고밀도 바코드 항체 마이크로 어레이의 흐름 패턴 가이드 제작

Chemistry

Your institution must subscribe to JoVE's Chemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

이 프로토콜은 세포 신호 전달 연구와 바이오 마커 검출 잠재적 인 응용 프로그램과 대규모의 제조, 다중화 된 두 차원의 DNA 또는 항체 배열을 설명합니다.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Ramirez, L. S., Wang, J. Flow-pattern Guided Fabrication of High-density Barcode Antibody Microarray. J. Vis. Exp. (107), e53644, doi:10.3791/53644 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

항체 Microarrays 널리 생체 단백질 1-3 비롯한 표적 단백질의 존재를 조사하기 위해 수십 년간 단백체 연구에 사용되었다. 이 필드는 현재와 같은 질량 분석기 (MS) 등의 높은 처리량 기술에서 큰 도전에 직면하고 있지만, 이러한 장치는 다른 분석과 간단한 데이터 해석과 쉬운 인터페이스를 여유가 주로 때문에, 여전히 항체 마이크로 어레이의 유틸리티의 여지가있다. 최근 몇 년 동안, 마이크로 칩의 발판으로 마이크로 어레이의 통합은 항체 마이크로 어레이에게 4-7 번창 할 수있는 새로운 기회를 제공하고 있습니다. 예를 들어, 단일 - 셀 마이크로 칩에 통합 바코드 마이크로 어레이는 휴대 통신 8,9 연구에서 사용되어왔다. 이 기술은 다른 사용 가능한 마이크로 어레이 기술에 비해 독특한 장점이 있습니다. 그것은 기존의 마이크로 어레이 elemen에서 사용되는 전형적인 150 μm의 크기보다 훨씬 작은 10 ~ 100 μm의에서 배열 요소를 갖추고 있습니다TS. 작은 어레이 요소의 구성은 체계적 흐름 패터닝 방법을 이용하여 달성되며, 이는 단일 세포 분비 된 단백질과 세포 내 단백질을 검출 할 수있는 소형 마이크​​로 어레이를 일으킨다. 또 다른 장점은 간단한기구가없는 설정의 사용이다. 대부분의 실험실 및 작은 기업이 마이크로 어레이 코어 설비에 액세스 할 수 없을 수 있기 때문에, 특히 중요하다. 이러한 바코드 항체 마이크로 어레이 분석 처리량의 개선 된 특성과 종래의 샌드위치 효소 면역 분석법의 것과 유사한 높은 민감도와 특이도 (ELISA 8)를 가지면서 단일 세포에 높은 다중 분석법을 수행하는 데 사용될 수있다. 이 기술은 종양 세포를 13 아교 모세포종 단백질 9-11에서, T 세포 (12)를 검출하고, 순환하는 수많은 응용 분야를 발견하고있다. 또한, 바코드의 DNA 마이크로 어레이는 혼자 해내는 대한 신경과 성상 세포의 정확한 위치에 사용되어왔다뇌 조직 (14)의 생체 어셈블리를 보내고.

이 프로토콜은 단지 실험 단계와 유체 샘플에서 바이오 마커의 검출에 응용 가능성을 갖는 2 차원 (2-D) 바코드 항체 마이크로 어레이의 빌드 업 블록과 하나의 셀에 초점을 맞추고있다. 기술 어 드레서, 단일 가닥 일 차원 (1-D) DNA 마이크로 어레이에 기반을 유리 기판 상에 공간적으로 패터닝 직교 올리고 뉴클레오티드를 사용하여 구축 하였다. 평행 유동 채널이 플로 패터닝 공정에서 사용되는 경우 1-D 패턴을 형성하고, 이러한 패턴은 1-D 제품 코드 (Universal Product Code, UPC) 바코드 비슷해 이산 밴드로 나타난다. 2-D (n × m) 개의 항체 어레이의 건설 - 2-D 빠른 응답 (QR) 매트릭스 코드 연상 - 더 복잡한 패터닝 전략을 필요로하지만, 높은 밀도 8,15에서 항체의 고정화를 허용한다. 제조둘째 직교 1 패턴 두 DNA 패터닝 단계를 필요로한다. 이 두 가지 패턴의 교차점 어레이의 N × M 소자를 구성한다. 전략적 유동 패터닝에서 사용될 단일 가닥 DNA (ssDNA를)의 시퀀스를 선택함으로써, 주어진 배열의 각 요소는 특정 주소가 할당된다. 이 공간 참조는 마이크로 어레이 슬라이드에 형광 신호를 구별 필요하다. ssDNA를 어레이 (DEAL 16)로 인코딩 된 DNA 항체 라이브러리라는 플랫폼을 형성하는 상보 적 DNA 항체 컨쥬 게이트의 혼입을 통해 항체 배열로 변환된다.

이 비디오 프로토콜은 두 방향에서 제조 포함 N × M 개의 항체 배열 된 폴리 디메틸 실록산 (PDMS) 바코드 금형, 유동 패터닝 ssDNA를를 생성 항체 올리고 뉴클레오티드 DEAL 접합체를 제조하고, (3)에 3 × 3 DNA 배열을 변환하는 주요 단계를 설명× 3 항체 배열입니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

주의 :이 프로토콜에서 사용되는 여러 가지 화학 물질을 자극하고 피부 접촉시 유해 있습니다. 물질 안전 보건 자료 (MSDS)를 참조하고이 프로토콜을 수행하기 전에 적절한 개인 보호 장비를 착용하십시오. 단계 (1.1.1)에서 사용 피라냐 용액은 부식성이고 교반하면서 산에 서서히 과산화물을 첨가함으로써 제조한다. 흄 후드에서 극단주의와이 솔루션을 처리합니다. 적절한 눈 보호 및 부식 방지 장갑을 사용합니다. 트리메틸 클로로 실란 (TMCS)는 (1.1.6) 후 선택 단계에서 사용, 부식성, 인화성 화학 물질이다. 흄 후드에서이 화학 물질을 처리합니다.

주 : 입자상 물질에 의한 오염을 최소화하기 위해 클린 룸 바코드 슬라이드 제조 및 임계 유동 패터닝 과정을 수행한다. 먼지 입자는 포트와 PDMS 몰드의 마이크로 블록 및 플로우 패턴을 방해 할 수있다.

한 - dimensiona 1. 건설L DNA 바코드 슬라이드

  1. 바코드 흐름 패턴의 SU-8 마스터의 준비
    주 : 수직 흐름 패턴위한 도면 (도 1A-B)은 컴퓨터 지원 설계 (CAD) 소프트웨어를 사용하여 생성된다. 이러한 패턴은 크롬 포토 마스크에 렌더링됩니다. 마스크의 투명 영역은 SU-8 마스터의 기능에 해당합니다.
    1. 96 ° C로 가열 한 30 % H 2 O 2 (피라냐 용액) : 완전히 3 H 2 SO 4의 혼합물에, 실리콘 웨이퍼 (100mm 직경)를 청소한다. 탈 이온수 및 이소 프로필 알코올로 웨이퍼를 세척 질소 블로우 총 건조 하였다.
    2. 웨이퍼에 SU-8 2,025 포토 레지스트의 약 4 ml에 붓고. 균일 한 다음 3000 rpm에서 30 초, 500 rpm에서 10 초 동안 웨이퍼 상에 포토 레지스트를 확산 프로그램을 스핀 코터를 사용한다. 이는 ~ 25 ㎛의 두께를 갖는 포토 레지스트 층을 생성한다. 점차적으로 중지하기 전에 천천히 회전 허용 -이 마이입니다웨이퍼의 표면에 균일 한 피막을 ntain.
    3. 다음 65 ℃에서 1 분 핫 플레이트에 코팅 된 웨이퍼, 빵을 95 ℃에서 5 분. 이 단계는 코팅이 응고 할 수 있습니다. 5 분 동안 실온으로 냉각.
    4. 포토 레지스트 코팅에 크롬 마스크 (그림 1C)을 놓습니다. 20 초 동안 근 자외선 (350-400 nm의, 노광 에너지 150-160 엠제이 / ㎠)에 마스크 기능을 노출.
      참고 : 크롬 마스크의 디자인은 50 μm의 피치 20 μm의 넓은 각각 20 개의 채널이 포함되어 있습니다. 채널은 대향 단부에 패턴의 일단으로부터 권취된다. 요컨대, 채널 20 ~ 40mm의 길이 ~ 20mm의 폭을 갖는 직사각형의 영역을 커버한다. 각 채널은 입구 및 출구에 해당하는 두 원형 특징 어귀된다. 입구와 출구는 교환 할 수있다.
    5. 95 ° C에서 5 분 동안 핫 플레이트상에서 노광 된 웨이퍼를 굽는다. 서서히 실온으로 냉각.
    6. 교반 SU-8 개발자의 웨이퍼를 담가5 분. 이소 프로필 알콜이어서 신선한 SU-8 현상액의 작은 부분으로 웨이퍼를 세척 하였다. 질소 블로우 건을 이용하여 웨이퍼를 건조. 하드 베이크 30 분 동안 200 ℃로 열판에서 웨이퍼 및 웨이퍼를 실온으로 서서히 냉각되도록.
      주 : 백색 필름이 단계에서 세척 후에 관찰되면 발전은 더 긴 시간 동안 수행 될 수있다.
      선택적 : 10 분 동안 폐쇄 된 배양 접시에 트리메틸 클로로 실란 증기에 노출에 의해 SU-8 마스터 silanization합니다.
  2. 바코드 PDMS 몰드의 제조
    1. 4.0 g 경화제와 40.0 g의 실리콘 엘라스토머 기재를 결합한다. 10 분 동안 격렬하게 예비 중합체 혼합물을 교반한다. 진공 하에서 20 분 동안 드가.
      주 : 1 (기본 : 경화제) 질량비 일반적으로 10을 사용합니다.
    2. 바코드 형 패턴의 SU-8 마스터와 실리콘 웨이퍼를 함유하는 페트리 접시로 프리폴리머를 붓는다. PDMS 혼합물의 높이는 약 7.5 mm 이상이어야한다. 페트르의 혼합물을 탈기두 번째는 다음 PDMS는 치료 할 수 있도록 75 ℃에서 1 시간 동안 혼합물을 구워, 남아있는 거품을 제거하기 위해 내가 요리.
      참고 :이 단계에서 PDMS 몰드의 구멍을 통해 핀 / 튜브의 삽입에 PDMS 유리 결합에 너무 많은 긴장을 추가하지 위 ~에 7.5 mm의 PDMS의 슬래브의 충분한 두께를 유지하거나하는 것이 중요하다 (1.3.3.1)를
    3. 메스를 사용하여 조심스럽게 바코드 금형의 기능을 포함하고 있으며 웨이퍼의 슬래브를 벗겨 PDMS의 슬래브의 주변 잘라.
    4. 바코드 PDMS 몰드의 원하는 형상을 얻기 위해 슬래브의 가장자리 트리밍. 플런저 생검 펀치를 이용하여 금형 (20)을 통해 구멍 (1.0 mm 직경) 펀치. 구멍이 바코드 패턴의 순환 기능과 정렬되어 있는지 확인합니다. 이 구멍은 입구와 출구 역할을한다.
  3. 폴리 -L- 라이신 일차원 패터닝 (PLL)
    1. 질소 블로우 건을 사용하여 폴리 -L- 리신 코팅 된 슬라이드 유리의 표면에 임의의 먼지를 제거한다. ATTACH 깨끗한 유리 슬라이드에 PDMS 몰드. 금형 및 슬라이드의 가장자리가 정렬되어 있는지 확인합니다.
    2. PDMS 금형 및 PLL 코팅 슬라이드 사이의 결합을 강화하기 위해 75 ℃에서 1.5 시간 동안 굽는다. 한편, (0.5 mm의 내부 지름과 1.5 mm의 외부 직경, 4 인치 조각 3-)가요 폴리에틸렌 튜브 20 개를 준비한다.
      주 : 튜브 부분의 개수는 PDMS 몰드 바코드의 입구의 수에 대응한다. 튜브 결합하도록 압력 조절기를 구비 한 질소 가스 탱크 바코드 PDMS 몰드에 채널을 제공.
    3. 튜브의 각 부분의 일단에, 스테인리스 중공 핀 (직경 1 ㎜)를 부착. 대기음 멸균 여과 튜브의 적어도 1cm가 용액으로 채워질 때까지, 폴리 -L- 리신 핀을 통해 용액.
      1. PDMS 바코드 형 (그림 1E)의 입구에 (솔루션 채워진 튜브에 연결) 핀을 고정합니다. 튜브의 다른 쪽 끝을 연결합니다압력 조절 질소 탱크 셋업. 용액은 적어도 6 시간 동안 0.5-1 PSI의 압력 범위를 사용하여 주형을 통해 흐르도록 허용한다.
        참고 : 모든 흐름 패터닝 절차 (1.3.3) 단계를 참조하십시오.
  4. ssDNA를 14 분의 1 차원 패터닝
    주의 : 후속 단계에 사용 된 인산 완충 식염수 (PBS)이 137 mM의 염화나트륨, 10 mM의 나트륨 2 HPO 4, 및 2 mM의 KH 2 PO 4 완충액의 pH가 7.4 인으로부터 제조된다.
    1. PBS 2 MM의 비스 (sulfosuccinimidyl) 수베 (BS3) 솔루션을 준비합니다. PBS 또는 초순수에 A, BC ssDNA를 (5'-아민, 80 뉴클레오티드 수정)의 300 μm의 솔루션을 준비합니다.
      참고 : N의 -hydroxysuccinimide 에스테르 쉽게 가수 분해를 거쳐 때문에 준비 후 약 30 분 이내에 BS3 솔루션을 사용합니다.
    2. 2 mM의 비스 2.5 μL (sulfosuccinim 300 μM의 A, B, 또는 C ssDNA를 2.5 μL 수확기각 채널. A, B,C에 대한 DNA의 짧은 서사시 PBS) 수베 각각 채널 1, 2로 지정하고 3된다. 이 순서는 또한 3 채널 (그림 2A)의 나머지 세트에 적용됩니다.
    3. 수행 단계 (1.3.3). 이번에는, 스테인리스 강 핀 통해 폴리에틸렌 튜브에 5 ㎕의 BS3 / DNA 용액을 흡인, 질소원에 커플 후 PDMS 몰드. BS3 / DNA 용액은 약 40 분 동안이나 채널이 가득에서까지 바코드 금형을 통과하도록 허용합니다.
    4. 한 번에 모든 채널이 가득 흐름을 중지 한 후 2 시간 동안 실온에서 바코드의 BS3 / DNA 용액을 품어. 용액을 건조하는 것을 허용하지 마십시오. 75 ° C에서 1 시간 동안 부착 된 바코드 슬라이드와 PDMS 몰드 구워.
      주의 : 후속 흐름 패터닝 단계의 정렬을 용이하게하기 위해, 바코드 슬라이드 채널 패턴의 가장자리에 설명 될 수있다. 이 신중 다이아몬드를 사용 scrib 유리 표면을 긁 의해 이루어진다E는 유리 슬라이드의 하부에 정렬 마커를 생성한다. 프로토콜의 나중 단계에서 정렬 현미경으로 확인할 수있다.
    5. 바코드 슬라이드에서 PDMS 몰드를 제거합니다. 초순수와 SDS는 한 번 세 번 0.01 %로 부드럽게 슬라이드를 씻으십시오.
      1. 현미경 슬라이드 스피너를 사용하여 바코드 슬라이드를 건조. 이후 사용을 위해 깨끗한 50 ML의 원심 분리 관에 바코드 슬라이드를 저장합니다.

바코드 슬라이드에 한 차원 패턴 2. 검증

주 :이 검증 프로토콜은 후속 흐름 패터닝 공정의 품질을 평가하는데 사용하기 위해 적응 될 수있다.

  1. 슬라이드 블로킹
    1. PBS에서 1 % 소 혈청 알부민 (BSA)을 준비한다. 사용하기 전에 0.45 μm의 주사기 필터를 통해이 솔루션을 필터링합니다. 겔 로딩 팁을 사용하여, 바코드 슬라이드의 한쪽 모서리에 1 % BSA 용액 50 μL를 적용.
    2. 1 % BSA의 오디오 솔루션을 품어RT에서 1 시간 동안 이온.
  2. 시아닌 3 (Cy3에)와 배양 보완 DNA를 π 공역 계
    1. 일단 Cy3에 접합의 칵테일 ', B'및 C '올리고 뉴클레오티드를 준비합니다. 'B'및 C '의 서열은 각각 A, B, C 및 이들의 상보 적이다. Cy3에-DNA의 작용 농도는 0.1 % BSA 0.05 μM이다.
    2. 피펫으로 슬라이드에서 BSA 솔루션을 제거한 다음 슬라이드의 같은 가장자리에있는 DNA 칵테일 용액 30 μl를 적용합니다. 1 시간 동안 실온에서 슬라이드를 Cy3-DNA 칵테일을 품어. photobleaching에에서 Cy3에 부분을 보호하기 위해 어둠 속에서이 배양 단계를 수행합니다.
  3. 형광 강도의 분석
    1. 희석 PBS에 마지막으로 Cy3에-DNA 칵테일을 피펫하고, 1 % BSA의 PBS를 슬라이드를 씻어 (1 페이지50 부품 초순수 예술 PBS). 스피너를 사용하여 슬라이드를 건조.
    2. 형광 현미경 또는 마이크로 어레이 스캐너를 사용하여 형광 (도 2B)를 관찰한다. 마이크로 어레이 스캐너를 사용하는 경우, 532 nm의, 5 마이크론 픽셀 크기, 15 %의 광전자 증 배관 (PMT) (450)에서의 이득 및 전력의 레이저 발광 파장을 설정한다.

2 차원 (3 × 3) DNA 어레이 (14)의 제조 3

  1. 바코드 PDMS 몰드의 제조
    1. 다른 SU-8 마스터를 구성하는 방법 (1.1)을 수행하지만,이 시간은 수직 제 설계의 그것에 흐름 패턴과 크롬 마스크를 사용한다. 수직 패턴으로 새로운 PDMS 몰드를 구성하는 절차 (1.2)을 수행합니다.
  2. ssDNA를 이차원 흐름 패터닝
    1. 3 × 3 배열의 경우, A'-I, B'-II의 150 μm의 재고 솔루션, C'-III, A'-IV, B'-V, C'-VI, A'-VII, B를 제조3 % BSA / PBS에서 '-viii 및 C'-IX DNA. 이러한 올리고 뉴클레오티드는 "브리징 시퀀스"(그림 2A)의 역할을한다. 올리고 뉴클레오티드 용액 (솔루션 1~3) 워킹 농도가 각각 50 μM 올리고 뉴클레오티드가되도록 조합. 표 1에서 제공하는 가이드를 사용합니다.
    2. 0.5 psi에서 1 시간 동안 20 개의 채널로 3 % BSA / PBS 차단 용액을 흐른다.
    3. 유동 한 솔루션 각각 2, 채널 1, 2, 3으로, 3,. 3 채널의 다음 세트의 순서를 따릅니다. 흐름은 일반적으로 약 40 분에 완료됩니다. DNA가 혼성화 할 수 있도록하기 위해 2 시간 동안 실온에서 DNA 용액을 배양한다.
    4. 혼성화되지 않은 DNA를 제거하기 위해 0.5 psi에서 1 시간 동안 20 개의 채널로 3 % BSA / PBS 차단 용액을 흐른다. PDMS 슬래브 벗기고, 그리고 3 % BSA로 유리 슬라이드를 디핑에 의해 얻어진 DNA 마이크로 어레이 슬라이드를 세척 / PBS 일단과 PBS 배 희석 PBS (1 부, PBS 50 부 초순수) 하였다. 디현미경 슬라이드 스피너를 사용하여 슬라이드를 RY.
    5. 내가 Cy3에 접합 된 것을 '은 9'섹션 2. 올리고 뉴클레오타이드에 유사한 두 번째 검증 단계 (그림 2C)을 수행합니다. 이후 사용을 위해 50 ML의 원심 분리 관에 3 × 3 배열 슬라이드를 저장합니다.
      주 : DNA 마이크로 어레이 달 동안 데시 케이 터 내에서 실온에서 저장 될 수있다.

항체 배열에 3 × 3의 DNA 배열 4. 변환

  1. 항체 올리고 뉴클레오티드 (DEAL) 복합체의 제조
    1. 200 MM의 숙신 -4- 포르 밀 (S-4FB) 및 무수 N 40 mM의 숙신-6-hydrazinonicotinamide (S-HyNic), N- 디메틸 포름 아미드 (DMF)의 솔루션을 준비합니다.
    2. PBS에서 캡처 항체의 7 별도의 솔루션 (1 ㎎ / ㎖)까지 준비합니다.
      주 : 항체 원액 나트륨 아 지드 정균제가 포함되어 있으면, 스핀 탈염 C를 이용하여 PBS로 완충액 교환을 수행7 kDa의 분자량 컷 - 오프 (MWCO)와 olumns.
    3. 필자가, 'II'III 'IV'V 'VI'와 VII '의 DNA를 별도의 400 μm의 솔루션을 준비합니다. 하나 올리고 뉴클레오티드 서열에 각각 캡처 항체를 할당합니다. 마이크로 원심 튜브에 DMF의 12.25 μL 400 μm의 DNA를 40 μl를 결합하고 철저하게 혼합 스핀 다운.
      1. 각각의 DNA / DMF 용액에, DMF 200 mM의 S-4FB의 2.3 μl를 추가합니다. 캡처 항체의 매 100 μg의 경우, DMF에서 40 mM의 S-HyNic의 2.25 μl를 추가합니다.
    4. 실온에서 4 시간 동안 항체 / S-HyNic 및 DNA / S-4FB 솔루션을 품어.
    5. 항체 DNA 커플 링 반응에 대비하여, pH를 6에서 구연산 버퍼를 세척하여 새로운 스핀 탈염 열 (각 항체에 대한 각각의 DNA 용액에 대해 하나 하나)를 준비합니다.
    6. 배양 4 시간 후, 각 항체 / S-HyNic 및 DNA / S-4FB 솔루션에 대한 버퍼 교환을 수행합니다. S-4FB 접합 결합 VII '올리고 뉴클레오티드. RT에서 2 시간 동안 혼합물을 배양한다.
    7. 반응 O / N에서 4 ° C를 품어.
  2. 항체 올리고 뉴클레오티드 (DEAL) 복합체의 정제
    참고 : 항체 올리고 뉴클레오타이드 복합체를 정화 수퍼 로스 6 300분의 10 GL 열이 장착 된 표준 FPLC 시스템에서 빠른 단백질 액체 크로마토 그래피 (FPLC)을 수행 할 수 있습니다.
    1. 280 ㎚에 FPLC 시스템의 UV 검출기 파장을 설정한다. 과량 S-4FB-DNA로부터 항체 - 올리고 뉴클레오티드 복합체를 분리하는 0.3 ㎖ / 분으로 PBS (PH 7.4)의 등용 매 유동을 사용한다.
    2. 접합체를 함유하는 분획을 풀 및 10 kDa의 MWCO으로 스핀 필터를 사용하여 150 μL의 부피 분획을 농축시킨다.
  3. 항체의 이차원 패터닝
    1. microchambers 또는 마이크로 웰 우리에게 또 다른 PDMS 몰드를 준비단계에서 보내고 제조 절차 (1.2). PDMS 몰드는 면역을위한 나노 리터 우물에 마이크로 리터를 포함 할 수있다.
      참고 : 유체 샘플 일반 바이오 마커 검출을위한 여러 우물와 PDMS 몰드는 배열 슬라이드와 결합된다. PDMS 몰드의 특징은 시스템이 연구되고에 의존한다. 예를 들어, 단일 세포 실험에서 단백질의 검출은 0.15 NL 볼륨으로 microchambers 함유 PDMS 몰드로 행할 수있다.
    2. (선택 사항)의 패턴 표면의 친수성을 렌더링하는 데 1.5 분 동안 플라즈마에 PDMS 몰드 청소 (18 승) 될 수 있습니다. 이전 플라즈마 세정에 직접 3 × 3 배열 슬라이드에 결합 할 다른 모든면을 차단하는 접착 테이프를 사용합니다.
      참고 : 단계 (4.3.2)는 선택 사항이지만 PDMS 몰드가 단일 세포 실험에서 사용하기위한 것입니다 때 일반적으로 수행됩니다.
    3. 3 × 3 배열 슬라이드와 PDMS 몰드 메이트, 다음 PBS에 1 % BSA와 슬라이드를 차단합니다. 실온에서 1 시간 동안 품어. Meanwhi제작은, 항체 올리고 뉴클레오타이드 복합체의 칵테일 (200 μL 최종 볼륨)을 준비합니다. 각 접합체의 작동 농도는 1 % BSA / PBS에 10 ㎍ / ml 인 것을.
    4. 다음시켜 항체 배열 DNA 배열을 변환 접합체의 뉴클레오티드 잔기는 3 × 3 어레이에 관한 특정 지점으로 혼성화 할 수 있도록 37 ° C에서 1 시간 동안 배양, 항체 - 올리고 칵테일을 추가한다.
    5. 청소하고 슬라이드를 건조하는 단계를 반복합니다 (3.2.4). 항체 배열을 즉시 사용하는 경우 가장 높은 감도를 달성 할 수있다. 장기간 보관 감도의 손실이 발생할 수 있습니다.
  4. 단백질의 검출
    1. 재조합 단백질을 재구성 또는 필터링 된 세포 샘플을 준비합니다.
    2. 맞춤 설계된 칩 마이크로 어레이 메이트, 1 시간 동안 PBS에서 3 % BSA와 표면을 차단합니다. 그런 다음 BSA 솔루션을 제거하고 샘플을 적용하고 2 시간 동안 품어.
    3. PBS에서 3 % BSA를 사용하여 샘​​플을 씻어 세 번다음 제품 시트가 제공 농도로 검출 된 항체를 추가 거라고. 2 시간 동안 품어.
    4. PBS로 세 번 3 % BSA에 의해 검출 항체를 씻어하고 1 시간 동안 인큐베이션 1 ㎍ / ㎖의에 -streptavidin 시아닌 5 (Cy5에)를 추가한다.
    5. 청소 및 검사 용 슬라이드를 건조하는 단계를 반복합니다 (3.2.4).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

PDMS 금형 (그림 1A-1B)에 대한 설계는 CAD 프로그램 (의 AutoCAD)를 사용하여 그려진. 흐름 패턴, 수평 하나는 수직에 대한 기능 채널을 보여 두 디자인. 각각의 디자인의 좌우 대칭 인 부분; 그 중 하나는 입구 또는 출구 수 있습니다. 20 채널들 각각은 줄곧 일단에서 타단까지 권취된다. 각각의 디자인은 크롬 포토 마스크 (그림 1C)에 인쇄되어 있습니다. 웨이퍼상에서 제작 된 SU-8 마스터는도 1d에 도시되어있다. PLL 또는 DNA의 흐름을 용이하게 패터닝, PDMS 몰드가 질소 가스 유량 설정 (도 1E)에 결합시켰다.

이 프로토콜에 사용되는 세 가지 흐름 패터닝 단계가 있습니다. 후속 단계가 올리고 뉴클레오티드 용액을 도입하면서 두 첫 번째 단계는, 유리 기판 상에 고정화를 PLL. 표 1에서 oligonucle솔루션 1-3의 otide 조성물이 제공됩니다. 각각의 올리고 뉴클레오티드의 작용은 50 μM 농도이며, 각 용액의 총 부피는 39 μL이다. 이러한 솔루션은 각각의 올리고 스톡 용액 (150 μM)의 13 μL를 조합하여 제조된다.

패터닝 된 DNA 마이크로 어레이는 반복 단위 전체 유리 슬라이드에 걸쳐 인접. 3 × 3 마이크로 어레이의 경우, 최대 밀도는 하나의 유리 슬라이드에 약 40 만 점이다. 상업 DNA 마이크로 어레이와 나란히 비교는 우리의 기술이를 Cy3에 바인딩 보완 DNA를 태그 할 때 약 5 배 더 민감하다는 것을 알 수있다. 패터닝 된 DNA를 여러 걸쳐 반복 ~ 5 %의 편차가 비교적 균일하다. 생물학적 시료에서 단백질 함량을 측정 할 때 그 기능은 우리의 기술의 높은 정량 능력을 약속드립니다. 또한, 유동 채널 디자인과 결합하는 DNA의 직교성을 제공 flexibili형상의 다양한 (그림 2D)에서 패턴의 타이.

도 3c에 도시 된 바와 같이 DNA 항체 컨쥬 게이트 (도 3b)를 통해 혼성화 항체 배열 DNA 배열을 변환 한 후, 생성 된 항체는 주로 패널 샌드위치 ELISA 플랫폼을 통해 다중화 검출에 사용된다. 샌드위치 ELISA에서, 바이오틴 검출 (보조) 항체는 캡처 된 단백질에 결합하고, 형광 접합 된 스트렙 타비 딘 후속 라벨 형광 기반 탐지 (그림 3C-E)을 허용한다. 단백질 쇼 <유리 슬라이드 (도 3D)의 일단에서 타단까지 10 %의 변이 검출. 3 × 3 배열, 우리는 참고로 배열 요소를 할당하면서, 7 단백질까지 감지 할 수 있습니다 (Cy3에 레이블) 및 음성 대조군과 같은 다른 요소입니다. 예를 들면, 단일 세포 실험 수행종양 연구, 단백질, 인터루킨 -6 (IL-6), 매트릭스 metallopeptidase 9 (MMP9), 간세포 성장 인자 (HGF), 혈관 내피 성장 인자 (VEGF), 인터루킨 -8 (IL-8), 및 대 식세포 이동 억제 인자 단일 셀로부터 (MIF)를 (도 3E)를 동시에 검출 할 수있다.

또한 다양한 농도에서 재조합 단백질을 이용하여 시스템을 교정. 도 3f에서, 재조합 단백질 인터페론 γ에 대한 검량선 (IFN-γ), 종양 괴사 인자 α (TNF의 α), 인터루킨 13 (IL-13), 종양 괴사 인자 β (TNF의 β), 그랜 자임 B, 인터루킨 -4 (IL-4) 및 인터루킨 8 (IL-8)을 나타낸다. 검출 감도도 기판에 DNA를 아마도 항체의 높은 로딩 웰 플레이트에 종래의 샌드위치 ELISA의 것과 매우 유사하다.

바코드 antibodY 마이크로 어레이는 유체 샘플에서뿐만 아니라, 단일 세포에서의 바이오 마커를 검출하기 위해 사용될 수있다. 단일 세포 분석은이 프로토콜의 초점 아니므 우리는 단순히 사이토킨 검출 항체를 3 × 3의 마이크로 어레이의 적용을 예시. 항체 - 표면 마커의 상호 작용을 통해, 분화 (8)의 클러스터 (CD8)는 양성 세포는 마이크로 어레이 소자 (도 3G] 위에 PDMS 칩) 중 하나를 포착하고, 요소의 나머지 (분비 된 사이토 카인을 검출하기 위해 사용 된 그림 3H). 이 셀 캡쳐 방법으로, "셀 어레이는"을 형성 할 수있다. 이 배열 캡처 기술은 각 ELISA 실험을 실시 세포의 수를 제어 가능하다. 검출 된 단백질의 특정 단셀에 관한 것이었다되도록 세포 microchambers 물리적으로 분리되었다. 도 3H에 도시 된 바와는 각각 microchamber은 캡슐화를 보장하기 위해 16 마이크로 어레이 소자가 장착되어 있는지완전한 3 × 3 마이크로 어레이를 설정합니다.

그림 1
도 1 및 설계 흐름 기반 DNA 패터닝 PDMS 바코드 용 금형의 제작. 패널 (A)은 수평 및 수직 일차원 바코드 패턴 AutoCAD 도면을 도시한다. 패널 (B)는 (A)에서 수평 및 수직 중첩 바코드 패턴을 나타낸다. 녹색 상자는 분리 된 3 × 3 배열 패턴 영역을 묶습니다. SU-8 마스터 제조 (C) 크롬 마스크입니다. (D) 실리콘 웨이퍼 상에 제조 된 SU-8 마스터. (E) 흐름 패턴에 대한 설정입니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 2 그림 2. 건설 및 3 × 3의 DNA 배열의 검증.이 그림은 왕, 제이 등. 2012, 나노 레트 (12) ", 아교 모세포종 홍반 암 세포에 응용 프로그램과 세포 - 세포 상호 작용 기능을 정량"에서 수정되었습니다 . 미국 화학 학회 저작권 2012. 허가 적응. DNA 흐름 패터닝 단계에 대한 (A) 방식. 1D 바코드의 (수직 라인으로 추적) 선택 영역에서 20 채널 (B) 형광 강도 프로파일. Cy3에 접합 된 올리고 뉴클레오티드는 확인을 위해 DNA 어레이와 하이브리드했다. 두 번째 DNA 패터닝 단계를 완료 한 후 Cy3에 접합 된 DNA와 검증 배열 (C) 형광 강도 프로파일. (D) 다른 플로리다에서 출발하는 대체 형광 패턴전략 - 패터닝 아야. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 3
3 × 3 마이크로 어레이의 그림 3. 응용 프로그램. (A) 방식 항체 올리고 뉴클레오티드 거래 복합체의 합성. 항체 - 올리고 뉴클레오티드 콘쥬 게이트와 혼성화를 통한 항체 배열 DNA 어레이의 전환 (B) 방식. 샌드위치 ELISA 플랫폼에 3 × 3 마이크로 어레이를 이용하기위한 (C) 방식. 이 수치는 왕, 제이 등. 2012, 나노 레트 (12) ", 아교 모세포종 홍반 암 세포에 응용 프로그램과 세포 - 세포 상호 작용 기능을 정량"에서 수정되었습니다. 저작권 (20)미국 화학 학회 12. 허가 적응. 패널 (D)는 Cy5에 채널에서 발생하는 형광 판독을 보여줍니다. 이 6 단백질을 감지 샌드위치 ELISA 실험에 해당합니다. 패널 (E)입니다 확대 된를 Cy3와 Cy5에 채널에서 3 × 3 배열 판독의 프로필. 패널 (F)은 재조합 단백질에 대한 샌드위치 ELISA 교정 곡선을 나타낸다. 패널 (G)이 배열 된 항체와 결합을 통해 세포를 포착함으로써 형성 "셀 어레이"를 나타낸다. 패널 (H)는 마이크로 칩의 microchambers 중첩 검출 결과를 보여줍니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

1
해결책 올리고 뉴클레오티드 조성
A'-I, B'-II, C'-III
(2) A'-IV, B'-V, C'-VI
3 A'-VII, B'-VIII, C'-IX

DNA 흐름 패턴 화를위한 솔루션 1-3 표 1. 구성.

앵커 시퀀스
에이 ATCCTGGAGCTAAGTCCGTA-AAAAAAAAAAAAAAAAAAAA - ATCCTGGAGCTAAGTCCGTA - AAAAAAAAAAAAAAAAAAAA
GCCTCATTGAATCATGCCTA-AAAAAAAAAAAAAAAAAAAA - GCCTCATTGAATCATGCCTA-
AAAAAAAAAAAAAAAAAAAA
기음 GCACTCGTCTACTATCGCTA-AAAAAAAAAAAAAAAAAAAA - GCACTCGTCTACTATCGCTA - AAAAAAAAAAAAAAAAAAAA
시퀀스를 브리징
일체 포함 TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA - ATGGTCGAGATGTCAGAGTA
B'-II TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA - ATGTGAAGTGGCAGTATCTA
C'-III TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA - ATCAGGTAAGGTTCACGGTA
A'-IV TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA - GAGTAGCCTTCCCGAGCATT
B'-V TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA - ATTGACCAAACTGCGGTGCG
C'-VI TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA - TGCCCTATTGTTGCGTCGGA
A'-VII TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA - TCTTCTAGTTGTCGAGCAGG
B'-VIII TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA - TAATCTAATTCTGGTCGCGG
C'-IX TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA - GTGATT AAGTCTGCTTCGGC
검증을위한 CY3 - 복합 올리고 뉴클레오티드
에이' TACGGACTTAGCTCCAGGAT
비' TAGGCATGATTCAATGAGGC
기음' TAGCGATAGTAGACGAGTGC
나는' TACTCTGACATCTCGACCAT
II ' TAGATACTGCCACTTCACAT
III ' TACCGTGAACCTTACCTGAT
IV ' AATGCTGGGGAAGGCTACTC
V' CGCACCGCAGTTTGGTCAAT
VI ' TCCGACGCAACAATAGGGCA
'VII CCTGCTCGACAACTAGAAGA
'VIII CCGCGACCAGAATTAGATTA
IX ' GCCGAAGCAGACTTAATCAC
"fo를 : 유지 - together.within 페이지를 ="1 "> 표 2. DNA 흐름 패터닝에 사용되는 시퀀스.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

흐름 패턴 디자인은 2-D 마이크로 어레이를 제조하는데 중요한 첫 단계이다. 유리 기판 상에 겹치는 두 DNA 패턴을 생성하기 위해, 제 디자인의 채널 특징은 초 (도 1A-B)들에 수직이어야한다. 디자인은 또한 마이크로 어레이의 다운 스트림 응용 프로그램을 고려합니다. 단일 세포 분석의 경우, 마이크로 어레이는, 따라서 채널 치수는 2-D 어레이에 정렬 microchambers 양립되어 microchambers 묶인 단일 세포로부터 단백질을 검출하기 위해 사용된다. 각 설계는 포토 마스크에 렌더링되고, 표준 포토 리소그래피 기술은 실리콘 웨이퍼 (도 1C-D)에 SU-8의 채널 특징을 제조하기 위해 사용된다. 이 성형 용 PDMS 마스터로서 기능한다. 주형이 제조되면, 그것을 PLL - 코팅 슬라이드에 결합하고, 질소 가스 유량 설정 (도 1E)에 연결되어있다. 셋업 우리사용이 간단하고 용이하게 압력 조절 질소 가스 공급원과 어떠한 실험실에 혼입된다는 장점이있다. 우리는 질소 가스 탱크에 연결된 여러 저가 3 방향 밸브 조립체를 사용한다. 패터닝을위한 공기 유동이 주형으로부터 유리 슬라이드의 박리를 방지하기 위해 낮은 압력 (0.5 psi) 이상으로 유지되어야한다. PDMS 몰드 내에서 누수 패턴의 무결성을 손상시킬 수 있습니다.

이 프로토콜의 DNA 흐름 패터닝 단계는 엄선 된 직교 시퀀스 (그림 2A)로 ssDNA를을 사용한다. 종래 흐르지 패터닝은, 이들 올리고 뉴클레오티드의 서열은 고유 한 크로스 토크의 부재에 대해 시험한다. 크로스 토크에 대한 간단한 테스트는 우리가 우리의 프로토콜에 소개 유효성 검사 절차 (2 단계)를 수정하여 수행됩니다. 대신 사용하는 칵테일을 Cy3에 상보 DNA를 표지 된 상보적인 서열의 한 유형은 슬라이드의 선택된 영역에 대해 시간에 사용되는 다수의DNA 서열이 고정됩니다. DNA의 크로스 토크가없는 경우, 단지 (1-D DNA 어레이에 대한) 하나 또는 스트라이프 (2-D DNA 어레이에 대한) 하나의 스폿을 Cy3 필터 형광등 아래한다. 충분히 검증 직교 시퀀스의 예로는 재료 및 장비의 테이블에서 찾을 수있다. 제 DNA 패터닝 단계는 "앵커"세 종류의 올리고 뉴클레오티드를 도입한다. 이 80 NT 시퀀스는 두 개의 고유 한 20 메르 시퀀스로 대체이 20 메르 폴리 영역으로 구성된다. 이러한 앵커 서열에 5'- 아민 변형 아민 아민 BS3에 의해 매개되는 PLL 17을 상호 연결하는 것이 필요하다. 두번째 DNA 패터닝 단계는 가교제를 필요로하지 않는다. 이 단계는 부분적으로 앵커 시퀀스와 하이브리드 "브릿지"올리고 뉴클레오타이드를 소개합니다. 각 60 NT 브리징 시퀀스는 하나의 앵커 순서, 20 메르 폴리 스페이서, 독특한 20 머 서열에 상보 20 메르 영역으로 구성되어 있습니다. DNA 어레이의 유효성 (FigurE 2B-C)은 패터닝 공정의 품질을 평가하고 더 교차 오염 14 없도록 모든 DNA 흐름 패터닝 공정 후에 수행된다. 이것은 DNA 혼성화 패턴을 Cy3 공역 올리고 뉴클레오티드 프로브를 도입함으로써 수행된다. 형광 강도를 분석하는 단계 (2.3.2)에서 지정된 파라미터와, 패턴을 DNA 마이크로 어레이를 사용하여 수행 하류 면역 분석법의 감도를 최대화하기 위해 최소한 40,000 Au로 형광 강도를 나타내는 것이다. 검증으로는 Cy3-DNA 다른 세트의 전략적 이용은 이와 같이 8 단계 DNA 패터닝의 유연성을 보여주는 대안적인 패턴 (도 2D)를 일으킨다. 누수 또는 (먼지 입자 등) 기계 장애물에서 발생할 수 균일 한 패턴을 달성하지 않으면 흐름 패터닝 단계에서 발생했습니다.

항체 올리고 뉴클레오티드 거래 복합체의 제조는 일의 또 다른 중요한 단계입니다프로토콜입니다. 항체의 선택은 연구중인 생물학적 시스템에 의해 결정된다. 접합에 사용 된 올리고 뉴클레오티드는 DNA 어레이에 고정 된 것과 상보적인 서열을 가져야한다. S-4FB 및 S-HyNic 링커의 재고 솔루션은 갓 준비 및 가수 분해를 방지하기 위해 습기에서 보관해야합니다. 우리의 결합 프로토콜에 사용되는 배양 시간은 항체 및 DNA에서 원하는 기능을 소개하기에 충분히 긴. 최종 커플 링 반응은 반응 FPLC 통해 S-4FB 공역 올리고 뉴클레오티드를 제거하여 켄칭된다. 따라서, FPLC 정제 접합을 완료 한 후 즉시 수행한다. 우리의 프로토콜에서 설명한 시스템, 낮은 유량 (0.2에서 0.25 사이 ㎖ / 분)로 FPLC를 수행하는 경우에도 해상도를 향상시키기 위해 사용될 수있다. 접합체는 좁고 높은 DNA 피크 (17 ~ 20 ㎖의 용출 볼륨) 앞에 나타나는 넓은 피크 (약 9-15 ml로 용출 볼륨)으로 용출된다. 우리는 솔루션을 저장하지 않는 것이 좋습니다초과 S-4FB-DNA와 복합체의이 과잉 작용 DNA와 결합시 항체의 항원 결합 부위의 손실을 초래할 수 있기 때문이다. DEAL 접합체를 사용하여 샌드위치 ELISA를 감도, 특이성, 재현성이 이전의 연구에서 증명되었다. 8,9,11,12,16를 항체 DNA 접합체의 품질을 평가하기 위해, 접합체를 생성하는 DNA 배열에서 배양 될 수있다 이어서 단백질 검출 (도 3f)에 대한 보정 곡선을 생성하기 위해 샌드위치 ELISA 실험에 사용 된 항체 어레이. 이러한 보정 커브를 생성하기 위해, 종래의 샌드위치 ELISA 키트에 재조합 단백질이 사용될 수있다. 고품질 접합체의 사용은 장비의 것과 유사한 선형 및 검출 범위의 하한을 야기한다. 예를 들어, 우리의 항체 어레이에 대한 샌드위치 ELISA TNFα 및 INFγ를위한 하한 (도 3f)은 PG가 ~ 50-100 / ㎖가 있으며 consisten 아르기존의 샌드위치 ELISA 키트의 제품 데이터 시트에 표시된 ~ 15-1,000 페이지 / ㎖의 선형 검출 범위와 T. 하류 샌드위치 ELISA 실험에서 얻어지는 신호가 약한 판독은 DNA 어레이, 또는 공액 DNA 용액에 과량의 간섭, 또는, 항체 ssDNAs의 불완전한 접합의 낮은 품질에 기인 할 수있다.

항체 어레이에 샌드위치 ELISA를 수행하기위한 주요 관심사와 시약 사이의 신호가 실제 생체 이벤트를 반영 여부 크로스 토크를 포함한다. 우리는이 프로토콜에서 사용하는 직교 DNA를 철저하게 0.1 % 미만의 크로스 토크를 가지고 확인되었다. 따라서 면역 단계에서 관찰 된 어떠한 누화는 항체 및 ELISA 시약 주로이다. 어레이 항체 사이의 크로스 토크에 대해 테스트하는 것은 실제 시료의 분석을 수행하기 전에 수행되어야한다. 항체 패널이 구성되면, 약간의 샌드위치 ELISA 제어 실험은 퍼포 레이션되어야검출 항체없이 항원없이 1, 2, 3 및 검출 항체 및 표지 시약만을 다음 조건 ORMED. 크로스 토크는 면역 단계에서 관찰되는 경우, 항체 쌍 및 / 또는 ELISA 시약은 대체되어야한다. 이는 종래의 ELISA 키트에서 시판 항체의 사용은 어레이 기반 샌드위치 ELISA 기법에 적용 가능성을 보장하지 않는다는 것을 유의해야한다.

이 기술의 장점은 저렴한 제조, 소형 크기, 디자인의 유연성을 포함한다. 우리의 제조 프로토콜은 항체 배열의 많은 사용자가 사용할 수 없습니다 마이크로 어레이 감시인이 필요하지 않습니다. 유동 패터닝 셋업 간단한 실험실에서 쉽게 조립 될 수있다. 포토 리소그래피 용 장치가 장착되지 않은 실험실, 우리의 프로토콜에 우리가 제공하는 CAD 디자인은 미세 서비스를 제공하는 회사로 전달 될 수있다. 기존의 마이크로 어레이로 소형화우리의 프로토콜을 사용하여 제작 된 조밀 한 배열은 단일 세포 실험에 사용 된 마이크로 칩과의 호환성을 위해 수 있습니다. 우리의 프로토콜은 먼저 항체 배열로 변환하기 전에 ssDNA를 배열과 배열의 생산을 갖추고 있습니다. ssDNAs와 예비 패터닝는 많은 장점을 가지고있다. 먼저 ssDNAs 따라서 ssDNA를 패터닝 슬라이드 상당한 열화 8,16없이 적어도 6 개월 건조기에 저장 될 수 있고, 항체에 비해 화학적으로보다 안정하다. 둘째, 우리의 방법은 최종 사용자에게 단순히 마이크로 어레이의 변형없이 용액에 함께 선택적 접합체를 혼합하여 필요한 분석을 선택할 수있는 유연성을 구비하고; 반대로, 종래의 단백질 / 항체 어레이는 사전 설계된 기판 상에 고정되어 있으므로 어 세이의 변화는 처음부터 단백질 / 항체의 패터닝 / 프린팅을 필요로한다. 대표적인 연구는 높은 처리량 바코드 항체 마이크로 어레이의 사용을 설명 detectio하나의 세포에서 여러 신호 단백질의 N. 흐름 패턴의 디자인 및 / 또는 사용 된 올리고 뉴클레오티드 패터닝 솔루션을 변화시킴으로써, 어레이 레이아웃은 다수의 탐색 할 수있다. 이 응용 프로그램의 예로서, 하나의 셀로부터의 기능성 단백질을 연구 할 수있다. 단일 세포 분석 용 칩은 8,700 ~ microchambers, 완전한 항체 3 × 3 어레이 (도 3H)와 정렬 된 각각의 수만큼 포함한다. 이러한 셋업은 높은 처리량 검출 할 수 있습니다. microchambers에서 배양 세포에 의해 분비되는 단백질이 배열에 의해 검출 될 수있다. 다양한 마이크로 어레이 디자인은 또한 다른 일반적인 구성 요소 8,15와 마이크로 어레이를 결합 후 혈청, 세포 용 해물, 그리고 하나의 세포에서 단백질의 다중 검출 할 수 있습니다. 단백질 검출에 더하여, 3 × 3 배열 항체는 세포 포착 (도 3G)에 유용하다.

이 접근법의 주요 단점은 라이트 인 COMPL종래 마이크로 어레이의 제조와 비교 exity. 제작 된 배열의 특정 응용 프로그램을 고려하여 패터닝 및 배열 디자인 전략은 신중하게 개념화해야합니다. 이 접근법은 또한 크로스 토크에 대한 검증 및 테스트 절차를 포함 중요한 단계들을 필요로한다. 3 × 3 어레이가 우리의 프로토콜을 사용하여 한번에 7 단백질을 검출하는 구성으로 제한된다. 그러나,이 제한은 큰 배열을 만들어 능가 할 수있다. 여기에 추천 프로토콜은 3 × 3의 마이크로 어레이 제조에 한정되지 않는다. 우리는 성공적으로 5 × 5 마이크로 어레이 및 배열 요소의 다른 차원을 제조 할 수 있었다. 원칙적으로, 다른 n 개의 X의 어레이는 m만큼 예비 DNA 패터닝 어레이를 만드는 데 사용되는 올리고 뉴클레오티드 세트 어레이 요소 사이의 크로스 토크를 방지 직교으로 유사한 기술을 이용하여 제조 될 수있다. 확장 어레이의 생성 흐름에 의해 달성된다 patterniNG ssDNA를 N 타입의 제 패터닝 공정 ssDNA를위한 시퀀스를 브리징 n 개의 X의 m 뒤에 제 DNA 패터닝 공정, 고정 장치. 브릿지 시퀀스는 A'-내가 E'-XXV가 동시에 이용되는 예를 들어, 5 × 5 어레이를 만들기 위해, E에 앵커 시퀀스가 사용될 수있다. 이것은 단지 하나의 DNA 유동 패터닝 공정을 이용했지만 유동 패터닝 공정을 자동화, 로봇 플랫폼 (18)이 개발되었다. 두 단계의 전환이 제 패터닝 단계 이후에 제 PDMS 몰드 박리 수동으로 요구할 수도 있지만, 원칙적으로 동일한 플랫폼 것이다 세정 다음과 밀어 (이 단계를 건조, 수직 흐름 패턴의 두 번째 단계로 확장 될 수있다 수직으로 배향 된 제 패터닝 공정을 용이하게하기 위해 다른 PDMS 몰드와 슬라이드 교미 전)는 약 10 분 걸릴.

우리는 패턴 N × M 개의 어레이를 제조하기위한 세부 절차를 논의했다프로테오믹스 연구와 세포 신호 미래의 응용 프로그램에 대한 큰 약속을 보유하고 높은 밀도에서 항체. 여기에 제시된 프로토콜은 다른 목적을 위해보다 정교한 DNA / 항체 배열의 건설을위한 가이드 역할을 할 수있다.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Sylgard 184 silicone elastomer base Dow Corning 3097366-1004
Sylgard 184 silicone elastomer curing agent Dow Corning 3097358-1004
SU-8 2025 photoresist MicroChem Y111069
Silicon wafers  University Wafers 452
Poly-L-lysine coated glass slides Thermo Scientific C40-5257-M20
Oligonucleotides Integrated DNA Technologies *Custom-ordered from Integrated DNA Technologies, see Table 2.
Poly-L-lysine adhesive stock solution Newcomer Supply 1339
Bis (sulfosuccinimidyl) suberate  (BS3) Thermo Scientific 21585
1x Phosphate buffered saline, pH 7.4 Quality Biological 114-058-101
Äkta Explorer 100 Fast Protein Liquid Chromatography (FPLC) System GE (Amersham Pharmacia)  18-1112-41
Superose 6 10/300 GL column GE Healthcare Life Sciences 17-5172-01
Capture antibodies various various *Antibody selection depends on application
Succinimidyl-6-hydrazino-nicotinamide (S-HyNic) Solulink S-1002
Succinimidyl-4-formylbenzamide (S-4FB) Solulink S-1004
N,N-dimethylformamide Sigma-Aldrich 227056
Citric acid, anhydrous Acros 42356
Sodium hydroxide Fisher Scientific S318
Amicon Ultra spin filter 10 kDa MWCO EMD Millipore UFC201024
Spin coater Laurell Technologies WS-650-MZ
Biopsy punch with plunger (1.0 mm diameter) Ted Pella, Inc. 15110-10
Diamond scribe (Style 60) SPI supplies 6004
Trimethylchlorosilane Sigma Aldrich 92361

DOWNLOAD MATERIALS LIST

References

  1. Alhamdani, M. S. S., Schroder, C., Hoheisel, J. D. Oncoproteomic profiling with antibody microarrays. Genome Med. 1, (7), (2009).
  2. Angenendt, P. Progress in protein and antibody microarray technology. Drug Discov Today. 10, (7), 503-511 (2005).
  3. Sun, H. Y., Chen, G. Y. J., Yao, S. Q. Recent advances in microarray technologies for proteomics. Chem Biol. 20, (5), 685-699 (2013).
  4. Fan, R., et al. Integrated barcode chips for rapid, multiplexed analysis of proteins in microliter quantities of blood. Nat Biotechnol. 26, (12), 1373-1378 (2008).
  5. Chattopadhyay, P. K., Gierahn, T. M., Roederer, M., Love, J. C. Single-cell technologies for monitoring immune systems. Nat Immunol. 15, (2), 128-135 (2014).
  6. Varadarajan, N., et al. Rapid, efficient functional characterization and recovery of HIV-specific human CD8(+) T cells using microengraving. Proc Natl Acad Sci USA. 109, (10), 3885-3890 (2012).
  7. Ma, S., et al. Electroporation-based delivery of cell-penetrating peptide conjugates of peptide nucleic acids for antisense inhibition of intracellular bacteria. Integr Biol-Uk. 6, (10), 973-978 (2014).
  8. Wang, J., et al. Quantitating cell-cell interaction functions with applications to glioblastoma multiforme cancer cells. Nano Lett. 12, (12), 6101-6106 (2012).
  9. Kravchenko-Balasha, N., Wang, J., Remacle, F., Levine, R. D., Heath, J. R. Glioblastoma cellular architectures are predicted through the characterization of two-cell interactions. Proc Natl Acad Sci USA. 111, (17), 6521-6526 (2014).
  10. Xue, M., et al. Chemical methods for the simultaneous quantitation of metabolites and proteins from single cells. J Am Chem Soc. 137, (12), 4066-4069 (2015).
  11. Shi, Q. H., et al. Single-cell proteomic chip for profiling intracellular signaling pathways in single tumor cells. Proc Natl Acad Sci USA. 109, (2), 419-424 (2012).
  12. Ma, C., et al. A clinical microchip for evaluation of single immune cells reveals high functional heterogeneity in phenotypically similar T cells. Nat Med. 17, (6), 738-743 (2011).
  13. Deng, Y., et al. An integrated microfluidic chip system for single-cell secretion profiling of rare circulating tumor cells. Sci Rep. 4, 7499 (2014).
  14. Vermesh, U., et al. High-density, multiplexed patterning of cells at single-cell resolution for tissue engineering and other applications. Angew Chem Int Ed. 50, (32), 7378-7380 (2011).
  15. Yu, J., et al. Microfluidics-based single-cell functional proteomics for fundamental and applied biomedical applications. Annu Rev Anal Chem. 7, 275-295 (2014).
  16. Bailey, R. C., Kwong, G. A., Radu, C. G., Witte, O. N., Heath, J. R. DNA-encoded antibody libraries: A unified platform for multiplexed cell sorting and detection of genes and proteins. J Am Chem Soc. 129, 1959-1967 (2007).
  17. Alegria-Schaffer, A. General protein-protein cross-linking. Methods Enzymol. 539, 81-87 (2014).
  18. Ahmad, H., et al. A robotics platform for automated batch fabrication of high density, microfluidics-based DNA microarrays, with applications to single cell, multiplex assays of secreted proteins. Rev Sci Instrum. 82, 094301 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics