliorer les performances du circuit, une analysedes temps de coût et de traitement a révélé que, bien que la production de portes de plasmide dérivé est légèrement meilleur marché (tableau 15), il prend 2-3 fois plus long temps de traitement par rapport à l'assemblage et la purification des portes de oligos de synthèse dans le commerce (tableau 16). Les coûts primaires de portes de plasmides sont dérivés du gène de synthèse et l'utilisation d'enzymes de restriction. Pour 300 pmol de portes (suffisant pour 15 réactions à 30 nM), le coût estimé pour Rejoignez portes est d'environ 170 $ et 200 $ pour Fork portes, la différence de coût étant due à l'utilisation de différentes enzymes entailler. En revanche, la synthèse chimique des brins pour les mêmes coûts de grille autour de 260 $ y compris un supplément de purification PAGE. Le coût principal de l'heure pour les portes dérivées du plasmide est dans la procédure de clonage, qui, tout comme la synthèse d'ADN, peut être confiée à une société de synthèse de gènes. Cependant, une fois assemblées, les portes de plasmides dérivés présentent l'avantage que les plasmides hôtes peuvent facilement être reproduits une peut être stocké sous forme de stocks de glycérol bactériennes. Cela permet de réutiliser les portes à plusieurs reprises.

Pour l'avenir, l'amélioration de la performance des portes dérivées du plasmide pourrait permettre à un plus grand éventail de comportements dynamiques que d'avoir été démontré expérimentalement à ce jour avec l'ADN RRC. Par exemple, la récente 47,48 de travail théorique a suggéré que la répartition spatiale auto-organisés à la macro-échelle peuvent être réalisées avec les ADN RRC à travers un mécanisme de diffusion de réaction. La méthode présentée ici fournit un chemin viable pour la construction des composants moléculaires sous-jacents de ces matériaux d'ADN auto-structuration. Bien que difficile, le développement de morphologies macro-échelle d'une manière programmable aurait des implications importantes dans des domaines allant de la recherche sur les biomatériaux à la médecine régénératrice.

Acknowledgements

Les figures 1, 2, 3, 4, 6, 8 et Tableaux 2, 3, 10, 15, 16 sont modifiés à partir de 29 Réf. Ce travail a été soutenu par la National Science Foundation (NSF-CCF accorder 1.117.143 et 1.162.141 NSF-CCF à GS). Y.-JC a été soutenu par des bourses du gouvernement taiwanais. DTS a été soutenu par le Programme National Science Foundation Graduate Research Fellowship (de GRFP).

Materials

Name Company Catalog Number Comments
Phusion High-Fidelity PCR Master Mix with HF Buffer NEB M0531S
PvuII-HF NEB R3151L
PstI-HF NEB R3140S
Gibson Assembly Master Mix NEB E2611S
Terrific Broth, Modified SIGMA-ALDRICH T0918-250G
QIAprep Spin Miniprep Kit (250) QIAGEN 27106
QIAGEN Hispeed Maxi-prep Kit QIAGEN 12662
Nb.BsrDI NEB R0648L
Nt.BstNBI NEB R0607L
NanoDrop 2000c Thermo Scientific
Double-stranded Genomic Blocks IDT
Horiba Jobin-Yvon Spex Fluorolog-3 Fluorimeter Horiba/Jobin Yvon
Synthetic Quartz Cells  Starna 23-5.45-S0G-5
QIAGEN Gel Extraction Kit QIAGEN 28706
Plasmid Backbones BioBrick E0240-pSB1A2 High copy number plasmid with Ampicillin resistance. Sequence can be found from http://parts.igem.org

DOWNLOAD MATERIALS LIST

References

  1. Zhang, D. Y., Seelig, G. Dynamic DNA nanotechnology using strand-displacement reactions. Nat. Chem. 3, 103-113 (2011).
  2. Krishnan, Y., Simmel, F. C. Nucleic acid based molecular devices. Angew. Chem. Int. Ed. Engl. 50, 3124-3156 (2011).
  3. Zhang, D. Y., Winfree, E. Control of DNA strand displacement kinetics using toehold exchange. J. Am. Chem. Soc. 131, 17303-17314 (2009).
  4. Qian, L., Winfree, E., Bruck, J. Neural network computation with DNA strand displacement cascades. Nature. 475, 368-372 (2011).
  5. Qian, L., Winfree, E. Scaling up digital circuit computation with DNA strand displacement cascades. Science. 332, 1196-1201 (2011).
  6. Zadegan, R. M., Jepsen, M. D., Hildebrandt, L. L., Birkedal, V., Kjems, J. Construction of a fuzzy and boolean logic gates based on DNA. Small. 11, 1811-1817 (2015).
  7. Seelig, G., Soloveichik, D., Zhang, D. Y., Winfree, E. Enzyme-free nucleic acid logic circuits. Science. 314, 1585-1588 (2006).
  8. Zadegan, R. M., et al. Construction of a 4 zeptoliters switchable 3D DNA box origami. ACS Nano. 6, 10050-10053 (2012).
  9. Andersen, E. S., et al. Self-assembly of a nanoscale DNA box with a controllable lid. Nature. 459, 73-76 (2009).
  10. Zhang, D. Y., Hariadi, R. F., Choi, H. M., Winfree, E. Integrating DNA strand-displacement circuitry with DNA tile self-assembly. Nat. Commun. 4, (1965).
  11. Yurke, B., Turberfield, A. J., Mills, A. P., Simmel, F. C., Neumann, J. L. A DNA-fuelled molecular machine made of DNA. Nature. 406, 605-608 (2000).
  12. Green, S. J., Lubrich, D., Turberfield, A. J. DNA hairpins: fuel for autonomous DNA devices. Biophys. J. 91, 2966-2975 (2006).
  13. Venkataraman, S., Dirks, R. M., Rothemund, P. W., Winfree, E., Pierce, N. A. An autonomous polymerization motor powered by DNA hybridization. Nat. Nanotechnol. 2, 490-494 (2007).
  14. Green, S. J., Bath, J., Turberfield, A. J. Coordinated chemomechanical cycles: a mechanism for autonomous molecular motion. Phys. Rev. Lett. 101, 238101 (2008).
  15. Omabegho, T., Sha, R., Seeman, N. C. A bipedal DNA Brownian motor with coordinated legs. Science. 324, 67-71 (2009).
  16. Turberfield, A. J., et al. DNA fuel for free-running nanomachines. Phys. Rev. Lett. 90, 118102 (2003).
  17. Dirks, R. M., Pierce, N. A. Triggered amplification by hybridization chain reaction. Proc. Natl. Acad. Sci. U. S. A. 101, 15275-15278 (2004).
  18. Seelig, G., Yurke, B., Winfree, E. Catalyzed relaxation of a metastable DNA fuel. J. Am. Chem. Soc. 128, 12211-12220 (2006).
  19. Zhang, D. Y., Turberfield, A. J., Yurke, B., Winfree, E. Engineering entropy-driven reactions and networks catalyzed by DNA. Science. 318, 1121-1125 (2007).
  20. Yin, P., Choi, H. M., Calvert, C. R., Pierce, N. A. Programming biomolecular self-assembly pathways. Nature. 451, 318-322 (2008).
  21. Chen, X., Briggs, N., McLain, J. R., Ellington, A. D. Stacking nonenzymatic circuits for high signal gain. Proc. Natl. Acad. Sci. U. S. A. 110, 5386-5391 (2013).
  22. Phillips, A., Cardelli, L. A programming language for composable DNA circuits. J. R. Soc. Interface. 6, Suppl 4. S419-S436 (2009).
  23. Lakin, M. R., Youssef, S., Polo, F., Emmott, S., Phillips, A. Visual DSD: a design and analysis tool for DNA strand displacement systems. Bioinformatics. 27, 3211-3213 (2011).
  24. Lakin, M. R., Youssef, S., Cardelli, L., Phillips, A. Abstractions for DNA circuit design. J. R. Soc. Interface. 9, 470-486 (2012).
  25. Zhang, D. Y., Winfree, E. Robustness and modularity properties of a non-covalent DNA catalytic reaction. Nucleic Acids Res. 38, 4182-4197 (2010).
  26. Ducani, C., Kaul, C., Moche, M., Shih, W. M., Hogberg, B. Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides. Nat. Methods. 10, 647-652 (2013).
  27. Lin, C., et al. In vivo cloning of artificial DNA nanostructures. Proc. Natl. Acad. Sci. U. S. A. 105, 17626-17631 (2008).
  28. Bhatia, D., et al. Icosahedral DNA nanocapsules by modular assembly. Angew. Chem. Int. Ed. Engl. 48, 4134-4137 (2009).
  29. Chen, Y. J., et al. Programmable chemical controllers made from DNA. Nat. Nanotechnol. 8, 755-762 (2013).
  30. Arkin, A., Ross, J. Computational functions in biochemical reaction networks. Biophys. J. 67, 560-578 (1994).
  31. Érdi, P., Tóth, J. Mathematical models of chemical reactions: theory and applications of deterministic and stochastic models. Manchester University Press. (1989).
  32. Magnasco, M. O. Chemical kinetics is Turing universal. Phys. Rev. Lett. 78, 1190 (1997).
  33. Oishi, K., Klavins, E. Biomolecular implementation of linear I/O systems. IET Syst. Biol. 5, 252-260 (2011).
  34. Senum, P., Riedel, M. Rate-independent constructs for chemical computation. PLoS One. 6, (2011).
  35. Soloveichik, D., Cook, M., Winfree, E., Bruck, J. Computation with finite stochastic chemical reaction networks. Natural Computing. 7, 615-633 (2008).
  36. Soloveichik, D., Seelig, G., Winfree, E. DNA as a universal substrate for chemical kinetics. Proc. Natl. Acad. Sci. U. S. A. 107, 5393-5398 (2010).
  37. Tyson, J. J., Chen, K. C., Novak, B. Sniffers, buzzers, toggles and blinkers: dynamics of regulatory and signaling pathways in the cell. Curr. Opin. Cell. Biol. 15, 221-231 (2003).
  38. Cardelli, L. Two-domain DNA strand displacement. Math. Struct. Comput. Sci. 23, 247-271 (2013).
  39. Angluin, D., Aspnes, J., Eisenstat, D. A simple population protocol for fast robust approximate majority. Distrib. Comput. 21, 87-102 (2008).
  40. Cardelli, L., Csikasz-Nagy, A. The cell cycle switch computes approximate majority. Sci. Rep. 2, 656 (2012).
  41. Zadeh, J. N., et al. NUPACK: Analysis and design of nucleic acid systems. J. Comput. Chem. 32, 170-173 (2011).
  42. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. J. Vis. Exp. (2012).
  43. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods. 6, 343-345 (2009).
  44. Froger, A., Hall, J. E. Transformation of plasmid DNA into E. coli using the heat shock method. J. Vis. Exp. e253 (2007).
  45. Lessard, J. C. Transformation of E. coli via electroporation. Methods Enzymol. 529, 321-327 (2013).
  46. Nasri, M., Thomas, D. Alteration of the specificity of PvuII restriction endonuclease. Nucleic Acids Res. 15, 7677-7687 (1987).
  47. Dalchau, N., Seelig, G., Phillips, A. Computational design of reaction-diffusion patterns using DNA-based chemical reaction networks. DNA Computing and Molecular Programming. 84-99 (2014).
  48. Scalise, D., Schulman, R. Designing modular reaction-diffusion programs for complex pattern formation. Technology. 2, 55-66 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics