Flow-modello Fabrication guidata della alta densità di codici a barre anticorpo Microarray

Chemistry

Your institution must subscribe to JoVE's Chemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Questo protocollo descrive la fabbricazione di una grande scala, DNA o anticorpi array bidimensionale multiplato, con potenziali applicazioni in studi di segnalazione cellulare e rilevazione biomarker.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Ramirez, L. S., Wang, J. Flow-pattern Guided Fabrication of High-density Barcode Antibody Microarray. J. Vis. Exp. (107), e53644, doi:10.3791/53644 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Microarrays dell'anticorpo sono stati ampiamente utilizzati in studi di proteomica per decenni per esaminare la presenza di proteine ​​mirate, tra cui proteine ​​biomarcatori 1-3. Anche se questo campo è attualmente di fronte a grandi sfide da altre tecnologie high-throughput come la spettrometria di massa (MS), c'è ancora molto spazio per l'utilità di microarrays dell'anticorpo, soprattutto perché questi dispositivi offrono semplice interpretazione dei dati e facile interfaccia con altri test. Negli ultimi anni, l'integrazione dei microarrays in ponteggi microchip ha fornito microarray anticorpo una nuova opportunità di prosperare 4-7. Ad esempio, il codice a barre microarray integrato in un microchip monocellulare è stato usato in studi di comunicazione cellulare 8,9. Questa tecnologia presenta notevoli vantaggi rispetto ad altre tecnologie microarray disponibili. È dotato di elementi di un array a 10-100 micron, molto più piccolo del tipico 150 micron dimensioni utilizzate in elemen microarray convenzionalits. La costruzione di elementi di un array più piccoli si ottiene utilizzando approcci sistematici flusso-patterning, e questo dà luogo a microarray compatti in grado di rilevare le proteine ​​unicellulare secrete e proteine ​​intracellulari. Un altro vantaggio è l'uso di una installazione senza strumento semplice. Ciò è particolarmente importante, perché la maggior parte dei laboratori e piccole imprese non siano in grado di accedere ai servizi di base di microarray. Microarrays dell'anticorpo Tale funzione avanzata di codici a barre di throughput test e possono essere utilizzati per eseguire analisi altamente multiplex su singole cellule, raggiungendo un'elevata sensibilità e specificità paragonabile a quella del convenzionale immunosorbent assay panino enzyme-linked (ELISA 8). Questa tecnologia ha trovato numerose applicazioni nel rilevare proteine ​​da glioblastoma 9-11, le cellule T 12, e cellule tumorali circolanti 13. In alternativa, microarray di DNA barcode sola sono stati utilizzati nel posizionamento preciso dei neuroni e astrociti per Mimickzione l'assemblea in vivo del tessuto cerebrale 14.

Questo protocollo si concentra solo sui gradini sperimentali e blocchi di accumulo di bidimensionale (2-D) del codice a barre microarray anticorpo che ha potenziali applicazioni nel rilevamento dei biomarcatori in campioni fluidici e in singole cellule. La tecnologia è basata su un indirizzabile a singolo filamento, unidimensionale (1-D) microarray DNA costruite con oligonucleotidi ortogonali che sono modellate spazialmente su substrati di vetro. Il modello 1-D si forma quando i canali di flusso paralleli sono utilizzati nel passaggio di flusso-patterning, e un tale modello appare come bande discrete visivamente simili a 1-D Universal Product Code (UPC) di codici a barre. La costruzione di una matrice 2-D anticorpi (n x m) - ricorda un codice a matrice 2-D Quick Response (QR) - richiede strategie patterning più complesse, ma permette l'immobilizzazione di anticorpi ad una densità più alta 8,15. La fabbricazionerichiede due fasi patterning DNA, con il primo pattern perpendicolari al secondo. I punti di intersezione di questi due modelli costituiscono i n x m elementi della matrice. Selezionando strategicamente le sequenze di DNA a singola elica (ssDNA) utilizzati in flow-patterning, ogni elemento in un dato array viene assegnato un indirizzo specifico. Questo riferimento spaziale è necessario distinguere tra segnali di fluorescenza sul vetrino microarray. L'array ssDNA viene convertito in un array di anticorpi attraverso l'incorporazione di coniugati DNA-anticorpo complementari, formando una piattaforma chiamata biblioteca anticorpi DNA-codificato (DEAL 16).

Questo protocollo video descrive i passaggi chiave nella creazione di array nxm anticorpi che comprendono la preparazione di polidimetilsilossano (PDMS) stampi di codici a barre, flow-patterning ssDNA in due orientamenti, la preparazione di anticorpi coniugati oligonucleotide DEAL, e convertendo l'array 3 x 3 DNA in una 3x 3 matrice anticorpo.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Attenzione: Diversi prodotti chimici utilizzati in questo protocollo sono irritanti e sono pericolosi in caso di contatto con la pelle. Consultare le schede di sicurezza dei materiali (MSDS) e indossare dispositivi di protezione adeguati prima di eseguire questo protocollo. La soluzione piranha utilizzato nel passaggio (1.1.1) è altamente corrosivo e deve essere preparata con l'aggiunta del perossido lentamente all'acido con agitazione. Maneggiare questa soluzione con estrema cautela in una cappa aspirante. Usare occhiali di protezione adeguato e guanti resistenti agli acidi. Trimetilclorosilano (TMCS) è un corrosivo, chimico infiammabile utilizzato in un passaggio facoltativo dopo (1.1.6). Gestire questa sostanza chimica in una cappa aspirante.

Nota: Eseguire la fabbricazione di codici a barre di scorrimento e le procedure di flow-patterning critici in una camera pulita per minimizzare la contaminazione da particolato. Le particelle di polvere possono bloccare le porte e le microcanali di stampi PDMS e interferire con il flusso-patterning.

1. Costruzione del One-dimensionall DNA Barcode diapositive

  1. Preparazione del master SU-8 per modelli di flusso barcode
    Nota: I disegni per i modelli di flusso perpendicolare (figura 1A-B) vengono creati utilizzando un software per computer-aided design (CAD). Questi modelli sono resi su una fotomaschera cromato. Le aree trasparenti della maschera corrispondono alle caratteristiche del maestro SU-8.
    1. Pulire un wafer di silicio (diametro 100 mm) a fondo in una miscela di 3 H 2 SO 4: 1 30% H 2 O 2 (soluzione Piranha) riscaldata a 96 ° C. Lavare il wafer con acqua deionizzata e alcol isopropilico, seguito da essiccazione con una pistola di azoto colpo.
    2. Versare circa 4 ml di SU-8 2025 photoresist sul wafer. Utilizzare uno spin coater programmabile per diffondere uniformemente il fotoresist sul wafer per 10 sec a 500 rpm, quindi 30 secondi a 3000 rpm. Questo crea uno strato di resina fotosensibile con uno spessore di ~ 25 micron. Gradualmente permettono filando a rallentare prima di fermarsi - questo è quello di Maintain anche un rivestimento sulla superficie del wafer.
    3. Cuocere il wafer rivestito su una piastra per 1 min a 65 ° C, poi per 5 minuti a 95 ° C. Questa fase permette il rivestimento solidificare. Raffreddare a temperatura ambiente per 5 minuti.
    4. Posizionare la maschera di cromo (Figura 1C) sul manto di resina fotosensibile. Esporre le caratteristiche della maschera alla luce vicino-UV (350-400 nm, energia esposizione 150-160 mJ / cm 2) per 20 sec.
      Nota: Il disegno sulla maschera cromo contiene 20 canali, ciascuno dei quali 20 micron di larghezza con 50 micron passo. I canali sono tortuose da un'estremità del modello all'estremità opposta. Complessivamente, i 20 canali coprono un'area rettangolare con una lunghezza di ~ 40 mm e una larghezza di 20 mm ~. Ogni canale è fiancheggiato da due elementi circolari che corrispondono a un ingresso ed una uscita. Ingressi e le uscite sono intercambiabili.
    5. Cuocere la cialda esposta su una piastra per 5 min a 95 ° C. Raffreddare a Rt gradualmente.
    6. Immergere il wafer di SU-8 sviluppatore con agitazioneper 5 min. Lavare il wafer con una piccola porzione di fresco SU-8 sviluppatore, seguito da alcol isopropilico. Asciugare il wafer con una pistola di azoto colpo. Hard-bake il wafer su una piastra riscaldante a 200 ° C per 30 min, e consentire il wafer raffreddare gradualmente a RT.
      Nota: lo sviluppo può essere eseguita per un tempo più lungo se una pellicola bianca si osserva dopo il lavaggio in questa fase.
      Opzionale: Silanizzazione il SU-8 master esponendolo alla trimetilclorosilano vapore in una capsula di Petri chiusa per 10 minuti.
  2. Preparazione dello stampo PDMS barcode
    1. Combina 40,0 g elastomero siliconico base con 4,0 g agente indurente. Lavorare l'impasto prepolimero vigorosamente per 10 min. Degas per 20 minuti sotto vuoto.
      Nota: Come regola generale, utilizzare un 10: 1 (base: induritore) rapporto di massa.
    2. Versare il prepolimero in una capsula Petri contenente un wafer di silicio con il SU-8 padrone del modello codice a barre. L'altezza della miscela PDMS dovrebbe essere di circa 7.5 mm o superiore. Degassare la miscela nella Petri piatto per una seconda volta per rimuovere eventuali bolle rimanenti, quindi cuocere la miscela per 1 ora a 75 ° C per consentire PDMS per curare.
      Nota: È importante mantenere abbastanza spessore della lastra PDMS a ~ 7.5 mm o superiore per evitare di aggiungere troppa tensione al legame PDMS vetro all'inserimento dei perni / tubi attraverso i fori dello stampo PDMS nel passaggio (1.3.3.1)
    3. Usando un bisturi, accuratamente tagliare intorno alla zona della lastra PDMS che contiene gli stampi di codici a barre e sbucciare la lastra dal wafer.
    4. Tagliare i bordi della lastra per ottenere la forma desiderata dello stampo PDMS barcode. Punch 20 fori (diametro 1,0 mm) attraverso lo stampo con un pugno biopsia con stantuffo. Assicurarsi che i fori siano allineati con le caratteristiche circolari del modello di codice a barre. Questi fori servono come gli ingressi e le uscite.
  3. Patterning monodimensionale di poli-L-lisina (PLL)
    1. Rimuovere la polvere sulla superficie di un vetrino rivestito con poli-L-lisina utilizzando una pistola azoto colpo. Attach lo stampo PDMS al vetrino pulito. Assicurarsi che i bordi dello stampo e la slitta sono allineati.
    2. Cuocere per 1,5 ore a 75 ° C per rafforzare il legame tra lo stampo PDMS e il vetrino PLL rivestite. Nel frattempo, preparare 20 pezzi di tubo di polietilene flessibili (da 3 a 4 pollici pezzi, con un diametro interno di 0,5 mm e un diametro esterno di 1,5 mm).
      Nota: Il numero di pezzi di tubo corrisponde al numero di ingressi nello stampo PDMS barcode. Il tubo serve ad accoppiare i canali sul codice a barre stampo PDMS ad un serbatoio di azoto dotato di un regolatore di pressione.
    3. Ad una estremità di ogni pezzo di tubo, collegare un acciaio inossidabile perno cavo (diametro 1 mm). Aspirare filtrata sterile soluzione attraverso il perno poli-L-lisina, fino almeno 1 cm del tubo è riempito con la soluzione.
      1. Fissare i perni (collegati alla tubazione soluzione pieno) alle prese del codice a barre di stampo PDMS (Figura 1E). Attaccare l'altra estremità dei tubiun serbatoio di azoto con regolazione della pressione di set-up. Lasciare la soluzione di fluire attraverso lo stampo con un intervallo di pressione di 0,5-1 psi per almeno 6 ore.
        Nota: Fare riferimento al punto (1.3.3) per tutte le procedure di flusso-patterning.
  4. Patterning unidimensionale del ssDNA 14
    Nota: Il tampone fosfato salino (PBS) utilizzati in fasi successive viene preparato da 137 mM NaCl, 10 mM Na 2 HPO 4, e 2 mM KH 2 PO 4. Il pH del tampone è 7.4.
    1. Preparare bis suberato (BS3) Soluzione 2 mm (sulfosuccinimidyl) in PBS. Preparare 300 pM soluzioni di A, B, e C ssDNA (5'-ammina modificata, 80 nucleotidi) in PBS o acqua ultrapura.
      Nota: Utilizzare la soluzione BS3 entro circa 30 minuti dopo la preparazione, perché la -hydroxysuccinimide estere N subisce facilmente idrolisi.
    2. Combinare 2,5 ml di 300 mM A, B, C o ssDNA con 2,5 ml di 2 mM bis (sulfosuccinimidyl) suberato in PBS per ciascun canale. A B, C e DNA, sono designati ai canali 1, 2, e 3, rispettivamente. Questo ordine è applicato anche ai restanti gruppi di 3 canali (Figura 2A).
    3. Eseguire il passo (1.3.3). Questa volta, aspirare il 5-microlitri soluzioni BS3 / DNA attraverso perni in acciaio inox e in tubo di polietilene, quindi coppia lo stampo PDMS la fonte di azoto. Lasciare la soluzione BS3 / DNA di fluire attraverso lo stampo barcode per circa 40 minuti o fino a che i canali vengono riempiti.
    4. Arrestare il flusso una volta tutti i canali sono pieni, poi incubare la soluzione BS3 / DNA nel codice a barre a temperatura ambiente per 2 ore. Non lasciare che la soluzione per asciugare. Cuocere lo stampo PDMS con annesso scivolo codice a barre per 1 ora a 75 ° C.
      Nota: Per facilitare la regolazione in successive fasi di flusso-patterning, i bordi del modello di canale sul vetrino barcode possono essere delineati. Questo viene fatto graffiare cura la superficie di vetro con un Scrib diamantee per generare segni di allineamento sulla parte inferiore del vetrino. Allineamento in fasi successive del protocollo può essere controllato al microscopio.
    5. Togliere lo stampo PDMS dalla diapositiva codice a barre. Lavare il vetrino delicatamente con lo 0,01% SDS volte una volta e tre con acqua ultrapura.
      1. Asciugare il vetrino del codice a barre con un filatore vetrino da microscopio. Conservare il vetrino di codici a barre in un ambiente pulito da 50 ml provetta da centrifuga per un uso successivo.

2. Convalida del modello unidimensionale sulla diapositiva di codici a barre

Nota: Questo protocollo convalida può anche essere adattato per l'uso nella valutazione della qualità di fasi successive del flusso patterning.

  1. Blocco della slitta
    1. Preparare 1% di albumina di siero bovino (BSA) in PBS. Filtrare la soluzione attraverso un filtro a siringa da 0,45 micron prima dell'uso. Utilizzando una punta gel-loading, applicare 50 ml di soluzione di BSA 1% di un bordo della slitta barcode.
    2. Incubare il 1% di BSA solution per 1 ora a RT.
  2. Incubazione con Cyanine 3 (Cy3) coniugata DNA complementare
    1. Preparare un cocktail di A ', B', e oligonucleotidi C 'coniugato con Cy3 ad una estremità. Le sequenze di A ', B' e C 'sono complementari a quelle di A, B, e C, rispettivamente. La concentrazione di lavoro del Cy3-DNA è di 0,05 micron di 0,1% di BSA.
    2. Rimuovere la soluzione BSA dal vetrino pipettando, quindi applicare 30 ml di soluzione di DNA cocktail sullo stesso bordo della diapositiva. Incubare il cocktail Cy3-DNA sul vetrino a temperatura ambiente per 1 ora. Eseguire questo passaggio di incubazione al buio per proteggere la parte Cy3 da photobleaching.
  3. Analisi di fluorescenza
    1. Pipettare il cocktail Cy3-DNA e lavare il vetrino in 1% BSA, PBS, e infine in PBS diluito (1 parte PBS con 50 parti di acqua ultrapura). Asciugare il vetrino con una filatrice.
    2. Osservare la fluorescenza (Figura 2B) usando un microscopio a fluorescenza o scanner microarray. Quando si utilizza un scanner per microarray, impostare la lunghezza d'onda di emissione del laser a 532 nm, la dimensione dei pixel a 5 micron, tubo fotomoltiplicatore (PMT) guadagno a 450 e la potenza al 15%.

3. Realizzazione della matrice a 2 dimensioni (3x3) del DNA 14

  1. Preparazione dello stampo PDMS barcode
    1. Eseguire la procedura (1.1) per costruire un altro SU-8 master ma questa volta utilizzando una maschera di cromo con un modello di flusso perpendicolare a quella del primo disegno. Eseguire la procedura (1.2) per costruire un nuovo stampo PDMS con il modello perpendicolari.
  2. Patterning flusso bidimensionale di ssDNA
    1. Per una matrice 3 x 3, preparare 150 micron soluzioni stock di A'-i, B'-ii, C'-iii, A'-iv, B'-v, C'-vi, A'-VII, B'DNA -viii e C'-ix in 3% BSA / PBS. Questi oligonucleotidi servono come "sequenze ponte" (Figura 2A). Unire le soluzioni di oligonucleotidi (soluzioni da 1 a 3), tali che la concentrazione di lavoro è di 50 micron per ogni oligonucleotide. Utilizzare la guida fornita nella tabella 1.
    2. Flusso 3% BSA / PBS soluzione di saturazione in tutti i 20 canali per 1 ora a 0,5-1 psi.
    3. Flow Solutions 1, 2 e 3 in canali 1, 2, e 3, rispettivamente. Seguire questo ordine per le successive serie di 3 canali. Flusso si effettua in circa 40 minuti. Incubare le soluzioni di DNA a temperatura ambiente per 2 ore per consentire al DNA di ibridare.
    4. Flusso 3% BSA / PBS soluzione di saturazione in tutti i 20 canali per 1 ora a 0,5-1 psi per rimuovere il DNA unhybridized. Staccare la lastra PDMS, e lavare il conseguente scorrimento DNA microarray immergendo il vetrino in 3% BSA / PBS volta PBS due volte, seguito da PBS diluito (1 parte di PBS e 50 parti di acqua ultrapura). Dry il vetrino con un filatore vetrino da microscopio.
    5. Eseguire una seconda fase di validazione (Figura 2C) simile a quella nella sezione 2. Usare oligonucleotidi i 'a IX' che sono Cy3-coniugato. Conservare la matrice slitta 3 x 3 in una provetta da centrifuga da 50 ml per un uso successivo.
      Nota: Il DNA microarray può essere conservato a temperatura ambiente in un essiccatore per mesi.

4. La conversione del DNA array 3 x 3 in una matrice anticorpo

  1. Preparazione di anticorpi-oligonucleotide (DEAL) coniugati
    1. Preparare le soluzioni di 200 mm succinimidyl-4-formylbenzoate (S-4FB) e 40 mm succinimidyl-6-hydrazinonicotinamide (S-HyNic) in anidra N, N -dimethylformamide (DMF).
    2. Preparare fino a 7 soluzioni separate di anticorpi di cattura (1 mg / ml) in PBS.
      Nota: Se le soluzioni anticorpo azionari contengono sodio azide bacteriostat, eseguire lo scambio buffer con PBS usando rotazione dissalazione columns con 7 kDa peso molecolare di cut-off (MWCO).
    3. Preparare separati 400 micron soluzioni di i ', ii', iii ', IV', v ', vi', e il DNA vii. Assegnare ad ogni anticorpo di cattura per una sequenza di oligonucleotidi. Combina 40 ml di 400 micron DNA con 12,25 ml di DMF in tubi microcentrifuga e spin down per mescolare accuratamente.
      1. Per ogni soluzione di DNA / DMF, aggiungere 2,3 ml di 200 mm S-4FB in DMF. Per ogni 100 mg di anticorpo di cattura, aggiungere 2,25 ml di 40 mm S-HyNic in DMF.
    4. Incubare l'anticorpo / soluzioni S-HyNic e DNA / S-4FB per 4 ore a temperatura ambiente.
    5. In preparazione per la reazione di accoppiamento anticorpo-DNA, preparare nuove colonne rotazione dissalazione (uno per ogni soluzione di DNA e una per ciascun anticorpo) lavandoli con tampone citrato a pH 6.
    6. Dopo 4 ore di incubazione, eseguire lo scambio buffer per ogni anticorpo / S-HyNic e soluzione di DNA / S-4FB. Unire il S-4FB coniugato VII »con i coniugati di anticorpi-S-HyNic. Incubare le miscele per 2 ore a temperatura ambiente.
    7. Incubare la reazione O / N a 4 ° C.
  2. Purificazione di anticorpi-oligonucleotide (DEAL) coniugati
    Nota: Per purificare i coniugati anticorpo-oligonucleotide, eseguire proteina veloce cromatografia liquida (FPLC) su un sistema standard FPLC dotato di una colonna Superose 6 10/300 GL.
    1. Impostare la lunghezza d'onda del rivelatore UV del sistema FPLC a 280 nm. Utilizzare flusso isocratica di PBS (pH 7.4) a 0,3 ml / min per separare i coniugati anticorpo-oligonucleotide dall'eccesso S-4FB-DNA.
    2. Pool frazioni contenenti il ​​coniugato e concentrare le frazioni ad un volume di 150 ml con filtri di spin con un kDa MWCO 10.
  3. Patterning bidimensionale di anticorpi
    1. Preparare altro stampo PDMS con microchambers o noi micro-pozziing procedure di fabbricazione nel passaggio (1.2). Lo stampo PDMS può contenere microlitri di pozzi nanolitri per saggi immunologici.
      Nota: Per la rivelazione biomarker generale in campioni fluidici, uno stampo PDMS con più pozzetti è accoppiato con la slitta matrice. Le caratteristiche dello stampo PDMS dipendono dal sistema in fase di studio. Per esempio, la rilevazione di proteine ​​da esperimenti monocellulari può essere eseguita con uno stampo PDMS contenente microchambers con volumi 0,15-nl.
    2. (Opzionale) Oggetto stampo PDMS di plasma pulizia (18 W) per 1,5 minuti per rendere la sua fantasia idrofila superficie. Prima della pulizia al plasma, usare nastro adesivo per bloccare tutte le altre superfici che saranno direttamente legati alla matrice slitta 3 x 3.
      Nota: I passi (4.3.2) è facoltativo, ma è di solito eseguita quando lo stampo PDMS è destinato all'uso in esperimenti sulle cellule singole.
    3. Mate stampo PDMS con l'array slitta 3 x 3, quindi bloccare il vetrino con 1% BSA in PBS. Incubare per 1 ora a RT. Meanwhile, preparare un cocktail (200 ml volume finale) di coniugati anticorpo-oligonucleotide. La concentrazione di lavoro di ogni coniugato è di 10 mg / ml in 1% BSA / PBS.
    4. Aggiungere il cocktail di anticorpi-oligonucleotide, poi incubare per 1 ora a 37 ° C per permettere la porzione oligonucleotide dei coniugati di ibridare con macchie specifiche sulle 3 x 3 matrici, in modo da convertire l'array DNA di un array di anticorpi.
    5. Ripetere il punto (3.2.4) per pulire e asciugare il vetrino. La sensibilità più alta può essere raggiunto se la matrice anticorpo è utilizzato immediatamente. Conservazione prolungata può comportare la perdita di sensibilità.
  4. Rilevamento delle proteine
    1. Ricostituire proteine ​​ricombinanti o preparare un campione di cellule filtrato.
    2. Mate microarray con un chip su misura, e bloccare la superficie con 3% BSA in PBS per 1 ora. Quindi rimuovere la soluzione di BSA, e applicare i campioni e incubare per 2 ore.
    3. Lavare i campioni con il 3% di BSA in PBS per tre volte, unD Poi aggiungere anticorpi di rilevamento ad una concentrazione fornito da questa scheda. Incubare per 2 ore.
    4. Lavare gli anticorpi di rilevamento di 3% di BSA in PBS per tre volte, e poi aggiungere Cyanine 5 (Cy5) -streptavidin a 1 mg / ml, seguita da incubazione per 1 ora.
    5. Ripetere il punto (3.2.4) per pulire e asciugare il vetrino per la scansione.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

I disegni per le PDMS stampi (Figura 1A-1B) sono stati elaborati utilizzando un programma CAD (AutoCAD). Due disegni illustrati presentano canali per il flusso patterning, uno orizzontale ed una verticale. Le parti sinistra e destra di ogni disegno sono simmetrici; uno di loro potrebbe essere ingressi o uscite. Ciascuno dei 20 canali è tortuoso da un'estremità fino all'altra estremità. Ogni disegno è stampato su una fotomaschera cromo (Figura 1C). Il fabbricato SU-8 master su un wafer viene mostrato nella Figura 1D. Per facilitare il flusso-patterning di PLL o DNA, lo stampo PDMS è stata accoppiata con un flusso di azoto gassoso set-up (Figura 1E).

Ci sono tre passi flusso-patterning utilizzati in questo protocollo. Il primo passo immobilizza PLL sul substrato di vetro, mentre i passi successivi sia introducono soluzioni oligonucleotidiche. Nella Tabella 1, il oligonuclecomposizioni otide di soluzioni 1-3 sono dati. La concentrazione di lavoro di ciascun oligonucleotide è di 50 micron e il volume totale di ciascuna soluzione è di 39 microlitri. Queste soluzioni vengono preparati combinando 13 ml di ciascuna soluzione oligonucleotide magazzino (150 micron).

Le unità di DNA microarray a motivi geometrici sono ripetitivi e adiacenti in tutta vetrino. Per 3 x 3 microarray, la densità massima è di circa 400.000 punti su un vetrino di vetro. Confronto side-by-side con DNA microarray commerciale rivela che la nostra tecnologia è di circa 5 volte più sensibile durante l'associazione a Cy3 tag DNA complementari. I DNA fantasia sono relativamente uniforme con variazione ~ 5% in più ripetizioni. Tali caratteristiche promettono l'elevata capacità quantificazione della nostra tecnologia nella misurazione contenuti di proteine ​​da campioni biologici. Inoltre, l'ortogonalità dei DNA in combinazione con il disegno del canale di flusso offrono flexibility di patterning in una varietà di geometrie (Figura 2D).

Dopo aver convertito l'array di DNA in un array di anticorpi mediante ibridazione con coniugati anticorpo-DNA (Figura 3B), il pannello anticorpo risultante è utilizzato nella rilevazione multiplexati, principalmente attraverso panino piattaforma ELISA come mostrato in Figura 3C. In sandwich ELISA, di rilevamento di anticorpi biotinilati (secondari) si legano alle proteine ​​catturate, e successiva marcatura con fluoroforo streptavidina coniugata permette di rilevazione basato sulla fluorescenza (Figura 3C-E). Rilevamento di proteine ​​spettacoli <10% variazione da un'estremità all'altra estremità del vetrino (figura 3D). Con la matrice 3 x 3, siamo in grado di rilevare fino a 7 proteine, assegnando un elemento di matrice come riferimento (Cy3 etichettato) e un altro elemento come controllo negativo. Ad esempio, in un esperimento di cella singola eseguita perstudi di tumore, le proteine ​​interleuchina-6 (IL-6), matrice metallopeptidasi 9 (MMP9), fattore di crescita degli epatociti (HGF), fattore di crescita vascolare endoteliale (VEGF), interleuchina-8 (IL-8), e migrazione di macrofagi inibitorio fattore (MIF) da una singola cellula può essere rilevata simultaneamente (Figura 3E).

Abbiamo anche calibrato il sistema utilizzando proteine ​​ricombinanti a varie concentrazioni. Nella figura 3F, curve di calibrazione per le proteine ​​ricombinanti di interferone-γ (IFN-g), α fattore di necrosi tumorale (TNF alfa), interleuchina-13 (IL-13), fattore di necrosi tumorale β (TNF beta), granzyme B, interleuchina -4 sono mostrati (IL-4), interleuchina-8 (IL-8). La sensibilità di rilevazione è molto simile a quella di ELISA sandwich tradizionale su piastre bene anche con un carico più elevato di anticorpi DNA ed eventualmente sul substrato.

Il codice a barre gli anticorpiy microarray può essere utilizzato per rilevare biomarcatori in campioni fluide ed in cellule singole. Da analisi singola cellula non è al centro di questo protocollo, abbiamo semplicemente esemplificato l'applicazione dell'anticorpo microarray 3 x 3 nella rilevazione di citochine. Attraverso interazioni anticorpo-marcatori superficiali, cluster di differenziazione 8 (CD8) cellule -positive stati catturati su uno degli elementi di microarray (figura 3G; un chip PDMS in alto), e il resto degli elementi sono stati usati per rilevare citochine secrete ( Figura 3H). Con questo metodo di cattura cella "array di celle" possono essere formate. Questa tecnica di acquisizione matrice permette inoltre di controllare il numero di cellule sottoposte a ogni esperimento ELISA. Le cellule sono state isolate fisicamente nelle microchambers modo che le proteine ​​rilevate riguardavano particolari cellule singole. In figura 3H, è dimostrato che ogni microcamera è dotato di 16 elementi microarray per garantire incapsulamentoun completo 3 x 3 set microarray.

Figura 1
Figura 1. Progettazione e realizzazione di stampi PDMS codici a barre per patterning DNA a base di flusso. Panel (A) mostra i disegni AutoCAD per modelli di codici a barre monodimensionali orizzontali e verticali. Pannello (B) mostra i modelli di codice a barre orizzontali e verticali sovrapposte da (A). Scatole verdi racchiudono zone fantasia con discrete 3 x 3 matrici. Maschera (C) Chrome per fabbricare il SU-8 master. (D) SU-8 padrone fabbricato su un wafer di silicio. (E) Set-up per il flusso di patterning. Cliccate qui per vedere una versione più grande di questa figura.

Figura 2 Figura 2. Costruzione e validazione di un array di DNA 3 x 3. Questo dato è stato modificato da "quantificazione Funzioni di interazione cellula-cellula con le applicazioni a celle glioblastoma multiforme Cancer", di Wang, J. et al., 2012, Nano Lett 12 . Copyright 2012 dalla American Chemical Society. Adattato su autorizzazione. (A) Schema per i DNA fasi del flusso di patterning. Profilo (B) intensità di fluorescenza di 20 canali in un'area selezionata (tracciato da una linea verticale) del codice a barre 1D. Oligonucleotidi Cy3-coniugato sono stati ibridati con gli array di DNA per la convalida. (C) fluorescenza profilo di intensità di array convalidati con DNA Cy3-coniugato dopo aver completato la seconda fase patterning DNA. (D) i modelli fluorescenti alternativi da diverso flow-patterning strategie. Cliccate qui per vedere una versione più grande di questa figura.

Figura 3
Figura 3. Applicazioni del 3 x 3 microarray. (A) Schema per la sintesi di coniugati DEAL anticorpi oligonucleotide. (B) Schema per la conversione della matrice di DNA in un array di anticorpi mediante ibridazione con coniugati anticorpo-oligonucleotide. (C) Schema per utilizzando il 3 x 3 microarray in una piattaforma ELISA sandwich. Questo dato è stato modificato da "quantificazione Funzioni di interazione cellula-cellula con le applicazioni a celle glioblastoma multiforme Cancer", di Wang, J. et al., 2012, Nano Lett 12. Copyright 2012 dalla American Chemical Society. Adattato su autorizzazione. Pannello (D) mostra una lettura di fluorescenza generata sotto un canale Cy5. Ciò corrisponde a un esperimento ELISA a sandwich che ha rilevato 6 proteine. Panel (E) è un ingrandita nel profilo di una matrice 3 x 3 lettura sotto canali Cy3 e Cy5. Panel (F) mostra il panino ELISA curve di calibrazione per le proteine ​​ricombinanti. Pannello (G) mostra una "matrice di celle" formato da catturare cellule attraverso il legame con anticorpi sull'array. Panel (H) mostra il risultato di rilevamento sovrapposta con microchambers in un microchip. Clicca qui per vedere una versione più grande di questa figura.

1
Soluzione Oligonucleotide Composizione
A'-i, B'-ii, C'-iii
2 A'-IV, B'-v, C'-vi
3 A'-vii, B'-VIII, C'-ix

Tabella 1. Composizione di soluzioni 1-3 per il DNA flusso Patterning.

Sequenze di ancoraggio
UN ATCCTGGAGCTAAGTCCGTA-AAAAAAAAAAAAAAAAAAAA-ATCCTGGAGCTAAGTCCGTA-AAAAAAAAAAAAAAAAAAAA
B GCCTCATTGAATCATGCCTA-AAAAAAAAAAAAAAAAAAAA-GCCTCATTGAATCATGCCTA-
AAAAAAAAAAAAAAAAAAAA
C GCACTCGTCTACTATCGCTA-AAAAAAAAAAAAAAAAAAAA-GCACTCGTCTACTATCGCTA-AAAAAAAAAAAAAAAAAAAA
Colmare sequenze
A'-i TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-ATGGTCGAGATGTCAGAGTA
B'-ii TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-ATGTGAAGTGGCAGTATCTA
C'-iii TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-ATCAGGTAAGGTTCACGGTA
A'-iv TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-GAGTAGCCTTCCCGAGCATT
B'-v TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-ATTGACCAAACTGCGGTGCG
C'-vi TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-TGCCCTATTGTTGCGTCGGA
A'-vii TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-TCTTCTAGTTGTCGAGCAGG
B'-viii TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-TAATCTAATTCTGGTCGCGG
C'-ix TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-GTGATT AAGTCTGCTTCGGC
Oligonucleotidi Cy3-coniugato per la validazione
UN' TACGGACTTAGCTCCAGGAT
B ' TAGGCATGATTCAATGAGGC
C ' TAGCGATAGTAGACGAGTGC
io' TACTCTGACATCTCGACCAT
ii ' TAGATACTGCCACTTCACAT
iii ' TACCGTGAACCTTACCTGAT
iv ' AATGCTGGGGAAGGCTACTC
v ' CGCACCGCAGTTTGGTCAAT
vi ' TCCGACGCAACAATAGGGCA
vii ' CCTGCTCGACAACTAGAAGA
viii ' CCGCGACCAGAATTAGATTA
ix ' GCCGAAGCAGACTTAATCAC
"Fo: keep-together.within-page =" 1 "> Tabella 2. Le sequenze utilizzate nel DNA di flusso-patterning.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Disegno del modello di flusso è il primo passo fondamentale per fabbricare microarray 2-D. Per generare due sovrapposti pattern di DNA su un substrato di vetro, le caratteristiche di canale del primo progetto devono essere perpendicolari a quelle del secondo (Figura 1A-B). I disegni considerano anche le applicazioni a valle del microarray. Nel caso di analisi singola cella, il microarray è utilizzato per rilevare proteine ​​da cellule singole racchiusi in microchambers, quindi le dimensioni di canale sono compatibili con i microchambers che si allineano con gli array 2-D. Ogni disegno è resa su una fotomaschera e tecniche fotolitografiche standard sono utilizzati per fabbricare le caratteristiche di canale in SU-8 su un wafer di silicio (Figura 1C-D). Questo serve come il master per PDMS stampaggio. Una volta che lo stampo è stato fabbricato, è legato a una diapositiva PLL rivestite e poi accoppiato con un flusso di azoto gassoso set-up (Figura 1E). L'abbiamo set-uputilizzo è semplice e ha il vantaggio di essere facilmente incorporato in un laboratorio con una sorgente di gas di azoto-pressione regolata. Usiamo un assemblaggio di più valvole a 3 vie economici collegati ad un serbatoio di azoto gassoso. Il flusso d'aria per patterning deve essere mantenuta a basse pressioni (0,5-1 psi) per evitare la delaminazione del vetrino dallo stampo. Perdite all'interno dello stampo PDMS può compromettere l'integrità dei modelli.

I passi patterning flusso del DNA di questo protocollo utilizzano ssDNA con sequenze ortogonali accuratamente selezionati (Figura 2A). Prima di flusso-patterning, le sequenze uniche su queste oligonucleotidi dovrebbe essere testato per l'assenza di cross-talk. Un semplice test per il cross-talk è fatto modificando la procedura di validazione si introduce nel nostro protocollo (punto 2). Invece di utilizzare un cocktail di Cy3-tag DNA complementare, solo tipo di sequenza complementare è utilizzato in un momento per un'area selezionata del vetrino su cui multiplaSequenze di DNA sono immobilizzati. In assenza di DNA cross-talk, una sola banda (per l'array di DNA 1-D) o un punto (per l'array DNA 2-D) devono avere fluorescenza sotto un filtro Cy3. Esempi di sequenze ortogonali completamente convalidati si trovano nella tabella dei Materiali e attrezzature. Il primo passo patterning DNA introduce tre tipi di oligonucleotidi "ancora". Queste sequenze di 80 nt sono costituiti da due regioni poli-A 20-mer che si alternano con due uniche sequenze di 20-mer. La modifica 5'-ammina nelle sequenze di ancoraggio è necessario per ammina-to-ammina reticolazione 17 con PLL mediato da BS3. Il secondo passo patterning DNA non richiede un reticolante. Questo passaggio introduce oligonucleotidi "ponte" che ibridano in parte con le sequenze di ancoraggio. Ogni sequenza ponte 60-nt consiste di una regione 20-mer complementare ad una sequenza di ancoraggio, un 20-mer-poly Un distanziatore, e un unica sequenza di 20-mer. Validazione delle matrici di DNA (Figure 2B-C) viene eseguita dopo ogni DNA flow-patterning passo di valutare la qualità dei passi patterning e per garantire la non contaminazione incrociata 14. Questa operazione viene eseguita introducendo sonde oligonucleotidiche Cy3-coniugato che ibridano con i modelli del DNA. Con i parametri specificati nella Fase (2.3.2) per analizzare intensità di fluorescenza, i modelli di DNA devono esibire intensità di fluorescenza di almeno 40.000 au per massimizzare la sensibilità degli immunodosaggi valle eseguito utilizzando il microarray. Uso strategico di diversi set Cy3-DNA durante la convalida genera modelli alternativi (Figura 2D), dimostrando così la flessibilità del patterning DNA passi 8. Il mancato raggiungimento modelli uniformi potrebbero derivare da perdite o ostruzioni meccaniche (come particelle di polvere), ha incontrato nelle fasi di flusso-patterning.

La preparazione di anticorpi coniugati oligonucleotide DEAL è un altro passo fondamentale in thè il protocollo. La scelta degli anticorpi è dettata dal sistema biologico in esame. Gli oligonucleotidi utilizzati in coniugazione dovrebbero avere sequenze complementari a quelle ancorate sull'array DNA. Soluzioni madre dei linker S-4FB e S-HyNic devono essere preparate al momento e tenuti lontano da umidità per evitare l'idrolisi. I tempi di incubazione utilizzati nel nostro protocollo coniugazione sono abbastanza a lungo per introdurre le funzionalità desiderate nelle anticorpi e del DNA. La reazione di accoppiamento finale si spegne solo rimuovendo le reagiti oligonucleotidi S-4FB coniugati tramite FPLC. Così, FPLC purificazione deve essere eseguita immediatamente dopo aver completato la coniugazione. Quando si esegue FPLC con il sistema descritto nel nostro protocollo, le portate inferiori (0,2-0,25 ml / min) può essere utilizzato anche per migliorare la risoluzione. I coniugati sono eluiti in un picco ampio (volume di eluizione di circa 9-15 ml) che appare prima di un picco di DNA più stretto e più alto (17-20 ml volume di eluizione). Si consiglia di non memorizzare le soluzionidi coniugati con eccesso S-4FB-DNA, perché questo può portare alla perdita di siti di legame antigene-anticorpo in su coniugazione con eccesso funzionalizzato DNA. La sensibilità, specificità e riproducibilità dei test ELISA a sandwich utilizzando coniugati DEAL è stato dimostrato in studi precedenti. 8,9,11,12,16 Per valutare la qualità di coniugati anticorpo-DNA, i coniugati possono essere incubate su array di DNA per generare la matrice anticorpo, che viene successivamente utilizzato in esperimenti ELISA a sandwich per generare curve di calibrazione per la rilevazione di proteine ​​(Figura 3F). Per generare queste curve di taratura, possono essere utilizzate proteine ​​ricombinanti fornite in un sandwich kit ELISA convenzionale. L'uso di coniugati di alta qualità dovrebbe dare origine a catene lineari e limiti inferiori di rilevazione confrontabili con quelli del kit. A titolo di esempio, i limiti inferiori per INFγ e TNF per ELISA sandwich sulla nostra gamma di anticorpi (figura 3F) sono ~ 50-100 pg / ml, e sono consistent con il campo di rilevamento lineare del ~ 15-1,000 pg / ml indicato nella scheda tecnica del prodotto per il panino kit ELISA convenzionale. Scadente lettura segnale ottenuto in valle esperimenti ELISA a sandwich può essere attribuito alla bassa qualità della matrice di DNA, l'interferenza di DNA in eccesso nelle soluzioni di coniugato, o, in alternativa, di coniugazione incompleta ssDNAs con anticorpi.

Le principali preoccupazioni per l'esecuzione di ELISA sandwich sulla matrice di anticorpi includono cross-talk tra reagenti e se il segnale riflette i veri eventi biologici. Il DNA ortogonali che usiamo in questo protocollo sono stati completamente validato per avere meno dello 0,1% di cross-talk. Pertanto, qualsiasi diafonia osservato in fase di dosaggio è principalmente dagli anticorpi e reagenti ELISA. Test per cross-talk tra anticorpi della matrice deve essere eseguita prima di effettuare analisi su campioni reali. Una volta che un pannello di anticorpi è costruito, a pochi esperimenti di controllo panino ELISA dovrebbe essere perfORMED con le seguenti condizioni: 1. Fatta antigeni, 2. Fatto anticorpi di rilevamento, e 3. anticorpi di rilevamento e solo reagenti di etichettatura. Se cross-talk si osserva nella fase immunologico, le coppie di anticorpi e / o reagenti ELISA devono essere sostituiti. Va osservato che l'uso di anticorpi commercialmente disponibili da kit ELISA convenzionali non garantisce applicabilità al panino tecnica ELISA basato su array.

I meriti di questa tecnologia includono la produzione economica, formato miniatura, e la flessibilità del design. Il nostro protocollo di fabbricazione non ha bisogno di uno spotter microarray che potrebbe non essere disponibile a molti utenti di array di anticorpi. Il flusso patterning set-up può essere montato facilmente in laboratori semplici. Per i laboratori che non sono dotati di strumenti per la fotolitografia, i disegni CAD che offriamo nel nostro protocollo potranno essere comunicati a società che offrono servizi di microfabbricazione. Downsizing microarray convenzionale inla matrice compatta fabbricata con il nostro protocollo consente la compatibilità con microchip utilizzati negli esperimenti unicellulari. Il nostro protocollo caratterizza la produzione della matrice come una matrice ssDNA prima conversione in un array di anticorpi. Patterning preliminare con ssDNAs ha una serie di vantaggi. Innanzitutto, ssDNAs sono chimicamente più stabile rispetto agli anticorpi, così i vetrini ssDNA-modellata possono essere memorizzati in un essiccatore per almeno 6 mesi senza significativa degradazione 8,16. Secondo, il nostro approccio offre all'utente finale la possibilità di scegliere i dosaggi necessari, per semplice miscelazione dei coniugati selettivi insieme in una soluzione senza modifica del microarray; Al contrario, proteina / array anticorpali convenzionali sono pre-progettati e fissato su un substrato, in modo che il cambiamento di saggi richiederebbe patterning / stampa di proteine ​​/ anticorpi fin dall'inizio. Studi rappresentativi illustrano l'uso del microarray anticorpi codice a barre nel-high throughput detection di più proteine ​​di segnalazione da singole cellule. Variando i disegni del modello di flusso e / o le soluzioni oligonucleotide patterning utilizzate, una moltitudine di configurazioni di matrice può essere esplorato. Come esempio di tale applicazione, proteine ​​funzionali da singole cellule possono essere studiate. Il chip per l'analisi singola cellula comprende ben ~ 8.700 microchambers, ognuna allineata con un totale di 3 x 3 matrice anticorpo (Figura 3H). Tale configurazione permette di individuare high-throughput. Le proteine ​​secrete dalle cellule coltivate in microchambers possono essere rilevate da questo array. Il design versatile consente microarray anche per il rilevamento multiplex di proteine ​​da siero, lisati cellulari e singole cellule dopo la combinazione del microarray con gli altri componenti generici 8,15. Oltre al rilevamento della proteina, la matrice 3 x 3 anticorpo è utile anche in cellule di cattura (Figura 3G).

Il principale svantaggio di questo approccio è la sua compl aggiuntoexity rispetto alla fabbricazione di microarray convenzionali. Strategie per patterning e per la progettazione di matrice devono essere accuratamente concepiti tenendo conto delle specifiche applicazioni della matrice fabbricato. Questo approccio richiede anche un certo numero di passaggi critici incluse le procedure di convalida e test per cross-talk. La matrice 3 x 3 costruito usando il nostro protocollo è limitata a rilevare 7 proteine ​​alla volta. Tuttavia, questo limite può essere superato con la creazione di array più grandi. Il protocollo descritto qui non si limita alla realizzazione di 3 x 3 microarray. Siamo stati in grado di realizzare con successo 5 x 5 microarray e altre dimensioni di elementi di un array. In linea di principio, altre matrici n x m possono essere fabbricati usando tecniche simili purché i set di oligonucleotidi utilizzati nella creazione matrice preliminare DNA-modellata sono ortogonali evitare interferenze tra gli elementi dell'array. La creazione di array espanse si ottiene flusso patterning n tipi di ssDNA ancoraggi per il primo passo patterning DNA, seguito da n x m bridging sequenze ssDNA per la seconda fase patterning. Ad esempio, per creare una matrice di 5 x 5, sequenze di ancoraggio da A a E può essere utilizzato, mentre le sequenze bridging A'-i per E'-xxv sono utilizzati. Per automatizzare il processo di patterning flusso, una piattaforma robotica è stata sviluppata 18 anche se questo è utilizzato un solo DNA flusso patterning passo. In linea di principio, la stessa piattaforma può essere estesa alla seconda fase di patterning flusso perpendicolare, mentre la commutazione tra due fasi può richiedere manualmente staccava primo stampo PDMS dopo il primo passo patterning, seguita da lavaggio e asciugatura la slitta (questo passaggio sarebbe prendere circa 10 minuti), prima di accoppiamento il vetrino con un altro stampo PDMS di facilitare la seconda fase patterning orientato perpendicolarmente.

Abbiamo discusso le procedure dettagliate per la realizzazione di una serie nxm fantasiacon anticorpi ad alta densità, che una grande promessa per applicazioni future in studi di proteomica e segnalazione cellulare. Il protocollo qui presentata può anche servire come guida per la costruzione di più elaborati array DNA / anticorpi per altri scopi.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Sylgard 184 silicone elastomer base Dow Corning 3097366-1004
Sylgard 184 silicone elastomer curing agent Dow Corning 3097358-1004
SU-8 2025 photoresist MicroChem Y111069
Silicon wafers  University Wafers 452
Poly-L-lysine coated glass slides Thermo Scientific C40-5257-M20
Oligonucleotides Integrated DNA Technologies *Custom-ordered from Integrated DNA Technologies, see Table 2.
Poly-L-lysine adhesive stock solution Newcomer Supply 1339
Bis (sulfosuccinimidyl) suberate  (BS3) Thermo Scientific 21585
1x Phosphate buffered saline, pH 7.4 Quality Biological 114-058-101
Äkta Explorer 100 Fast Protein Liquid Chromatography (FPLC) System GE (Amersham Pharmacia)  18-1112-41
Superose 6 10/300 GL column GE Healthcare Life Sciences 17-5172-01
Capture antibodies various various *Antibody selection depends on application
Succinimidyl-6-hydrazino-nicotinamide (S-HyNic) Solulink S-1002
Succinimidyl-4-formylbenzamide (S-4FB) Solulink S-1004
N,N-dimethylformamide Sigma-Aldrich 227056
Citric acid, anhydrous Acros 42356
Sodium hydroxide Fisher Scientific S318
Amicon Ultra spin filter 10 kDa MWCO EMD Millipore UFC201024
Spin coater Laurell Technologies WS-650-MZ
Biopsy punch with plunger (1.0 mm diameter) Ted Pella, Inc. 15110-10
Diamond scribe (Style 60) SPI supplies 6004
Trimethylchlorosilane Sigma Aldrich 92361

DOWNLOAD MATERIALS LIST

References

  1. Alhamdani, M. S. S., Schroder, C., Hoheisel, J. D. Oncoproteomic profiling with antibody microarrays. Genome Med. 1, (7), (2009).
  2. Angenendt, P. Progress in protein and antibody microarray technology. Drug Discov Today. 10, (7), 503-511 (2005).
  3. Sun, H. Y., Chen, G. Y. J., Yao, S. Q. Recent advances in microarray technologies for proteomics. Chem Biol. 20, (5), 685-699 (2013).
  4. Fan, R., et al. Integrated barcode chips for rapid, multiplexed analysis of proteins in microliter quantities of blood. Nat Biotechnol. 26, (12), 1373-1378 (2008).
  5. Chattopadhyay, P. K., Gierahn, T. M., Roederer, M., Love, J. C. Single-cell technologies for monitoring immune systems. Nat Immunol. 15, (2), 128-135 (2014).
  6. Varadarajan, N., et al. Rapid, efficient functional characterization and recovery of HIV-specific human CD8(+) T cells using microengraving. Proc Natl Acad Sci USA. 109, (10), 3885-3890 (2012).
  7. Ma, S., et al. Electroporation-based delivery of cell-penetrating peptide conjugates of peptide nucleic acids for antisense inhibition of intracellular bacteria. Integr Biol-Uk. 6, (10), 973-978 (2014).
  8. Wang, J., et al. Quantitating cell-cell interaction functions with applications to glioblastoma multiforme cancer cells. Nano Lett. 12, (12), 6101-6106 (2012).
  9. Kravchenko-Balasha, N., Wang, J., Remacle, F., Levine, R. D., Heath, J. R. Glioblastoma cellular architectures are predicted through the characterization of two-cell interactions. Proc Natl Acad Sci USA. 111, (17), 6521-6526 (2014).
  10. Xue, M., et al. Chemical methods for the simultaneous quantitation of metabolites and proteins from single cells. J Am Chem Soc. 137, (12), 4066-4069 (2015).
  11. Shi, Q. H., et al. Single-cell proteomic chip for profiling intracellular signaling pathways in single tumor cells. Proc Natl Acad Sci USA. 109, (2), 419-424 (2012).
  12. Ma, C., et al. A clinical microchip for evaluation of single immune cells reveals high functional heterogeneity in phenotypically similar T cells. Nat Med. 17, (6), 738-743 (2011).
  13. Deng, Y., et al. An integrated microfluidic chip system for single-cell secretion profiling of rare circulating tumor cells. Sci Rep. 4, 7499 (2014).
  14. Vermesh, U., et al. High-density, multiplexed patterning of cells at single-cell resolution for tissue engineering and other applications. Angew Chem Int Ed. 50, (32), 7378-7380 (2011).
  15. Yu, J., et al. Microfluidics-based single-cell functional proteomics for fundamental and applied biomedical applications. Annu Rev Anal Chem. 7, 275-295 (2014).
  16. Bailey, R. C., Kwong, G. A., Radu, C. G., Witte, O. N., Heath, J. R. DNA-encoded antibody libraries: A unified platform for multiplexed cell sorting and detection of genes and proteins. J Am Chem Soc. 129, 1959-1967 (2007).
  17. Alegria-Schaffer, A. General protein-protein cross-linking. Methods Enzymol. 539, 81-87 (2014).
  18. Ahmad, H., et al. A robotics platform for automated batch fabrication of high density, microfluidics-based DNA microarrays, with applications to single cell, multiplex assays of secreted proteins. Rev Sci Instrum. 82, 094301 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics