تدفق نمط تلفيق إرشادية للعالي الكثافة الباركود الأجسام المضادة ميكروأري

Chemistry

Your institution must subscribe to JoVE's Chemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

ويحدد هذا البروتوكول تصنيع على نطاق واسع، ثنائية الأبعاد DNA أو الأجسام المضادة مجموعة المضاعفة، مع التطبيقات المحتملة في الخلية دراسات الإشارات وكشف العلامات البيولوجية.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Ramirez, L. S., Wang, J. Flow-pattern Guided Fabrication of High-density Barcode Antibody Microarray. J. Vis. Exp. (107), e53644, doi:10.3791/53644 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

وقد استخدمت المجهرية الأجسام المضادة على نطاق واسع في الدراسات البروتين لعقود من الزمن لدراسة وجود البروتينات المستهدفة، بما في ذلك المؤشرات الحيوية البروتين 1-3. على الرغم من أن هذا المجال يواجه حاليا تحديات كبيرة من تقنيات عالية الإنتاجية الأخرى مثل مطياف الكتلة (MS)، لا يزال هناك الكثير من الغرفة لفائدة ميكروأرس الأجسام المضادة، وذلك أساسا بسبب هذه الأجهزة تحمل تفسير البيانات بسيطة وسهلة واجهة مع فحوصات أخرى. في السنوات الأخيرة، وقد وفرت دمج المجهرية في السقالات رقاقة ميكروأري الأجسام المضادة فرصة جديدة للازدهار 4-7. على سبيل المثال، تم استخدام ميكروأري الباركود دمجها في رقاقة وحيدة الخلية في دراسات الاتصالات الخلوية 8،9. هذه التقنية لها مزايا مميزة على غيرها من التكنولوجيات ميكروأري المتاحة. ويضم عناصر مجموعة في 10-100 ميكرون، أصغر بكثير من نموذجي 150 ميكرون حجم المستخدمة في elemen ميكروأري التقليديةنهاية الخبر. ويتحقق بناء عناصر مجموعة أصغر باستخدام نهج تدفق الزخرفة المنهجية، وهذا يؤدي إلى ميكروأرس المدمجة التي يمكن الكشف عن البروتينات وحيدة الخلية تفرز الخلايا والبروتينات. ميزة أخرى هي استخدام بسيطة، خالية من أداة الإعداد. هذا مهم بشكل خاص، لأن معظم المعامل والشركات الصغيرة قد لا تكون قادرة على الوصول إلى المرافق الأساسية ميكروأري. هذا الباركود المجهرية الضد تشمل الخصائص المتطورة مقايسة الإنتاجية، ويمكن استخدامها لإجراء فحوصات المضاعفة كبير على الخلايا وحيدة حين تحقيق حساسية عالية وخصوصية مقارنة مع تلك التي التقليدي المرتبط بالإنزيم شطيرة الفحص المناعي (ELISA 8). وقد وجدت هذه التقنية العديد من التطبيقات في الكشف عن البروتينات من ورم أرومي 11/09، وخلايا T 12، وتعميم الخلايا السرطانية 13. بدلا من ذلك، ميكروأرس DNA الباركود وحده استخدمت في تحديد المواقع بدقة من الخلايا العصبية والخلايا النجمية لميميكجي التجميع في الجسم الحي من أنسجة المخ 14.

ويركز هذا البروتوكول فقط على الخطوات التجريبية وكتل تراكم من ثنائي الأبعاد (2-D) الباركود الأجسام المضادة ميكروأري التي لها تطبيقات محتملة في الكشف عن المؤشرات الحيوية في عينات الموائعية وفي زنازين انفرادية. وتستند هذه التقنية على عنونة احد الذين تقطعت بهم السبل، أحادية البعد (1-D) ميكروأري DNA شيدت باستخدام [أليغنوكليوتيد المتعامدة التي يتم نمط مكانيا على ركائز الزجاج. يتم تشكيل نمط 1-D عندما تستخدم قنوات تدفق موازية في خطوة تدفق الزخرفة، ويبدو مثل هذا النمط كما عصابات منفصلة مماثلة بصريا إلى 1-D رمز المنتج العالمي (UPC) الباركود. بناء 2-D س م) الأجسام المضادة مجموعة - يذكرنا 2-D الاستجابة السريعة (QR) رمز المصفوفة - يحتاج استراتيجيات الزخرفة أكثر تعقيدا، ولكن يسمح لتجميد الأجسام المضادة في ارتفاع الكثافة 8،15. تلفيقيتطلب خطوتين الزخرفة DNA، مع النمط الأول عمودي على الثانية. نقاط تقاطع هذه الأنماط اثنين تشكل عناصر م ن خ المصفوفة. عن طريق اختيار استراتيجي تسلسل واحد الذين تقطعت بهم السبل الحمض النووي (ssDNA) المستخدمة في تدفق الزخرفة، يتم تعيين كل عنصر في مجموعة وإعطاء عنوان محدد. هذه الإشارة المكانية اللازمة في التمييز بين الإشارات مضان على الشريحة ميكروأري. تحويل مجموعة ssDNA في صفيف الأجسام المضادة من خلال إدراج تقارن-DNA الأجسام المضادة التكميلية، وتشكيل منصة تسمى مكتبة الأجسام المضادة ترميز الحمض النووي (DEAL 16).

يصف هذا البروتوكول الفيديو الخطوات الرئيسية في خلق صفائف nxm الأجسام المضادة والتي تشمل إعداد polydimethylsiloxane (PDMS) قوالب الباركود، وتدفق الزخرفة ssDNA في اثنين من التوجهات، وإعداد الأجسام المضادة النوكليوتيد تقارن DEAL، وتحويل مجموعة 3 × 3 DNA إلى 3× 3 الضد مجموعة.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

تحذير: العديد من المواد الكيميائية المستخدمة في هذا البروتوكول هي المهيجات وخطرة في حالة ملامسة الجلد. استشارة بيانات سلامة المواد (MSDS) وارتداء معدات الوقاية الشخصية المناسبة قبل تنفيذ هذا البروتوكول. الحل البيرانا المستخدمة في الخطوة (1.1.1) غير ضارة للغاية ويجب بإضافة بيروكسيد ببطء إلى حامض مع الإثارة مستعدة. التعامل مع هذا الحل مع الحذر الشديد في غطاء الدخان. استخدام حماية العين المناسبة والقفازات المقاومة للحمض. Trimethylchlorosilane (TMCS) هو تآكل والكيميائية القابلة للاشتعال يستخدم في خطوة اختيارية بعد (1.1.6). التعامل مع هذه المادة الكيميائية في غطاء الدخان.

ملاحظة: إجراء تصنيع الشرائح الباركود وإجراءات تدفق الزخرفة حرجة في غرفة نظيفة للحد من التلوث عن طريق الجسيمات. قد يمنع جزيئات الغبار الموانئ وmicrochannels قوالب PDMS وتتداخل مع تدفق الزخرفة.

1. البناء للdimensiona واحدةل DNA الباركود الشرائح

  1. إعداد سيد SU-8 لأنماط تدفق الباركود
    ملاحظة: يتم إنشاء رسومات لأنماط تدفق عمودي (الشكل 1A-B) باستخدام (CAD) برامج التصميم بمساعدة الكمبيوتر. يتم تقديم هذه الأنماط على الضوئية الرئيسية الكروم. مناطق شفافة من القناع تتوافق مع ملامح سيد SU-8.
    1. تنظيف رقاقة السيليكون (100 مم) بدقة في خليط من 3 H 2 SO 4: 1 30٪ H 2 O 2 (حل سمكة البيرانا) تسخينها إلى 96 درجة مئوية. غسل رقاقة مع الماء منزوع الأيونات وايزوبروبيل، تليها تجفيف بمسدس ضربة النيتروجين.
    2. صب حوالي 4 مل من SU-8 2025 مقاوم الضوء على الرقاقة. استخدام تدور المغطي للبرمجة لنشر موحد مقاوم الضوء على الرقاقة لمدة 10 ثانية في 500 دورة في الدقيقة، ثم 30 ثانية في 3000 دورة في الدقيقة. وهذا يخلق طبقة مقاومة للضوء مع سمك ~ 25 ميكرون. تدريجيا تسمح الغزل لإبطاء قبل أن تتوقف - وهذا هو إلى maintain حتى الطلاء على سطح الرقاقة ل.
    3. خبز الرقاقة المغلفة على موقد لمدة 1 دقيقة عند 65 درجة مئوية، ثم لمدة 5 دقائق عند 95 ° C. هذه الخطوة تسمح للطلاء ليصلب. بارد لRT لمدة 5 دقائق.
    4. وضع قناع الكروم (الشكل 1C) على معطف مقاومة للضوء. كشف ملامح قناع للضوء القريب للأشعة فوق البنفسجية (350-400 نانومتر، والطاقة التعرض 150-160 ميغا جول / سم 2) لمدة 20 ثانية.
      ملاحظة: التصميم على القناع الكروم يحتوي على 20 قنوات، كل منها 20 ميكرون واسع مع 50 ميكرون الملعب. القنوات يتم لف من طرف واحد من نمط إلى الطرف الآخر. وإجمالا، تغطي القنوات 20 منطقة مستطيلة بطول ~ 40 ملم وبعرض ~ 20 ملم. ويحيط كل قناة من قبل اثنين من الميزات دائرية والتي تتوافق إلى مدخل ومخرج. المداخل والمخارج قابلة للتبادل.
    5. خبز الرقاقة تعرض على موقد لمدة 5 دقائق عند 95 ° C. بارد لRT تدريجيا.
    6. تزج الرقاقة في SU-8 المطور مع الإثارةلمدة 5 دقائق. غسل رقاقة مع جزء صغير من جديد SU-8 المطور، تليها الإيزوبروبيل. تجفيف الرقاقة باستخدام بندقية ضربة النيتروجين. من الصعب خبز الرقاقة على موقد C 200 درجة لمدة 30 دقيقة، والسماح للرقاقة لتبرد تدريجيا إلى RT.
      ويمكن تنفيذ التنمية خارج لفترة أطول إذا لوحظ فيلم أبيض بعد الغسيل في هذه الخطوة: مذكرة.
      اختياري: Silanize سيد SU-8 عن طريق تعريضها لبخار trimethylchlorosilane في طبق بيتري مغلقة لمدة 10 دقيقة.
  2. إعداد القالب الباركود PDMS
    1. الجمع بين 40.0 غرام سيليكون قاعدة المطاط الصناعي مع 4.0 ز وكيل المعالجة. يحرك الخليط prepolymer بقوة لمدة 10 دقيقة. ديغا لمدة 20 دقيقة تحت فراغ.
      ملاحظة: كقاعدة عامة، استخدم 10: 1 (قاعدة: وكيل علاج) نسبة الجماعية.
    2. صب prepolymer في طبق بتري تحتوي على رقاقة السيليكون مع سيد SU-8 من نمط الباركود. ارتفاع مزيج PDMS يجب أن يكون حوالي 7.5 ملم فما فوق. ديغا الخليط في بيترط طبق للمرة الثانية لإزالة أي فقاعات المتبقية، ثم يخبز الخليط لمدة 1 ساعة على 75 درجة مئوية للسماح PDMS لعلاج.
      ملاحظة: من المهم للحفاظ على سمك ما يكفي من بلاطة PDMS في ~ 7.5 مم أو أعلى لتجنب إضافة الكثير من التوتر على السندات PDMS من الزجاج على ادراج دبابيس / الأنابيب من خلال ثقوب في القالب PDMS في الخطوة (1.3.3.1)
    3. باستخدام مشرط، وقطع بعناية حول منطقة بلاطة PDMS الذي يحتوي على ميزات العفن الباركود وقشر لوح من الرقاقة.
    4. تقليم حواف لوح لتحقيق الشكل المطلوب من العفن الباركود PDMS. لكمة ثقوب 20 (1.0 مم) من خلال القالب باستخدام لكمة خزعة مع الغطاس. تأكد من أن الثقوب تتماشى مع ميزات دائرية من نمط الباركود. هذه الثقوب بمثابة مداخل ومنافذ البيع.
  3. الزخرفة ذات بعد واحد من بولي-L-ليسين (PLL)
    1. إزالة أي غبار على سطح شريحة الزجاج المطلي بولي-L-يسين باستخدام بندقية ضربة النيتروجين. أتاكح العفن PDMS إلى شريحة زجاجية نظيفة. تأكد من أن حواف القالب وشريحة والانحياز.
    2. تخبز لمدة 1.5 ساعة عند 75 ° C لتعزيز العلاقة بين القالب PDMS وشريحة PLL المغلفة. وفي الوقت نفسه، وإعداد 20 قطعة من مرونة أنابيب البولي ايثيلين (3- إلى قطع 4 بوصة، مع قطرها الداخلي 0.5 ملم وقطرها الخارجي من 1.5 ملم).
      ملاحظة: عدد من قطع أنابيب مساويا لعدد من مداخل في قالب الباركود PDMS. يخدم أنابيب لزوجين من القنوات على القالب الباركود PDMS إلى خزان غاز النيتروجين مجهزة منظم الضغط.
    3. إلى نهاية واحدة من كل قطعة من الأنابيب، وإرفاق الفولاذ المقاوم للصدأ دبوس جوفاء (1 مم). نضح العقيمة التي تمت تصفيتها بولي-L-يسين حل من خلال دبوس، حتى يمتلئ 1 سم على الأقل من الأنبوب مع الحل.
      1. ربط المسامير (متصلة مليئة حل الأنابيب) إلى مداخل القالب الباركود PDMS (الشكل 1E). نعلق على الطرف الآخر من الأنابيب لدبابة النيتروجين الضغط ينظم انشاء. يسمح الحل لتتدفق من خلال القالب باستخدام مجموعة ضغط من 0.5-1 رطل لمدة لا تقل عن 6 ساعة.
        ملاحظة: يرجى الرجوع إلى الخطوة (1.3.3) لجميع إجراءات تدفق الزخرفة.
  4. الزخرفة ذات بعد واحد من ssDNA 14
    ملاحظة: يتم إعداد الفوسفات المالحة (PBS) مخزنة المستخدمة في الخطوات اللاحقة من 137 ملي كلوريد الصوديوم، و 10 ملي نا 2 هبو و 2 ملي KH 2 PO 4. الرقم الهيدروجيني للالعازلة هي 7.4.
    1. إعداد 2 مم مكرر (sulfosuccinimidyl) suberate (BS3) حل في برنامج تلفزيوني. إعداد 300 ميكرومتر حلول من A، B، C وssDNA (5'-أمين تعديل، 80 النيوكليوتيدات) في برنامج تلفزيوني أو الماء عالى النقاء.
      ملاحظة: استخدام الحل BS3 في غضون نحو 30 دقيقة بعد إعداد لأن N -hydroxysuccinimide استر يخضع بسهولة المائي.
    2. الجمع بين 2.5 ميكرولتر من 300 ميكرومتر A، B، C أو ssDNA مع 2.5 ميكرولتر من 2 مكررا ملي (sulfosuccinimتصنف موضوع ملائم) suberate في برنامج تلفزيوني لكل قناة. A، B، C وDNA لقنوات 1، 2، و 3، على التوالي. يتم تطبيق هذا النظام أيضا إلى مجموعات المتبقية من 3 قنوات (الشكل 2A).
    3. نفذ الخطوة (1.3.3). هذه المرة، نضح الحلول BS3 / DNA 5 ميكرولتر من خلال دبابيس الفولاذ المقاوم للصدأ وإلى أنابيب البولي ايثيلين، ثم زوجين العفن PDMS إلى مصدر النيتروجين. السماح للحل BS3 / DNA لتتدفق من خلال القالب الباركود لحوالي 40 دقيقة أو حتى في تمتلئ القنوات.
    4. وقف تدفق تمتلئ مرة واحدة كل القنوات، ثم احتضان الحل BS3 / DNA في الباركود في RT لمدة 2 ساعة. لا تسمح الحل لتجف. يخبز القالب PDMS مع شريحة الباركود المرفق لمدة 1 ساعة على 75 درجة مئوية.
      ملاحظة: لتسهيل التوافق في لاحقة الخطوات التدفق الزخرفة، قد تكون الخطوط العريضة لحواف نمط القناة على الشريحة الباركود. يتم ذلك عن طريق الخدش بعناية سطح الزجاج باستخدام scrib الماسه لتوليد علامات التوافق على الجزء السفلي من شريحة زجاجية. المحاذاة في مراحل لاحقة من بروتوكول يمكن فحص تحت المجهر.
    5. إزالة العفن PDMS من الشريحة الباركود. غسل الشريحة بلطف مع 0.01٪ SDS مرة واحدة وثلاث مرات مع الماء عالى النقاء.
      1. تجف الشريحة الباركود باستخدام الدوار شريحة المجهر. تخزين الشريحة الباركود في نظيفة 50 مل أنبوب الطرد المركزي لاستخدامها لاحقا.

2. التحقق من نمط واحد الابعاد على الشريحة الباركود

ملاحظة: يمكن أيضا أن تتكيف هذا البروتوكول المصادقة لاستخدامه في تقييم نوعية لاحقة الخطوات الزخرفة التدفق.

  1. حجب الشريحة
    1. إعداد 1٪ ألبومين المصل البقري (BSA) في برنامج تلفزيوني. تصفية هذا الحل من خلال مرشح حقنة 0.45 ميكرون قبل الاستخدام. باستخدام طرف جل التحميل، وتطبيق 50 ميكرولتر من 1٪ محلول BSA إلى حافة واحدة من الشرائح الباركود.
    2. احتضان 1٪ BSA solutايون لمدة 1 ساعة على RT.
  2. الحضانة مع Cyanine 3 (CY3) -conjugated DNA التكميلي
    1. إعداد كوكتيل من A C وأليغنوكليوتيد]' مترافق إلى CY3 في نهاية واحدة. تسلسل A C و"هي مكملة لA، C و، على التوالي. تركيز العمل للDNA CY3 0.05 ميكرومتر في 0.1٪ BSA.
    2. إزالة الحل BSA من الشريحة من قبل pipetting، ثم تطبيق 30 ميكرولتر من الحل كوكتيل DNA على نفس حافة الشريحة. احتضان كوكتيل CY3-DNA على الشريحة في RT لمدة 1 ساعة. تنفيذ هذه الخطوة الحضانة في الظلام لحماية شاردة CY3 من photobleaching من.
  3. تحليل كثافة مضان
    1. ماصة من كوكتيل CY3-DNA وغسل الشريحة في 1٪ BSA، PBS، وأخيرا في برنامج تلفزيوني المخفف (1 عالفن PBS مع 50 أجزاء عالى النقاء الماء). تجف الشريحة باستخدام الدوار.
    2. مراقبة مضان (الشكل 2B) باستخدام مجهر مضان أو ماسح ضوئي ميكروأري. عند استخدام ماسح ضوئي ميكروأري، تعيين الطول الموجي انبعاث الليزر ل532 نانومتر، وحجم البكسل في 5 ميكرون، أنبوب مضخم (PMT) مكاسب في 450 والطاقة بنسبة 15٪.

3. تصنيع صفيف 2-الأبعاد (3X3) DNA 14

  1. إعداد القالب الباركود PDMS
    1. أداء الإجراء (1.1) لبناء SU-8 رئيسي آخر، ولكن هذه المرة استخدام قناع الكروم مع نمط تدفق عمودي على أن من أول تصميم. أداء الإجراء (1.2) لبناء العفن PDMS جديد مع نمط عمودي.
  2. ثنائية الأبعاد الزخرفة تدفق ssDNA
    1. لمجموعة 3 × 3، وإعداد 150 ميكرومتر الحلول الأسهم من A'-I، B '، الجزء الثاني، C'والثاني والثالث، A'-IV، B' الخامس، C'الى السادس، A'السابع، B"DNA -viii، وC'-التاسع في 3٪ BSA / برنامج تلفزيوني. هذه أليغنوكليوتيد بمثابة "تسلسل سد" (الشكل 2A). الجمع بين الحلول النوكليوتيد (حلول 1-3) هذه أن تركيز العمل هو 50 ميكرومتر لكل النوكليوتيد. استخدام دليل الواردة في الجدول 1.
    2. تتدفق 3٪ BSA / PBS عرقلة الحل في جميع القنوات 20 لمدة 1 ساعة في 0.5-1 رطل.
    3. حلول تدفق 1، 2، و 3 إلى قنوات 1، 2، و 3، على التوالي. اتباع هذا النظام لمجموعات لاحقة من 3 قنوات. عادة ما يتم تدفق في حوالي 40 دقيقة. احتضان الحلول DNA في RT لمدة 2 ساعة للسماح للDNA لهجن.
    4. تتدفق 3٪ BSA / PBS عرقلة الحل في جميع القنوات 20 لمدة 1 ساعة في 0.5-1 رطل لإزالة DNA الغير مهجنة. تقشر بلاطة PDMS، وغسل الناتجة الشريحة ميكروأري الحمض النووي عن طريق غمس شريحة زجاجية إلى 3٪ BSA / PBS مرة واحدة وPBS مرتين، تليها المخفف PBS (1 جزء PBS و 50 أجزاء من الماء عالى النقاء). دراي الشريحة باستخدام الدوار شريحة المجهر.
    5. تنفيذ الخطوة الثانية التحقق من صحة (الشكل 2C) مماثلة لتلك التي في القسم 2. استخدام أليغنوكليوتيد] ط 'إلى التاسع "التي هي CY3 مترافق. تخزين مجموعة الشرائح 3 × 3 في أنبوب الطرد المركزي 50 مل لاستخدامها لاحقا.
      ملاحظة: يمكن تخزين متطورة للحمض النووي في RT في مجفف لمدة شهور.

4. تحويل الحمض النووي صفيف 3 × 3 في صفيف الأضداد

  1. إعداد الأجسام المضادة النوكليوتيد (DEAL) تقارن
    1. إعداد الحلول من 200 ملي succinimidyl-4-formylbenzoate (S-4FB) و 40 ملي succinimidyl-6-hydrazinonicotinamide (S-HyNic) في اللامائية N، N -dimethylformamide (DMF).
    2. إعداد ما يصل إلى 7 حلول منفصلة من الأجسام المضادة القبض على (1 ملغ / مل) في برنامج تلفزيوني.
      ملاحظة: إذا كانت الحلول الأسهم الضد تحتوي على الصوديوم أزيد كابح الجراثيم، نفذ الصرف عازلة مع PBS باستخدام تدور تحلية جolumns مع 7 كيلو دالتون الوزن الجزيئي قطع (MWCO).
    3. إعداد منفصلة 400 ميكرومتر حلول ط '، والثاني'، الثالث، الرابع، الخامس، السادس، السابع وDNA ". تعيين كل التقاط الأجسام المضادة لتسلسل قليل النوكليوتيد واحد. الجمع بين 40 ميكرولتر من 400 ميكرومتر DNA مع 12.25 ميكرولتر من DMF في أنابيب microcentrifuge وتدور باستمرار لتخلط جيدا.
      1. على كل حل DNA / DMF، إضافة 2.3 ميكرولتر من 200 ملي S-4FB في DMF. مقابل كل 100 ميكروغرام من التقاط الأجسام المضادة، إضافة 2.25 ميكرولتر من 40 ملي S-HyNic في DMF.
    4. احتضان الضد / S-HyNic وDNA / S-4FB حلول لمدة 4 ساعة على RT.
    5. استعدادا للتفاعل اقتران-DNA الأجسام المضادة، وإعداد الأعمدة تدور تحلية جديدة (واحد لكل حل DNA واحد لكل الأجسام المضادة) من خلال غسلها مع العازلة سيترات في درجة الحموضة 6.
    6. بعد 4 ساعات من الحضانة، نفذ الصرف عازلة لكل الأجسام المضادة / S-HyNic وحل DNA / S-4FB. الجمع بين S-4FB، مترافق السابع "مع تقارن الضد-S-HyNic. احتضان خلطات لمدة 2 ساعة على RT.
    7. احتضان رد فعل O / N عند 4 درجات مئوية.
  2. تنقية الأجسام المضادة النوكليوتيد (DEAL) تقارن
    ملاحظة: لتنقية تقارن الأجسام المضادة النوكليوتيد، أداء سريع البروتين اللوني السائل (FPLC) على نظام FPLC قياسي مجهزة عمود GL Superose 6 10/300.
    1. تعيين الطول الموجي للكشف عن الأشعة فوق البنفسجية من نظام FPLC إلى 280 نانومتر. استخدام تدفق isocratic من برنامج تلفزيوني (الرقم الهيدروجيني 7.4) في 0.3 مل / دقيقة لفصل تقارن الأجسام المضادة قليل النوكليوتيد من S-4FB-DNA الزائد.
    2. تجميع الكسور التي تحتوي على المكورات والتركيز الكسور إلى وحدة تخزين 150 ميكرولتر باستخدام مرشحات تدور مع 10 كيلو دالتون MWCO.
  3. الزخرفة ثنائية الأبعاد من الأجسام المضادة
    1. إعداد قالب PDMS آخر مع microchambers أو الآبار الصغرى لناجي الإجراءات تلفيق في الخطوة (1.2). قد يحتوي القالب PDMS ميكروليتر إلى آبار نانولتر لالمناعية.
      ملاحظة: للكشف عن العلامات البيولوجية عام في عينات الموائعية، تزاوج العفن PDMS مع آبار متعددة مع الشريحة مجموعة. ملامح القالب PDMS تعتمد على نظام قيد الدراسة. على سبيل المثال، والكشف عن البروتينات من التجارب خلية واحدة لا يمكن أن يؤديها مع قالب PDMS تحتوي على microchambers مع وحدات التخزين 0.15-NL.
    2. (اختياري) العنوان العفن PDMS إلى البلازما تنظيف (18 W) لمدة 1.5 دقيقة لتقديم محبة للماء على سطح منقوشة. قبل تنظيف البلازما، واستخدام شريط لاصق لمنع جميع الأسطح الأخرى التي سيتم المستعبدين مباشرة إلى مجموعة الشرائح 3 × 3.
      ملاحظة: الخطوة (4.3.2) هو اختياري ولكن عادة ما يتم إجراء عندما يكون القصد القالب PDMS لاستخدامها في التجارب خلية واحدة.
    3. تزاوج العفن PDMS مع مجموعة الشرائح 3 × 3، ثم منع الانزلاق مع 1٪ BSA في برنامج تلفزيوني. احتضان لمدة 1 ساعة على RT. Meanwhiجنيه، وإعداد الكوكتيل (200 الحجم النهائي ميكرولتر) من تقارن الأجسام المضادة قليل النوكليوتيد. تركيز عمل كل المترافقة هو 10 ميكروغرام / مل في 1٪ BSA / برنامج تلفزيوني.
    4. إضافة كوكتيل الضد النوكليوتيد، ثم احتضان لمدة 1 ساعة على 37 درجة مئوية للسماح شاردة قليل النوكليوتيد من تقارن لهجن مع وجود بقع محددة على 3 × 3 المصفوفات، وبالتالي تحويل مجموعة الحمض النووي لمجموعة الأجسام المضادة.
    5. كرر الخطوة (3.2.4) لتنظيف وتجفيف الشريحة. ويمكن تحقيق أعلى حساسية إذا تم استخدام مجموعة الأجسام المضادة فورا. التخزين لفترات طويلة قد يؤدي إلى فقدان الحساسية.
  4. الكشف عن البروتينات
    1. إعادة تشكيل البروتينات المؤتلف أو إعداد عينة الخلايا التي تمت تصفيتها.
    2. تتزاوج ميكروأري مع رقاقة مصممة خصيصا، ومنع السطح مع 3٪ BSA في برنامج تلفزيوني لمدة 1 ساعة. ثم إزالة الحل BSA، وتطبيق العينات واحتضان لمدة 2 ساعة.
    3. يغسل العينات باستخدام 3٪ BSA في برنامج تلفزيوني ثلاث مرات، وهود ثم إضافة الأجسام المضادة كشف بتركيز المقدمة من ورقة البيانات المنتج. احتضان لمدة 2 ساعة.
    4. يغسل الأجسام المضادة الكشف عن طريق 3٪ BSA في برنامج تلفزيوني ثلاث مرات، ثم قم بإضافة Cyanine 5 (Cy5) -streptavidin في 1 ميكروغرام / مل، تليها الحضانة لمدة 1 ساعة.
    5. كرر الخطوة (3.2.4) لتنظيف وتجفيف الشريحة للمسح الضوئي.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

ووضعت التصاميم لPDMS قوالب (الشكل 1A-1B) باستخدام برنامج CAD (أوتوكاد). تصميمين أظهرت قنوات ميزة لتنميط تدفق، واحدة الأفقي والرأسي واحد. أجزاء اليسار واليمين من كل تصميم متناظرة. أي منهما يمكن أن يكون مداخل أو مخارج. كل واحد من 20 قناة والمتعرجة واحدة من نهاية كل وسيلة إلى الطرف الآخر. طبعت كل تصميم على الضوئية الرئيسية الكروم (الشكل 1C). يظهر ملفقة SU-8 رئيسي على الرقاقة في الشكل 1D. لتسهيل تدفق الزخرفة من PLL أو DNA، واقترن العفن PDMS إلى تدفق غاز النيتروجين انشاء (الشكل 1E).

هناك ثلاث خطوات تدفق الزخرفة المستخدمة في هذا البروتوكول. الخطوة الأولى يشل PLL على الركيزة الزجاج، في حين أن الخطوات اللاحقة على حد سواء تقديم حلول قليل النوكليوتيد. في الجدول 1، وoligonucleتعطى التراكيب otide من حلول 1-3. تركيز عمل كل النوكليوتيد 50 ميكرومتر والحجم الكلي للكل حل هو 39 ميكرولتر. تم إعداد هذه الحلول من خلال الجمع بين 13 ميكرولتر من كل حل الأسهم النوكليوتيد (150 ميكرومتر).

وحدات متطورة للحمض النووي نمط هي المتكررة والمجاورة عبر شريحة زجاجية كاملة. لمدة 3 × 3 المجهرية، الحد الأقصى لكثافة حوالي 400،000 البقع على شريحة واحدة الزجاج. جنبا إلى جنب مقارنة مع ميكروأري DNA التجاري تكشف أن التكنولوجيا لدينا حوالي 5 مرات أكثر حساسية عند الربط CY3 الموسومة السلطات الوطنية المعينة التكميلية. السلطات الوطنية المعينة نمط موحدة نسبيا مع ~ 5٪ تباين عبر تكرار متعددة. تلك الميزات وعد القدرة الكمي عالية من التكنولوجيا لدينا عند قياس محتويات البروتين من العينات البيولوجية. بالإضافة إلى ذلك، التعامد من السلطات الوطنية المعينة في تركيبة مع تصميم قناة التدفق تقدم flexibiliتاي من الزخرفة في مجموعة متنوعة من الأشكال الهندسية (الشكل 2D).

بعد تحويل مجموعة DNA في صفيف الأجسام المضادة من خلال التهجين مع تقارن-DNA الأجسام المضادة (الشكل 3B)، يتم استخدام لوحة الضد مما أدى إلى كشف المضاعفة، وذلك أساسا من خلال منصة شطيرة ELISA كما هو مبين في الشكل 3C. في شطيرة ELISA، المعقدة البيروكسيديز الكشف عن الأجسام المضادة (الثانوية) تتحد مع البروتينات القبض عليه، ووضع العلامات لاحق مع fluorophore مترافق streptavidin يسمح للكشف القائم على مضان (الشكل 3C-E). الكشف عن البروتينات يظهر <10٪ الاختلاف واحدة من نهاية إلى نهاية أخرى من شريحة زجاجية (الشكل 3D). مع مجموعة 3 × 3، ونحن قادرون على كشف ما يصل إلى 7 البروتينات، في حين تعيين عنصر صفيف واحد كمرجع (CY3 المسمى) وعنصر آخر كما المراقبة السلبية. على سبيل المثال، كان أداء في تجربة وحيدة الخلية لدراسات الورم، والبروتينات انترلوكين 6 (IL-6)، المصفوفة metallopeptidase 9 (MMP9)، عامل نمو الخلايا الكبدية (HGF)، الأوعية الدموية (عامل نمو بطانة VEGF)، انترلوكين 8 (IL-8)، والبلاعم المثبطة الهجرة عامل (MIF) من خلية واحدة يمكن أن يتم الكشف في وقت واحد (الشكل 3E).

نحن أيضا معايرة النظام باستخدام بروتينات المؤتلف بتركيزات مختلفة. في الشكل 3F، منحنيات المعايرة للبروتينات المؤتلف الإنترفيرون γ (IFN-γ)، α عامل نخر الورم (TNF α)، انترلوكين 13 (IL-13)، عامل نخر الورم β (TNF β)، جرانزيم B، انترلوكين -4 ترد (IL-4)، وانترلوكين 8 (IL-8). حساسية الكشف مشابهة تماما لتلك التي ELISA شطيرة التقليدية في لوحات جيدة حتى مع تحميل أعلى من السلطات الوطنية المعينة وربما الأجسام المضادة على الركيزة.

وantibod الباركودذ ميكروأري يمكن أن تستخدم لكشف المؤشرات الحيوية في عينات الموائعية وكذلك في الخلايا وحيدة. منذ التحليل وحيدة الخلية ليست هي محور هذا البروتوكول، ونحن ببساطة يتمثل في تطبيق الأجسام المضادة ميكروأري 3 × 3 في الكشف عن السيتوكينات. من خلال الأجسام المضادة سطح التفاعلات علامة، مجموعة من التمايز 8 (CD8) تم القبض على خلايا -positive على أحد العناصر ميكروأري (الشكل الجيل الثالث 3G، ورقة PDMS على أعلى)، واستخدمت بقية العناصر للكشف عن السيتوكينات يفرز ( الشكل 3H). مع هذا الأسلوب القبض على الخلية، ويمكن تشكيلها "مصفوفات الخلايا". هذه القبض على تقنية المصفوفة يسمح أيضا للسيطرة على عدد من الخلايا تعرض لكل تجربة ELISA. الخلايا تم عزل فعليا في microchambers بحيث البروتينات الكشف عن انصبت على الخلايا واحدة بعينها. في الشكل 3H، فإنه يظهر أن تم تجهيز كل microchamber مع 16 عنصرا ميكروأري لضمان التغليف منكامل 3 × 3 مجموعة ميكروأري.

الشكل 1
الشكل 1. تصميم وتصنيع القوالب الباركود PDMS لالقائم على تدفق DNA الزخرفة. لوحة (A) يدل على رسومات أوتوكاد لأنماط الباركود أحادية البعد الأفقي والرأسي. لوحة (B) يدل على أنماط الباركود الأفقية والرأسية فرضه من (A). صناديق خضراء أرفق المناطق منقوشة مع منفصلة 3 × 3 المصفوفات. قناع (C) الكروم لافتعال سيد SU-8. (D) SU-8 الرئيسي ملفقة على رقاقة السيليكون. (E) إنشاء لتنميط تدفق. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الرقم 2 الشكل 2. البناء والمصادقة على مجموعة DNA 3 × 3. وقد تم تعديل هذا الرقم من "Quantitating التفاعل خلية خلية وظائف مع تطبيقات لخلايا ورم أرومي دبقي الأشكال السرطان،" وانغ، J. وآخرون، 2012، نانو بادئة رسالة 12 . حقوق الطبع والنشر 2012 من قبل الجمعية الكيميائية الأميركية. تكييفها مع إذن. (A) خطة لDNA الخطوات التدفق الزخرفة. الملف (B) شدة الإسفار من 20 قنوات في المنطقة المحددة (تتبع خط عمودي) من الباركود 1D. تم تهجين أليغنوكليوتيد-CY3 مترافق مع صفائف DNA للتأكد من صحة. (C) الإسفار ملف كثافة صفائف التحقق مع DNA CY3 مترافق بعد الانتهاء من الخطوة الزخرفة DNA الثانية. (D) أنماط الفلورسنت البديلة من مختلف فلوريداآه من الزخرفة الاستراتيجيات. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل (3)
الشكل 3. تطبيقات ميكروأري 3 × 3. (A) خطة لتركيب تقارن DEAL الأجسام المضادة قليل النوكليوتيد. (B) مخطط لتحويل مجموعة DNA في صفيف الأجسام المضادة من خلال التهجين مع تقارن الأجسام المضادة قليل النوكليوتيد. (C) خطة للاستفادة من ميكروأري 3 × 3 في منصة شطيرة ELISA. تم تعديل هذا الرقم من "Quantitating التفاعل خلية خلية وظائف مع تطبيقات لخلايا ورم أرومي دبقي الأشكال السرطان،" وانغ، J. وآخرون، 2012، نانو بادئة رسالة 12. حقوق التأليف والنشر 2012 من قبل الجمعية الكيميائية الأميركية. مقتبس بإذن. لوحة (D) يظهر قراءات مضان ولدت تحت قناة Cy5. وهذا يتوافق مع شطيرة ELISA التجربة أن الكشف عن 6 البروتينات. لوحة (E) هو التكبير في الملف الشخصى 3 × 3 مجموعة قراءات تحت CY3 وCy5 القنوات. لوحة (F) يدل على شطيرة ELISA منحنيات المعايرة للبروتينات المؤتلف. لوحة (G) يدل على "مجموعة الخلايا" التي شكلتها التقاط الخلايا من خلال الربط مع الأجسام المضادة على صفيف. لوحة (H) يدل على نتيجة الكشف فرضه مع microchambers في رقاقة. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

1
حل النوكليوتيد التكوين
A'-I، B '، الجزء الثاني، C'والثاني والثالث
2 A'-IV، B 'الخامس، C'الى السادس
3 A'-السابع، B 'إلى الثامن، C'-التاسع

الجدول 1. تكوين حلول 1-3 DNA تدفق الزخرفة.

تسلسل ترسيخ
ا ATCCTGGAGCTAAGTCCGTA-AAAAAAAAAAAAAAAAAAAA-ATCCTGGAGCTAAGTCCGTA-AAAAAAAAAAAAAAAAAAAA
ب GCCTCATTGAATCATGCCTA-AAAAAAAAAAAAAAAAAAAA-GCCTCATTGAATCATGCCTA-
AAAAAAAAAAAAAAAAAAAA
C GCACTCGTCTACTATCGCTA-AAAAAAAAAAAAAAAAAAAA-GCACTCGTCTACTATCGCTA-AAAAAAAAAAAAAAAAAAAA
سد متواليات
A'-ط TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-ATGGTCGAGATGTCAGAGTA
B 'الثاني TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-ATGTGAAGTGGCAGTATCTA
C'والثاني والثالث TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-ATCAGGTAAGGTTCACGGTA
A'-IV TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-GAGTAGCCTTCCCGAGCATT
B 'الخامس TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-ATTGACCAAACTGCGGTGCG
C'الى السادس TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-TGCCCTATTGTTGCGTCGGA
A'السابع TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-TCTTCTAGTTGTCGAGCAGG
B 'إلى الثامن TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-TAATCTAATTCTGGTCGCGG
C'-التاسع TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-GTGATT AAGTCTGCTTCGGC
[أليغنوكليوتيد-CY3 مترافق للمصادقة
ا' TACGGACTTAGCTCCAGGAT
ب' TAGGCATGATTCAATGAGGC
C ' TAGCGATAGTAGACGAGTGC
أنا' TACTCTGACATCTCGACCAT
ب ' TAGATACTGCCACTTCACAT
ج ' TACCGTGAACCTTACCTGAT
رابعا " AATGCTGGGGAAGGCTACTC
الخامس' CGCACCGCAGTTTGGTCAAT
السادس' TCCGACGCAACAATAGGGCA
سابعا " CCTGCTCGACAACTAGAAGA
ثامنا " CCGCGACCAGAATTAGATTA
التاسع " GCCGAAGCAGACTTAATCAC
"FO: المحافظة على together.within صفحة =" 1 "> الجدول 2. تسلسل الحمض النووي المستخدمة في تدفق الزخرفة.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

تصميم نمط تدفق هو أول خطوة حاسمة في افتعال ميكروأري 2-D. لتوليد اثنين من تداخل أنماط الحمض النووي على ركيزة الزجاج، ويجب الميزات قناة للتصميم الأول أن يكون عمودي على تلك الثاني (الشكل 1A-B). النظر في التصاميم أيضا التطبيقات المصب ميكروأري. في حالة تحليل خلية واحدة، يتم استخدام ميكروأري للكشف عن البروتينات من خلايا مفردة المغلقة في microchambers، وبالتالي تتم أبعاد قناة متوافق مع microchambers التي تتماشى مع صفائف 2-D. يتم تقديم كل تصميم على الضوئية الرئيسية وتستخدم تقنيات ضوئيه القياسية لافتعال ميزات القناة في SU-8 على رقاقة السيليكون (الشكل 1C-D). هذا بمثابة الربان لPDMS الصب. مرة واحدة وقد تم ملفقة العفن، والمستعبدين لشريحة PLL المغلفة ثم إلى جانب وجود تدفق غاز النيتروجين انشاء (الشكل 1E). ونحن الإعداداستخدام بسيط ولديه ميزة كونها يسهل إدراجها في أي مختبر مع مصدر الضغط ينظم غاز النيتروجين. نستخدم تجميع رخيصة متعددة الصمامات 3-وسيلة اتصال إلى خزان غاز النيتروجين. يجب الحفاظ على تدفق الهواء لتنميط عند ضغوط منخفضة (0.5-1 رطل) لتجنب التبطين من شريحة زجاجية من القالب. يمكن أن تسرب داخل القالب PDMS تعرض للخطر سلامة الأنماط.

الخطوات الزخرفة تدفق DNA في هذا البروتوكول الاستفادة ssDNA مع تسلسل المتعامدة مختارة بعناية (الشكل 2A). قبل تدفق الزخرفة، وينبغي اختبار تسلسل فريد على هذه أليغنوكليوتيد] لغياب عبر الحديث. ويتم اختبار بسيط لعبر الحديث عن طريق تعديل إجراءات المصادقة ونحن نقدم في بروتوكول لدينا (الخطوة 2). بدلا من استخدام مزيج من CY3 الموسومة DNA التكميلي، ويستخدم نوع واحد فقط من تسلسل التكميلي في وقت لمنطقة مختارة من الشريحة التي متعددةويجمد تسلسل الحمض النووي. في حالة عدم وجود الحمض النووي عبر الحديث، ينبغي فلوري شريط واحد فقط (لل1-D DNA مجموعة) أو بقعة واحدة (ل2-D DNA مجموعة) تحت التصفية CY3. أمثلة تسلسل المتعامدة التحقق بدقة يمكن العثور عليها في جدول المواد والمعدات. أول خطوة الزخرفة DNA يقدم ثلاثة أنواع من [أليغنوكليوتيد "مرساة". وتتألف هذه المتتاليات 80 الإقليم الشمالي من اثنين 20 مير بولي-A المناطق التي تتناوب مع اثنين فريدة تسلسل 20-مير. تعديل 5'-أمين على هذه المتتاليات مرساة ضروري لأمين إلى أمين عبر ربط 17 مع PLL بوساطة BS3. لا يتطلب خطوة الزخرفة DNA الثانية على رابط الصليب. هذه الخطوة يقدم [أليغنوكليوتيد "سد" أن يهجن جزئيا مع تسلسل مرساة. يتكون كل تسلسل سد 60 الإقليم الشمالي من منطقة 20 مير مكملة لسلسلة واحدة مرساة، 20 مير بولي-A الفاصل، وتسلسل 20 مير فريدة من نوعها. المصادقة على المصفوفات DNA (شملت رقميتم تنفيذ ه 2B-C) بعد كل DNA خطوة تدفق الزخرفة لتقييم نوعية الخطوات الزخرفة وضمان عدم انتقال التلوث 14. يتم تنفيذ ذلك عن طريق تقديم تحقيقات قليل النوكليوتيد-CY3 مترافق أن يهجن مع أنماط الحمض النووي. مع المعايير المحددة في الخطوة (2.3.2) لتحليل كثافة مضان، ينبغي أن أنماط الحمض النووي تظهر شدة مضان من 40،000 على الأقل الاتحاد الافريقي لتحقيق أقصى قدر من حساسية المناعية المصب التي أجريت باستخدام ميكروأري. الاستخدام الاستراتيجي لمختلف مجموعات-DNA CY3 أثناء التحقق من الصحة يؤدي إلى أنماط بديلة (الشكل 2D)، مما يدل على مرونة الزخرفة DNA الخطوات 8. الفشل في تحقيق أنماط موحدة يمكن أن تنجم عن تسرب أو أي عوائق ميكانيكية (مثل ذرات الغبار) واجه في الخطوات التدفق الزخرفة.

إعداد الأجسام المضادة النوكليوتيد تقارن DEAL هو خطوة حاسمة أخرى في الهو بروتوكول. وأملت اختيار الأجسام المضادة من قبل النظام البيولوجي قيد الدراسة. ينبغي أن أليغنوكليوتيد] المستخدمة في الاقتران يكون تسلسل مكملة لتلك ترسو على مجموعة DNA. الحلول الأسهم من S-4FB وS-HyNic linkers يجب الطازجة وأبقى بعيدا عن الرطوبة لتجنب التحلل. الأوقات حضانة المستخدمة في بروتوكول الاقتران لدينا هي طويلة بما يكفي لتقديم وظائف المطلوب على الأجسام المضادة وDNA. تطفأ رد فعل اقتران النهائي فقط عن طريق إزالة أليغنوكليوتيد S-4FB مترافق غير المتفاعل عبر FPLC. وبالتالي، يجب أن يتم تنفيذ تنقية FPLC على الفور بعد الانتهاء من الاقتران. عند تنفيذ FPLC مع النظام المذكور في بروتوكول لدينا، وانخفاض معدلات تدفق (0،2 حتي 0،25 مل / دقيقة) ويمكن أيضا أن تستخدم لتحسين القرار. ومزال تقارن باعتباره ذروة اسعة (حجم شطف حوالي 9-15 مل) الذي يظهر قبل ذروة DNA أضيق وارتفاع (17-20 مل حجم شطف). نحن لا ننصح تخزين حلولمن تقارن مع فائض S-4FB-DNA لأن هذا يمكن أن يؤدي إلى فقدان مواقع ملزم مستضد في الجسم المضاد على الاقتران مع فائض functionalized DNA. وقد أظهرت الحساسية والنوعية، واستنساخ ELISAs شطيرة باستخدام تقارن DEAL في الدراسات السابقة. 8،9،11،12،16 لتقييم جودة تقارن-DNA الأجسام المضادة، قد تكون المحتضنة تقارن على المصفوفات الحمض النووي لتوليد مجموعة الأجسام المضادة، والذي يستخدم لاحقا في التجارب شطيرة ELISA لتوليد منحنيات المعايرة للكشف عن البروتين (الشكل 3F). لتوليد هذه المنحنيات المعايرة، يمكن استخدام البروتينات المؤتلف المنصوص عليها في شطيرة التقليدية ELISA عدة. استخدام تقارن عالية الجودة ينبغي أن تؤدي إلى نطاقات الخطية والحدود الدنيا من الكشف مقارنة مع تلك للمجموعة. وكمثال على ذلك، والحدود الدنيا لINFγ وTNFα لشطيرة ELISA على مجموعة الأجسام المضادة لدينا (الشكل 3F) هي ~ 50-100 غ / مل، وهي consistenر مع اكتشاف مجموعة خطية من ~ 15-1،000 الغرام / مل ورد في ورقة البيانات المنتج للالتقليدية شطيرة ELISA عدة. ويمكن أن يعزى الفقيرة قراءات إشارة التي تم الحصول عليها في المصب التجارب شطيرة ELISA إلى تدني نوعية مجموعة DNA، تدخل الحمض النووي الزائد في حلول المترافقة، أو بدلا من ذلك، الاقتران غير مكتملة من ssDNAs مع الأجسام المضادة.

وتشمل الاهتمامات الرئيسية لأداء شطيرة ELISA على مجموعة الأجسام المضادة عبر الحديث بين الكواشف وعما إذا كانت إشارة تعكس الأحداث البيولوجية الحقيقية. السلطات الوطنية المعينة المتعامدة التي نستخدمها في هذا البروتوكول تم التحقق من صحتها تماما أن يكون أقل من 0.1٪ عبر الحديث. لذا فإن أي نقاش عبر وحظ في مرحلة المناعية بشكل رئيسي من الأجسام المضادة والكواشف ELISA. اختبار لعبر الحديث بين الأجسام المضادة في مجموعة يجب أن يتم تنفيذ قبل إجراء فحوصات على عينات حقيقية. مرة واحدة يتم إنشاء لجنة الأجسام المضادة، وينبغي أن يكون عدد قليل من شطيرة ELISA تجارب السيطرة على الأداء الإقتصادي الأداءormed مع الشروط التالية: 1. بدون المستضدات، 2. دون الكشف عن الأجسام المضادة، والأجسام المضادة 3. كشف والكواشف وضع العلامات فقط. إذا لوحظ عبر الحديث في مرحلة المناعية، يجب أن يتم استبدال أزواج الأضداد و / أو الكواشف ELISA. وتجدر الإشارة إلى أن استخدام الأجسام المضادة المتاحة تجاريا من مجموعات ELISA التقليدية لا يضمن تطبيقها على شطيرة تقنية ELISA مجموعة مقرها.

وتشمل مزايا هذه التكنولوجيا التصنيع غير مكلفة، وحجم مصغر، والمرونة في التصميم. بروتوكول تلفيق لدينا لا يحتاج إلى نصاب ميكروأري التي قد لا تكون متاحة لكثير من صفائف الضد المستخدمين. الزخرفة تدفق انشاء يمكن تجميعها بسهولة في مختبرات بسيطة. للمختبرات التي لم يتم مجهزة بأدوات لضوئيه، تصاميم CAD التي نقدمها في بروتوكول لدينا قد تحال إلى الشركات التي تقدم خدمات التصنيع الدقيق. تقليص ميكروأري التقليدية إلىمجموعة التعاقد مع ملفقة لدينا بروتوكول يسمح للتوافق مع الرقائق المستخدمة في التجارب وحيدة الخلية. بروتوكول لدينا يتميز إنتاج مجموعة كصفيف ssDNA أولا قبل التحول إلى مجموعة الأجسام المضادة. الزخرفة الأولية مع ssDNAs لديها عدد من المزايا. أولا، ssDNAs هي كيميائيا أكثر استقرارا بالمقارنة مع الأجسام المضادة، وبالتالي فإن الشرائح نقوش ssDNA يمكن تخزينها في مجفف لمدة 6 أشهر على الأقل دون تدهور كبير 8،16. ثانيا، نهجنا يوفر للمستخدم النهائي المرونة لاختيار المقايسات اللازمة، ببساطة عن طريق خلط تقارن انتقائية معا في حل من دون تعديل ميكروأري. على العكس من ذلك، بروتين / صفائف الضد التقليدية هي والثابتة على ركيزة المصممة مسبقا، لذا فإن تغيير فحوصات تتطلب الزخرفة / طباعة البروتينات / الأجسام المضادة من البداية. وتوضح الدراسات تمثيلية استخدام الأجسام المضادة ميكروأري الباركود في الإنتاجية العالية detectioن من عدة بروتينات الإشارة من خلايا مفردة. من خلال تغيير نمط تدفق التصاميم و / أو الحلول النوكليوتيد الزخرفة المستخدمة، عدد وافر من تصاميم مجموعة يمكن استكشافها. وكمثال على هذا التطبيق، يمكن دراسة بروتينات وظيفية من الخلايا وحيدة. رقاقة لتحليل وحيدة الخلية يشمل العديد من مثل ~ 8700 microchambers، كل تتماشى مع استكمال 3 × 3 الضد مجموعة (الشكل 3H). مثل هذا الإعداد يسمح للكشف عن الإنتاجية العالية. ويمكن الكشف عن البروتينات التي يفرزها الخلايا المستزرعة في microchambers من قبل هذه المجموعة. تصميم ميكروأري تنوعا يسمح أيضا للكشف عن المضاعفة من البروتينات من الدم، ولست] الخلية، والخلايا وحيدة بعد الجمع بين ميكروأري مع مكونات عامة أخرى 8،15. بالإضافة إلى الكشف عن البروتين، والأجسام المضادة مجموعة 3 × 3 هي مفيدة أيضا في خلايا التقاط (الشكل 3G).

العيب الرئيسي لهذا النهج هو مجمعات التي تضافexity مقارنة مع تصنيع ميكروأرس التقليدية. استراتيجيات الزخرفة وتصميم مجموعة يجب أن تصور بدقة حين النظر في تطبيقات محددة من مجموعة ملفقة. يتطلب هذا النهج أيضا عددا من الخطوات الحاسمة بما في ذلك إجراءات المصادقة واختبارات عبر الحديث. شيدت مجموعة 3 × 3 باستخدام بروتوكول لدينا محدودة للكشف عن 7 البروتينات في وقت واحد. ومع ذلك، هذا الحد يمكن تجاوزه من خلال خلق صفائف أكبر. بروتوكول ظهرت هنا لا يقتصر على تصنيع 3 × 3 المجهرية. لقد كنا قادرين على افتعال 5 × 5 المجهرية وأبعاد أخرى من عناصر مجموعة بنجاح. من حيث المبدأ، قد تكون ملفقة أخرى صفائف ن س م باستخدام تقنيات مماثلة طالما أن مجموعات النوكليوتيد المستخدمة في إنشاء مجموعة نقوش DNA الأولية متعامدة لتجنب عبر الحديث بين عناصر المصفوفة. ويتحقق إنشاء صفائف توسعت بنسبة patterni تدفقنانوغرام ن أنواع ssDNA المراسي لأول خطوة الزخرفة DNA، تليها ن س م سد تسلسل ssDNA للخطوة الثانية الزخرفة. على سبيل المثال، لإنشاء 5 × 5 مجموعة، تسلسل مرساة A إلى E يمكن أن تستخدم، في حين تسلسل سد A'-I لوتستخدم الخامس والعشرون E'. لأتمتة عملية تنميط تدفق، وقد وضعت منصة الروبوتات 18 على الرغم من أن هذا قد تستغل فقط DNA خطوة واحدة الزخرفة التدفق. من حيث المبدأ، على نفس منصة يمكن أن تمتد إلى الخطوة الثانية من عمودي الزخرفة التدفق، في حين أن التبديل بين خطوتين قد تتطلب يدويا تقشير قبالة الأول العفن PDMS بعد خطوة الزخرفة الأولى، تليها غسل وتجفيف الشريحة (هذه الخطوة من شأنها أن يستغرق حوالي 10 دقيقة)، قبل التزاوج الشريحة مع العفن PDMS أخرى لتسهيل خطوة الزخرفة الثانية موجهة بشكل عمودي.

لقد ناقشنا الإجراءات التفصيلية لافتعال مجموعة nxm منقوشةمع الأجسام المضادة في الكثافة العالية، والتي تبشر بالخير العميم للتطبيقات المستقبلية في الدراسات البروتين وإشارات الخلية. بروتوكول المقدمة هنا قد تكون أيضا بمثابة دليل لبناء أكثر تفصيلا صفائف DNA / الأجسام المضادة لأغراض أخرى.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Sylgard 184 silicone elastomer base Dow Corning 3097366-1004
Sylgard 184 silicone elastomer curing agent Dow Corning 3097358-1004
SU-8 2025 photoresist MicroChem Y111069
Silicon wafers  University Wafers 452
Poly-L-lysine coated glass slides Thermo Scientific C40-5257-M20
Oligonucleotides Integrated DNA Technologies *Custom-ordered from Integrated DNA Technologies, see Table 2.
Poly-L-lysine adhesive stock solution Newcomer Supply 1339
Bis (sulfosuccinimidyl) suberate  (BS3) Thermo Scientific 21585
1x Phosphate buffered saline, pH 7.4 Quality Biological 114-058-101
Äkta Explorer 100 Fast Protein Liquid Chromatography (FPLC) System GE (Amersham Pharmacia)  18-1112-41
Superose 6 10/300 GL column GE Healthcare Life Sciences 17-5172-01
Capture antibodies various various *Antibody selection depends on application
Succinimidyl-6-hydrazino-nicotinamide (S-HyNic) Solulink S-1002
Succinimidyl-4-formylbenzamide (S-4FB) Solulink S-1004
N,N-dimethylformamide Sigma-Aldrich 227056
Citric acid, anhydrous Acros 42356
Sodium hydroxide Fisher Scientific S318
Amicon Ultra spin filter 10 kDa MWCO EMD Millipore UFC201024
Spin coater Laurell Technologies WS-650-MZ
Biopsy punch with plunger (1.0 mm diameter) Ted Pella, Inc. 15110-10
Diamond scribe (Style 60) SPI supplies 6004
Trimethylchlorosilane Sigma Aldrich 92361

DOWNLOAD MATERIALS LIST

References

  1. Alhamdani, M. S. S., Schroder, C., Hoheisel, J. D. Oncoproteomic profiling with antibody microarrays. Genome Med. 1, (7), (2009).
  2. Angenendt, P. Progress in protein and antibody microarray technology. Drug Discov Today. 10, (7), 503-511 (2005).
  3. Sun, H. Y., Chen, G. Y. J., Yao, S. Q. Recent advances in microarray technologies for proteomics. Chem Biol. 20, (5), 685-699 (2013).
  4. Fan, R., et al. Integrated barcode chips for rapid, multiplexed analysis of proteins in microliter quantities of blood. Nat Biotechnol. 26, (12), 1373-1378 (2008).
  5. Chattopadhyay, P. K., Gierahn, T. M., Roederer, M., Love, J. C. Single-cell technologies for monitoring immune systems. Nat Immunol. 15, (2), 128-135 (2014).
  6. Varadarajan, N., et al. Rapid, efficient functional characterization and recovery of HIV-specific human CD8(+) T cells using microengraving. Proc Natl Acad Sci USA. 109, (10), 3885-3890 (2012).
  7. Ma, S., et al. Electroporation-based delivery of cell-penetrating peptide conjugates of peptide nucleic acids for antisense inhibition of intracellular bacteria. Integr Biol-Uk. 6, (10), 973-978 (2014).
  8. Wang, J., et al. Quantitating cell-cell interaction functions with applications to glioblastoma multiforme cancer cells. Nano Lett. 12, (12), 6101-6106 (2012).
  9. Kravchenko-Balasha, N., Wang, J., Remacle, F., Levine, R. D., Heath, J. R. Glioblastoma cellular architectures are predicted through the characterization of two-cell interactions. Proc Natl Acad Sci USA. 111, (17), 6521-6526 (2014).
  10. Xue, M., et al. Chemical methods for the simultaneous quantitation of metabolites and proteins from single cells. J Am Chem Soc. 137, (12), 4066-4069 (2015).
  11. Shi, Q. H., et al. Single-cell proteomic chip for profiling intracellular signaling pathways in single tumor cells. Proc Natl Acad Sci USA. 109, (2), 419-424 (2012).
  12. Ma, C., et al. A clinical microchip for evaluation of single immune cells reveals high functional heterogeneity in phenotypically similar T cells. Nat Med. 17, (6), 738-743 (2011).
  13. Deng, Y., et al. An integrated microfluidic chip system for single-cell secretion profiling of rare circulating tumor cells. Sci Rep. 4, 7499 (2014).
  14. Vermesh, U., et al. High-density, multiplexed patterning of cells at single-cell resolution for tissue engineering and other applications. Angew Chem Int Ed. 50, (32), 7378-7380 (2011).
  15. Yu, J., et al. Microfluidics-based single-cell functional proteomics for fundamental and applied biomedical applications. Annu Rev Anal Chem. 7, 275-295 (2014).
  16. Bailey, R. C., Kwong, G. A., Radu, C. G., Witte, O. N., Heath, J. R. DNA-encoded antibody libraries: A unified platform for multiplexed cell sorting and detection of genes and proteins. J Am Chem Soc. 129, 1959-1967 (2007).
  17. Alegria-Schaffer, A. General protein-protein cross-linking. Methods Enzymol. 539, 81-87 (2014).
  18. Ahmad, H., et al. A robotics platform for automated batch fabrication of high density, microfluidics-based DNA microarrays, with applications to single cell, multiplex assays of secreted proteins. Rev Sci Instrum. 82, 094301 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics