Strömungsmuster Guided Herstellung von High-Density-Barcode Antikörper Microarray

Chemistry

Your institution must subscribe to JoVE's Chemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Dieses Protokoll beschreibt die Herstellung eines großflächigen, gemultiplexten zweidimensionalen DNA oder Antikörperarray, mit potentiellen Anwendungen in der Zellsignal Studien und Biomarkern.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Ramirez, L. S., Wang, J. Flow-pattern Guided Fabrication of High-density Barcode Antibody Microarray. J. Vis. Exp. (107), e53644, doi:10.3791/53644 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Antikörper-Mikroarrays wurden weitgehend in der Proteomik seit Jahrzehnten verwendet, um die Anwesenheit von Zielproteinen, einschließlich Proteinbiomarker 1-3 zu prüfen. Obwohl dieser Bereich steht derzeit vor großen Herausforderungen von anderen Hochdurchsatz-Technologien wie Massenspektrometrie (MS), gibt es noch viel Raum für die Nützlichkeit der Antikörper Microarrays, vor allem, weil diese Geräte leisten einfache Dateninterpretation und einfache Schnittstelle mit anderen Tests. In den letzten Jahren hat sich die Integration von Microarrays in die Mikrochip-Gerüsten der Antikörper Microarray eine neue Möglichkeit, gedeihen 4-7 vorgesehen. Zum Beispiel hat der Barcode Microarray in eine Einzelzellmikrochip integriert in Zell-Kommunikation Studien 8,9 verwendet. Diese Technologie hat deutliche Vorteile gegenüber anderen verfügbaren Microarray-Technologien. Es verfügt über Array-Elemente auf 10-100 um, viel kleiner als die typischen 150 um Größe in herkömmlichen Microarray elemen verwendetts. Der Bau von kleineren Arrayelemente mit systematischen Strömungsmusterbildungsverfahren erreicht wird, und dies führt zu kompakten Mikroarrays, die Einzelzell sezernierten Proteinen und intrazellulären Proteinen erkennen kann. Ein weiterer Vorteil ist die Verwendung eines einfachen, instrument freie Konfiguration. Dies ist besonders wichtig, weil die meisten Labors und Kleinunternehmen nicht in der Lage, um Mikroarray-Kerneinrichtungen zugreifen zu können. Solchen Barcode-Antikörper-Mikroarrays mit einer leistungsfähigen Assay Durchsatz und können verwendet werden, um hoch Multiplex-Assays an einzelnen Zellen durchzuführen, während eine hohe Empfindlichkeit und Spezifität mit der von herkömmlichen Sandwich-Enzym-Immunoassay (ELISA 8) werden. Diese Technologie hat zahlreiche Anwendungen in der Detektion von Proteinen aus Glioblastom 9-11, T-Zellen 12 und 13 zirkulierenden Tumorzellen gefunden. Alternativ Barcode DNA Microarrays allein in der präzisen Positionierung von Neuronen und Astrozyten für mimick genutzt wordening der in vivo Anordnung von Hirngewebe 14.

Dieses Protokoll konzentriert sich nur auf die experimentellen Schritte und Aufbaublöcke der zweidimensionalen (2D) Strichcode-Antikörper-Microarray, die Anwendungsmöglichkeiten in der Detektion von Biomarkern in Fluidproben hat und in einzelne Zellen. Die Technik basiert auf einem adressierbaren einzelsträngig, eindimensionale (1-D) DNA Microarray konstruiert unter Verwendung eines Orthogonal-Oligonukleotide, die sich räumlich auf Glassubstraten gemustert. Der 1-D-Muster gebildet wird, wenn parallele Strömungskanäle in Strömungsmusterungsschritt verwendet, und ein derartiges Muster wird als diskrete Banden visuell ähnlich zu 1-D Universal Product Code (UPC) Barcodes. Der Bau eines 2-D (n x m) Antikörper Array - erinnert an ein 2-D Quick Response (QR) Matrixcode - braucht mehr komplexe Strukturierungsstrategien, sondern ermöglicht für die Immobilisierung von Antikörpern mit einer höheren Dichte 8,15. Die Fertigungerfordert zwei DNA Strukturierungsschritte, wobei das erste Muster senkrecht zu der zweiten. Die Schnittpunkte dieser beiden Muster bilden die n x m Elemente des Arrays. Durch strategische Auswahl der Sequenzen der einzelsträngigen DNA (ssDNA) in Strömungsstrukturierung verwendet wird, wird jedes Element in einem gegebenen Array eine bestimmte Adresse zugewiesen. Diese Raumbezug ist bei der Unterscheidung zwischen Fluoreszenzsignale auf dem Microarray Objektträger notwendig. Die ssDNA-Array in einen Antikörper-Array durch den Einbau von komplementären DNA-Antikörper-Konjugate umgewandelt und bildet eine Plattform genannte DNA-kodierten Antikörperbibliothek (DEAL 16).

Diese Video-Protokoll werden die wichtigsten Schritte bei der Erstellung nxm Antikörperarrays, umfassend die Herstellung schließen Polydimethylsiloxan (PDMS) Barcode Formen, Fließmuster ssDNA in zwei Orientierungen, die Vorbereitung Antikörper-Oligonukleotid-Konjugaten DEAL, und Umwandeln des 3 x 3-DNA-Array in ein 3x 3-Antikörper-Array.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Achtung: Einige Chemikalien, die in diesem Protokoll verwendet werden, sind Reizstoffe und sind im Falle von Hautkontakt gefährlich. Wenden Sie Sicherheitsdatenblätter (MSDS) und tragen Sie geeignete persönliche Schutzausrüstung vor dem Durchführen dieses Protokoll. Die in Schritt (1.1.1) verwendet Piranha-Lösung ist stark ätzend und erfolgt durch Zugabe der Peroxid langsam zu der Säure unter Rühren hergestellt werden. Behandeln Sie diese Lösung mit äußerster Vorsicht in einer Abzugshaube. Verwenden Sie geeignete Schutzbrille und säurefeste Handschuhe. Trimethylchlorsilan (TMCS) ist eine ätzende, brennbare Chemikalie in einem optionalen Schritt nach (1.1.6) verwendet. Behandeln Sie diese Chemikalie in einem Abzug.

Hinweis: Führen Sie die Barcode-Schiebe Fertigung und kritische Strömung-Strukturierungsverfahren in einem Reinraum, um eine Verunreinigung durch Partikel zu minimieren. Staubpartikel können die Ports und Mikrokanäle PDMS Formen blockieren und stören Fluss-Strukturierung.

1. Bau des One-dimensional DNA Barcode Slide

  1. Vorbereitung des SU-8 Master für Barcode-Strömungsmuster
    Anmerkung: Die Zeichnungen für den senkrechten Strömungsmuster (1A-B) unter Verwendung eines Computer-Aided Design (CAD) geschaffen. Diese Muster werden auf einer Chrommaske erstellt. Transparenten Bereichen der Maske entsprechen den Merkmalen der SU-8-Master.
    1. Reinigen einer Siliziumwafer (Durchmesser 100 mm) gründlich in einem Gemisch von 3 H 2 SO 4: 1 30% H 2 O 2 (Piranha-Lösung) auf 96 ° C erwärmt. Waschen Sie die Wafer mit deionisiertem Wasser und Isopropylalkohol, durch Trocknen mit einem Stickstoffluftpistole gefolgt.
    2. Pour etwa 4 ml SU-8-Fotolack 2025 auf dem Wafer. Verwenden einer programmierbaren Schleuderbeschichter gleichmäßig verteilt den Photoresist auf dem Wafer 10 Sekunden lang bei 500 UpM, dann 30 Sekunden bei 3.000 Umdrehungen pro Minute. Dies schafft eine Photoresistschicht mit einer Dicke von ~ 25 & mgr; m. Nach und ermöglichen zum Stillstand kommen, vor dem Anhalten zu verlangsamen - das ist nach MaiNtain eine gleichmäßige Beschichtung auf der Oberfläche des Wafers.
    3. Backen des beschichteten Wafers auf einer Heizplatte für 1 min bei 65 ° C, dann für 5 min bei 95 ° C. Dieser Schritt ermöglicht die Beschichtung zu verfestigen. Cool, für 5 min RT.
    4. Legen Sie die Chrommaske (Abbildung 1c) auf dem Fotolack beschichten. Setzen die Maske Eigenschaften, um im nahen UV-Licht (350 bis 400 nm, einer Belichtungsenergie von 150 bis 160 mJ / cm 2) für 20 sec.
      Hinweis: Das Design auf der Chrommaske enthält 20 Kanäle, von denen jeder 20 & mgr; m breit mit 50 & mgr; m Steigung sind. Die Kanäle Wicklung von einem Ende der Struktur auf der gegenüberliegenden Seite. Insgesamt sind die 20 Kanäle umfassen eine rechteckige Fläche mit einer Länge von ~ 40 mm und einer Breite von ca. 20 mm. Jeder Kanal ist durch zwei kreisförmige Merkmale, die zu einem Einlass und einem Auslass entsprechen flankiert. Einlässe und Auslässe sind austauschbar.
    5. Backen Sie die belichteten Wafer auf einer Heizplatte 5 min bei 95 ° C. Coole allmählich auf RT.
    6. Tauchen des Wafers in SU-8-Entwickler unter Rührenfür 5 min. Der Wafer mit einem kleinen Teil des Frisch SU-8-Entwickler, gefolgt von Isopropylalkohol zu waschen. Trocknen Sie die Wafer unter Verwendung einer Stickstoffluftpistole. Hard-bake Wafers auf einem 200 ° C-Kochplatte für 30 min und damit der Wafer schrittweise auf RT abkühlen.
      Anmerkung: Die Entwicklung kann für eine längere Zeit durchgeführt werden, wenn ein weißer Film wird nach dem Waschen in diesem Schritt festgestellt.
      Optional: silanisieren die SU-8 Master, indem es Dampf in einer verschlossenen Petrischale für 10 min Trimethylchlorsilan.
  2. Herstellung der PDMS Barcode Form
    1. Kombinieren 40,0 g Siliconelastomer-Basis mit 4,0 g Härter. Rühre das Prepolymergemisch 10 min kräftig. Degas für 20 min unter Vakuum.
      Hinweis: In der Regel verwenden Sie ein 10: 1 (Basis: Härter) Massenverhältnis.
    2. Gießen Sie das Präpolymer in eine Petrischale, die einen Silizium-Wafer mit dem SU-8 Master des Barcode-Musters. Die Höhe des PDMS-Mischung sollte etwa 7,5 mm oder mehr betragen. Entgasen des Gemischs in der Petri Gericht für ein zweites Mal, um alle verbleibenden Luftblasen zu entfernen, dann backen die Mischung für 1 h bei 75 ° C, damit PDMS zu heilen.
      Hinweis: Es ist wichtig, genügend Dicke der PDMS-Platte mit 7,5 mm zu halten ~ oder über Zugabe von zu viel Spannung auf das PDMS-Glas-Bindung beim Einsetzen der Stifte / Schlauch durch Löcher in der PDMS-Form in Schritt, um zu vermeiden (1.3.3.1)
    3. Mit einem Skalpell vorsichtig um den Bereich der PDMS-Platte, die den Barcode Formmerkmale enthält, und ziehen Sie die Platte aus dem Wafer geschnitten.
    4. Die Kanten der Platte, um die gewünschte Form des PDMS Barcode-Form zu erreichen. Stempel 20 Löchern (1,0 mm Durchmesser) durch die Form mit Hilfe einer Biopsie Schlag mit Kolben. Sicherzustellen, dass die Löcher mit den kreisförmigen Merkmalen der Strichcodemuster ausgerichtet sind. Diese Löcher dienen als Ein- und Ausgänge.
  3. Eindimensionale Strukturierung von Poly-L-Lysin (PLL)
    1. Entfernen Sie Staub auf der Oberfläche einer Poly-L-Lysin beschichteten Glasobjektträger unter Verwendung einer Stickstoffluftpistole. Attach die PDMS-Form auf die sauberen Glasobjektträger. Sicherzustellen, dass die Kanten der Form und dem Schlitten ausgerichtet sind.
    2. Backen für 1,5 h bei 75 ° C, um die Bindung zwischen der PDMS-Form und der PLL-beschichteten Objektträger zu verstärken. Währenddessen werden 20 Stücke aus flexiblem Polyethylenschlauch (3- bis 4-Zoll-Stücke, mit einem Innendurchmesser von 0,5 mm und einem Außendurchmesser von 1,5 mm).
      Anmerkung: Die Anzahl der Schlauchstücke, entspricht der Anzahl von Einlässen im PDMS Barcodeform. Der Schlauch dient zur Kopplung der Kanäle auf dem PDMS Barcodeform zu einem Stickstoffgastank mit einem Druckregler ausgestattet ist.
    3. An einem Ende jedes Rohrstück, befestigen eine Edelstahlhohlbolzen (1 mm Durchmesser). Aspirat sterilfiltriert Poly-L-Lysinlösung durch den Stift, bis mindestens 1 cm des Schlauchs wird mit der Lösung gefüllt.
      1. Befestigen Sie die Stifte (zur Lösung gefüllten Schlauch verbunden) an den Einlässen der PDMS Barcode Form (1E). Schließen Sie das andere Ende der Rohre zueine druckgeregelte Stickstofftank Set-up. Die Lösung wird durch die Form mit einem Druckbereich von 0,5-1 bar für mindestens 6 h fließen.
        Hinweis: Siehe Schritt (1.3.3) für alle Flussstrukturierungsverfahren.
  4. Eindimensionale Strukturierung ssDNA 14
    Anmerkung: Die Phosphat-gepufferte Salzlösung (PBS) in den nachfolgenden Schritten verwendet wird, aus 137 mM NaCl, 10 mM Na 2 HPO 4 und 2 mM KH 2 PO 4. Der pH-Wert des Puffers beträgt 7,4 hergestellt.
    1. Vorzubereiten 2 mM Bis (sulfosuccinimidyl) suberat (BS3) -Lösung in PBS. Vorzubereiten 300 uM Lösungen A, B und C ssDNA (5'-Amin-modifizierten, 80 Nukleotide) in PBS oder Reinstwasser.
      Hinweis: Mit der BS3-Lösung innerhalb von 30 min nach der Herstellung, da die N-Hydroxysuccinimid Ester leicht eine Hydrolyse.
    2. Kombinieren 2,5 ul 300 uM A, B oder C ssDNA mit 2,5 ul 2 mM bis (sulfosuccinimidyl) suberat in PBS für jeden Kanal. A, B, und C-DNA mit den Kanälen 1, 2 und 3 bezeichnet, und sind. Dieser Auftrag wird auch die verbleibenden Gruppen von 3 Kanälen (2A) angelegt wird.
    3. Führen Sie Schritt (1.3.3). Dieses Mal absaugen 5 ul BS3 / DNA-Lösungen durch Edelstahlbolzen und in die Polyethylenschlauch, dann koppeln die PDMS Form, um die Stickstoffquelle. Damit der BS3 / DNA-Lösung, durch die Strichcodeform für etwa 40 Minuten oder bis an die Kanäle gefüllt sind, fließen.
    4. Stoppen Sie den Fluss, wenn alle Kanäle belegt sind, dann inkubieren BS3 / DNA-Lösung in der Barcode bei RT für 2 h. Erlauben nicht die Lösung zu trocknen. Backen Sie die PDMS-Form mit angeschlossener Barcode-Schieber für 1 h bei 75 ° C.
      Hinweis: Um die Ausrichtung in den nachfolgenden Flussstrukturierungsschritte zu erleichtern, können die Ränder der Kanalmuster auf dem Barcode Schieber umrissen. Dies geschieht durch vorsichtiges Kratzen der Glasoberfläche mit einem Diamant Scrib getane an Ausrichtmarkierungen an der Unterseite des Objektträgers generiert. Ausrichtung in späteren Stufen des Protokolls können unter einem Mikroskop geprüft werden.
    5. Entfernen Sie die PDMS-Form von der Barcode-Folie. Sanft SDS einmal und dreimal mit hochreinem Wasser Waschen Sie die Objektträger mit 0,01%.
      1. Trocknen Sie die Barcode-Schieber mit einem Mikroskop-Objektträger Spinner. Bewahren Sie die Barcode-Folie in einer sauberen 50-ml-Zentrifugenröhrchen für die spätere Verwendung.

2. Validierung der eindimensionalen Muster auf dem Barcode-Slide

Anmerkung: Diese Validierungsprotokoll können auch zur Verwendung bei der Beurteilung der Qualität von Nachfließen Strukturierungsschritten angepasst werden.

  1. Blockieren des Schiebers
    1. Vorbereitung 1% Rinderserumalbumin (BSA) in PBS. Filtern dieser Lösung durch einen 0,45 um-Spritzenfilter vor dem Gebrauch. Verwendung eines gel-Ladespitze gelten 50 ul 1% BSA-Lösung, um einen Rand des Barcodeträger.
    2. Inkubieren Sie die 1% BSA solutIon für 1 h bei RT.
  2. Inkubation mit Cyanine 3 (Cy3) -konjugiertem komplementäre DNA
    1. Bereiten Sie einen Cocktail von A ', B' und C 'Oligonukleotide an einem Ende konjugiert an Cy3. Die Sequenzen der A ', B' und C 'sind komplementär zu denen von A, B und C sind. Die Arbeitskonzentration des Cy3-DNA beträgt 0,05 & mgr; M in 0,1% BSA.
    2. Entfernen Sie die BSA-Lösung aus der Folie durch Pipettieren, so gelten 30 ul der DNA-Cocktail-Lösung auf dem gleichen Rand des Objektträgers. Inkubieren Sie die Cy3-DNA-Cocktail auf der Folie bei Raumtemperatur für 1 Stunde. Führen Sie diese Inkubationsschritt in der Dunkelheit, die Cy3-Einheit von Photobleaching zu schützen.
  3. Analyse der Fluoreszenzintensität
    1. Pipettieren Sie die Cy3-DNA-Cocktail und waschen Sie die Folie in 1% BSA, PBS und schließlich in PBS verdünnt (1 S.Kunst PBS mit 50 Teilen hochreinem Wasser). Trocknen Sie den Schieber unter Verwendung einer Schleuder.
    2. Beachten Sie die Fluoreszenz (2B) mit einem Fluoreszenzmikroskop oder einem Microarray-Scanner. Bei der Verwendung eines Microarray-Scanner, stellen Sie den Laser-Emissionswellenlänge auf 532 nm, die Pixelgröße auf 5 Mikrometer, Photomultiplier (PMT) Verstärkung bei 450 und Leistung bei 15%.

3. Herstellung von 2-dimensionalen (3x3) DNA-Arrays 14

  1. Herstellung der PDMS Barcode Form
    1. Zuführen Verfahren (1.1), eine andere SU-8 Master realisiert werden, aber dieses Mal mit einem Chrommaske mit einem Strömungsmuster senkrecht zu der ersten Design. Führen Sie das Verfahren (1.2), um eine neue PDMS-Form mit der Senkrechten Muster zu konstruieren.
  2. Zweidimensionalen Strömungs Strukturieren ssDNA
    1. Für einen 3 x 3-Matrix, bereiten 150 uM Vorratslösungen A'-i, B'-ii, iii C'-A'-iv, B'-v, vi C'-A'-VII, B'-VIII und C'-ix DNA in 3% BSA / PBS. Diese Oligonukleotide dienen als "Brückensequenzen" (2A). Verbinden die Oligonukleotid-Lösungen (Lösungen 1 bis 3), so dass die Arbeitskonzentration von 50 & mgr; M für jedes Oligonukleotid. Benutzen Sie den Leitfaden in der Tabelle 1 zur Verfügung gestellt.
    2. Fließen 3% BSA / PBS Blocklösung in alle 20 Kanäle für 1 h bei 0,5-1 bar.
    3. Strömungs Lösungen 1, 2 und 3 in den Kanälen 1, 2 und 3. Folgen Sie dieser Reihenfolge für nachfolgende Sätze von 3 Kanälen. Stroms normalerweise in etwa 40 min abgeschlossen. Die DNA-Lösungen bei RT inkubieren für 2 Stunden, damit die DNA zu hybridisieren.
    4. Fließen 3% BSA / PBS Blocklösung in alle 20 Kanäle für 1 h bei 0,5-1 psi bis unhybridisierten DNA zu entfernen. Ziehen Sie die PDMS-Platte, und waschen Sie die erhaltenen DNA-Microarray-Objektträger durch Eintauchen der Objektträger in 3% BSA / PBS einmal und PBS zweimal durch verdünnte PBS (1 Teil PBS und 50 Teilen hochreinem Wasser) gefolgt. Dry die Folie mit einem Mikroskop-Objektträger Spinner.
    5. Führen Sie eine zweite Validierungsschritt (2C) ähnlich wie in Abschnitt 2. Verwenden Oligonukleotide i 'bis ix', die Cy3-konjugiert sind. Speichern die 3 x 3-Matrix Folie in einer 50-ml-Zentrifugenröhrchen für eine nachfolgende Verwendung.
      Anmerkung: Die DNA-Mikroarray bei RT in einem Exsikkator Monate gelagert werden.

4. Umwandlung der 3 x 3 DNA-Array in ein Array Antikörper

  1. Herstellung von Antikörper-Oligonukleotid (DEAL) Konjugate
    1. Werden die Lösungen von 200 mM Succinimidyl-4-formylbenzoat (S-4FB) und 40 mM Succinimidyl-6-hydrazinonicotinamide (S-HYNIC) in wasserfreiem N, N-Dimethylformamid (DMF).
    2. Vorbereitung bis zu 7 getrennte Lösungen von Fänger-Antikörper (1 mg / ml) in PBS.
      Hinweis: Wenn die Antikörper-Stammlösungen enthalten Natriumazid Bakteriostatikum, führen Pufferaustausch mit PBS unter Verwendung von Spin-Entsalzung columns 7 kDa Molekulargewichtsausschlußgrenze (MWCO).
    3. Bereiten separaten 400 & mgr; M Lösungen von I ', II', III ', IV', v ', VI' und vii 'DNA. Ordnen Sie jedem Capture-Antikörper auf einem Oligonukleotid-Sequenz. Kombinieren Sie 40 ul 400 uM DNA mit 12.25 ul DMF in Mikrozentrifugenröhrchen und Spin-Down, um gründlich zu mischen.
      1. Zu jeder DNA / DMF-Lösung, fügen 2,3 & mgr; l 200 mM S-4FB in DMF. Für jede 100 ug Capture-Antikörper, fügen 2,25 & mgr; l 40 mM S-HYNIC in DMF.
    4. Antikörper / S-HYNIC und DNA / S-4FB Lösungen inkubieren 4 h bei RT.
    5. In Vorbereitung für den Antikörper-DNA-Kupplungsreaktion vorzubereiten neuen Spin Entsalzungssäulen (eine für jede DNA-Lösung und eines für jeden Antikörper) durch Waschen mit Citrat-Puffer bei pH 6.
    6. Nach 4 Stunden Inkubation, führen Pufferaustausch für jeden Antikörper / S-HYNIC und DNA / S-4FB Lösung. Kombinieren Sie die S-4FB konjugierten vii 'Oligonukleotide mit den Antikörper-S-HYNIC Konjugate. Die Gemische Inkubieren für 2 h bei RT.
    7. Inkubieren Sie die Reaktion O / N bei 4 ° C.
  2. Die Reinigung von Antikörper-Oligonukleotid (DEAL) Konjugate
    Hinweis: Um die Antikörper-Oligonukleotid-Konjugate zu reinigen, führen schnelle Protein-Flüssigkeitschromatographie (FPLC) auf einer Standard-FPLC-System mit einer Superose 6 10/300 GL-Säule ausgestattet.
    1. Set der Wellenlänge des UV-Detektors der FPLC-System bis 280 nm. Verwenden isokratisch Fluss von PBS (pH 7,4) bei 0,3 ml / min, um die Antikörper-Oligonukleotid-Konjugate von der überschüssigen S-4FB-DNA zu trennen.
    2. Bündeln die Fraktionen, die das Konjugat und konzentrieren sich die Fraktionen auf ein Volumen von 150 ul unter Verwendung von Spin-Filter mit einer 10 kDa MWCO.
  3. Zweidimensionalen Strukturierung von Antikörpern
    1. Bereiten Sie einen anderen PDMS-Form mit Kleinstkammern oder Mikrovertiefungen unsing Herstellungsverfahren in Schritt (1.2). Die PDMS-Form kann Mikroliter bis Nanoliter-Vertiefungen für Immunoassays enthalten.
      Hinweis: Für allgemeine Biomarkern in fluidischen Proben wird ein PDMS-Form mit mehreren Vertiefungen, die mit dem Array Objektträger gedeckt. Die Merkmale der PDMS-Form hängen von das System untersucht. Zum Beispiel kann der Nachweis von Proteinen, die aus Einzelzellen-Experimente mit einem PDMS-Form enthaltenden Mikrokammern mit 0,15-nl Volumen durchgeführt werden.
    2. (Optional) Betreff der PDMS-Form an Plasmareinigung (18 W) für 1,5 min um seine strukturierte Oberfläche hydrophil zu machen. Vor dem Plasmareinigung mit Klebeband alle anderen Oberflächen, die direkt an die 3 x 3-Matrix Schieber verbunden werden blockieren.
      Hinweis: Schritt (4.3.2) ist optional, aber ist in der Regel durchgeführt, wenn das PDMS-Form ist für den Einsatz in Einzelzellexperimenten bestimmt.
    3. Kamerad die PDMS-Form mit dem 3 x 3-Array Rutsche, dann sperren Sie die Folie mit 1% BSA in PBS. Inkubieren für 1 h bei RT. Meanwhile, bereiten Sie einen Cocktail (200 ul Endvolumen) von Antikörper-Oligonukleotid-Konjugate. Die Arbeitskonzentration jedes Konjugat 10 ug / ml in 1% BSA / PBS.
    4. Hinzufügen des Antikörper-Oligonukleotid-Cocktail, dann Inkubieren für 1 h bei 37 ° C, damit das Oligonucleotid-Einheit der Konjugate mit bestimmten Stellen auf den 3 x 3 Matrizen hybridisieren, wodurch das DNA-Array-Konvertierung in einem Antikörper-Array.
    5. Wiederholen Sie Schritt (3.2.4) zu reinigen und trocknen Sie die Folie. Die höchste Empfindlichkeit wird erreicht, wenn der Antikörper-Array sofort verwendet werden. Längere Lagerung kann zu einem Verlust der Empfindlichkeit führen.
  4. Nachweis von Proteinen
    1. Rekonstituieren rekombinanten Proteinen oder bereiten Sie eine gefilterte Zellprobe.
    2. Kamerad des Mikroarrays mit einem speziell angefertigten Chip, und blockieren Sie die Oberfläche mit 3% BSA in PBS für 1 Stunde. Entfernen Sie dann die BSA-Lösung und gelten Proben und Inkubation für 2 Stunden.
    3. Abwaschen der Proben unter Verwendung von 3% BSA in PBS dreimal eind fügen Nachweisantikörper in einer von der Produktdatenblatt vorgesehen Konzentration. Inkubieren für 2 Stunden.
    4. Abwaschen der Nachweisantikörper durch 3% BSA in PBS dreimal, und fügen Cyanin 5 (Cy5) -streptavidin bei 1 ug / ml, gefolgt von einer Inkubation für 1 Stunde.
    5. Wiederholen Sie Schritt (3.2.4) zu reinigen und trocknen Sie die Folie für das Scannen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Die Entwürfe für die PDMS-Form (1A-1B) wurden unter Verwendung eines CAD-Programms (AutoCAD) erstellt. Zwei Entwürfe gezeigt Funktion Kanäle für Strömungs Strukturierung, eine horizontale und eine vertikale. Die linke und rechte Teile jedes Design symmetrisch sind; einer von ihnen könnte Einlässen oder Auslässen sein. Jeder der 20 Kanäle ist Wicklung von einem Ende hin zum anderen Ende. Jedes Design ist auf einem Chrom-Photomaske (Abbildung 1c) gedruckt. Hergestellter SU-8-Master auf einem Wafer wird in 1D gezeigt. Um die Strömung Strukturierung PLL oder DNA zu erleichtern, wurde der PDMS-Form zu einem Stickstoffgasstrom Aufbau (1E) gekoppelt ist.

Es gibt drei strömungsStrukturierungsSchritte in diesem Protokoll verwendet. Der erste Schritt, bewegungsunfähig PLL auf dem Glassubstrat, während die nachfolgenden Schritte sowohl einzuführen Oligonukleotidlösungen. In Tabelle 1 sind die oligonucleotide Zusammensetzungen der Lösungen 1-3 sind angegeben. Die Arbeitskonzentration jedes Oligonukleotids beträgt 50 & mgr; M, und das Gesamtvolumen jeder Lösung ist 39 & mgr; l. Diese Lösungen werden durch die Kombination von 13 ul jeder Oligonukleotid-Stammlösung (150 & mgr; M) vorbereitet.

Die gemusterten DNA-Microarray-Einheiten sind sich wiederholende und über den gesamten Objektträger nebeneinander. 3 x 3 Mikroarrays ist die maximale Dichte von etwa 400.000 Stellen auf einem Glasträger. Side-by-Side-Vergleich mit kommerziellen DNA-Microarray zeigt, dass unsere Technologie ist etwa 5-mal empfindlicher als die Bindung an Cy3 markierte komplementäre DNAs. Die gemusterten DNAs sind mit ca. 5% Abweichung über mehrere Wiederholungen relativ einheitlich. Diese Funktionen versprechen die hohe quantitative Fähigkeit unserer Technologie bei der Messung der Proteingehalt aus biologischen Proben. Darüber hinaus ist die Orthogonalität der DNAs in Kombination mit dem Durchflusskanal, bietet die flexibility der Musterung in einer Vielzahl von Geometrien (2D).

Nach dem Konvertieren des DNA-Array in einen Antikörper-Array durch Hybridisierung mit DNA-Antikörper-Konjugate (3B) wird der resultierende Antikörper-Panel Parallelnachweis hauptsächlich durch Sandwich-ELISA-Plattform verwendet wird, wie in 3C gezeigt. Im Sandwich-ELISA, biotinylierten Detektions (sekundären) Antikörper binden an die eingefangenen Proteine ​​und die anschließende Markierung mit einem Fluorophor konjugiertes Streptavidin ermöglicht fluoreszenzbasierten Detektions (3C-D). Nachweis von Proteinen zeigt <10% Abweichung von einem Ende zum anderen Ende des Objektträgers (Figur 3D). Mit der 3 x 3-Matrix, sind wir in der Lage zu erkennen, die bis zu 7-Proteine, während die Zuweisung einer Feldelement als Referenz (Cy3) und ein weiteres Element als Negativkontrolle. Zum Beispiel für geführt in eine Einzelzell-ExperimentTumor-Studien, die Proteine ​​Interleukin-6 (IL-6), Matrix-Metallopeptidase 9 (MMP-9), Hepatozyten-Wachstumsfaktor (HGF), vaskulärer endothelialer Wachstumsfaktor (VEGF), Interleukin-8 (IL-8) und Makrophagen-Migration-Hemmfaktor (MIF) von einer einzelnen Zelle gleichzeitig detektiert werden (3E).

Wir haben auch kalibriert das System mit Hilfe von rekombinanten Proteinen in verschiedenen Konzentrationen. In 3F, Eichkurven für die rekombinanten Proteine ​​Interferon-γ (IFN-γ), Tumor-Nekrose-Faktor α (TNF α), Interleukin-13 (IL-13), Tumor-Nekrose-Faktor β (TNF β), Granzym B, Interleukin 4 (IL-4) und Interleukin-8 (IL-8) gezeigt. Die Nachweisempfindlichkeit ist ziemlich ähnlich zu der herkömmlichen Sandwich-ELISA auf Lochplatten auch bei höherer Belastung der DNAs und gegebenenfalls Antikörpern auf dem Substrat.

Der Barcode Antibody Mikroarray kann zur Biomarkern in Fluidproben sowie in einzelnen Zellen zu detektieren. Da Einzelzellanalyse ist nicht im Mittelpunkt der diesem Protokoll exemplifiziert wir einfach die Anwendung der 3 x 3-Antikörper-Mikroarray in der Detektion von Zytokinen. Durch Antikörper-Oberflächenmarker Wechselwirkungen Cluster of Differentiation 8 (CD8) -positiven Zellen wurden auf einer der Mikroarray-Elementen (Figur 3G, ein PDMS-Chip auf der Oberseite) erfasst, und der Rest der Elemente wurden verwendet, um Zytokine zu detektieren ( Figur 3H). Mit dieser Zelleinfang Methode "Zellenarrays" gebildet werden kann. Dieses Array capture Technik erlaubt auch die Kontrolle über die Anzahl der Zellen auf jeden ELISA-Experiment unterzogen. Die Zellen wurden direkt in den Mikrokammern isoliert ist, so dass die detektierten Proteine ​​betrafen insbesondere einzelne Zellen. In 3H, wird gezeigt, dass sich jeder Mikrokammer mit 16 Mikroarrayelemente Verkapselung von sicherzustellen ausgestattetein komplettes 3 ​​x 3-Microarray-Set.

Abbildung 1
Figur 1. Konstruktion und Herstellung von PDMS Barcode Formen für Flow-basierte DNA Musterung. Teil (a) zeigt die AutoCAD Zeichnungen zur horizontalen und vertikalen eindimensionalen Barcode-Muster. Tafel (B) zeigt die überlagerten horizontalen und vertikalen Strichcodemuster von (A). Grün-Boxen umschließen Bereiche mit diskreten 3 x 3 Arrays gemustert. (C) Chrom-Maske zum Herstellen der SU-8 Master. (D) SU-8-Master auf einem Siliziumwafer hergestellt. (E) Set-up für die Durchfluss Musterung. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figur 2 Abbildung 2. Konstruktion und Validierung eines 3 x 3 DNA-Arrays. Diese Zahl wurde von Wang, J. et al., 2012 Nano Lett 12 modifiziert worden "Quantifizieren von Zell-Zell-Interaktion Funktionen mit Anwendungen zu Glioblastoma Multiforme Cancer Cells" . Copyright 2012 von der American Chemical Society. Mit Genehmigung angepasst. (A) Schema für die DNA Flussstrukturierungsschritte. (B) Fluoreszenzintensitätsprofil 20 Kanälen in einem ausgewählten Bereich (durch eine vertikale Linie zurückverfolgen) des 1D-Barcode. Cy3-konjugierte Oligonukleotide wurden mit den DNA-Arrays zur Validierung hybridisiert. (C) Fluoreszenzintensitätsprofil des Arrays mit Cy3-konjugierte DNA nach Abschluss des zweiten DNA Strukturierungsschritt validiert. (D) Alternative Leuchtstoffmuster aus verschiedenen flow-Strukturierungsstrategien. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figur 3
Abbildung 3. Anwendungen des 3 x 3-Mikroarray. (A) Schema für die Synthese von Antikörper-Oligonukleotid-Konjugate DEAL. (B) Schema für die Umwandlung der DNA-Array in einem Antikörper-Array durch Hybridisierung mit Antikörper-Oligonukleotid-Konjugate. (C) Schema zum Verwenden des 3 x 3 Mikroarray in einem Sandwich-ELISA-Plattform. Diese Zahl hat sich von Wang, J. et al., 2012 Nano Lett 12 modifiziert worden "Quantifizieren von Zell-Zell-Interaktion Funktionen mit Anwendungen zu Glioblastoma Multiforme Krebszellen". Urheberrecht 2012 durch die American Chemical Society. Mit Genehmigung angepasst. Panel (D) zeigt ein Fluoreszenzauslese unter einem Cy5 Kanal erzeugt. Dies entspricht einem Sandwich-ELISA-Experiment, das 6-Proteine ​​nachgewiesen. Panel (E) ist eine vergrößerten Profil eines 3 x 3-Array Auslese unter Cy3 und Cy5-Kanälen. Platte (F) zeigt die Sandwich-ELISA-Eichkurven für rekombinante Proteine. Panel (G) zeigt ein "Zellenanordnung" durch die Erfassung von Zellen durch die Bindung mit Antikörpern auf dem Array gebildet. Panel (H) zeigt das Erfassungsergebnis mit Mikrokammern in einem Mikrochip überlagert. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

1
Lösung Oligonukleotid-Zusammensetzung
A'-i, B'-ii, C'-iii
2 A'-iv, B'-v, C'-vi
3 A'-vii, B'-viii, C'-ix

Tabelle 1. Zusammensetzung der Lösungen 1-3 für die DNA-Flow-Patterning.

Verankerungssequenzen
EIN ATCCTGGAGCTAAGTCCGTA-AAAAAAAAAAAAAAAAAAAA-ATCCTGGAGCTAAGTCCGTA-AAAAAAAAAAAAAAAAAAAA
B GCCTCATTGAATCATGCCTA-AAAAAAAAAAAAAAAAAAAA-GCCTCATTGAATCATGCCTA-
AAAAAAAAAAAAAAAAAAAA
C GCACTCGTCTACTATCGCTA-AAAAAAAAAAAAAAAAAAAA-GCACTCGTCTACTATCGCTA-AAAAAAAAAAAAAAAAAAAA
Bridging-Sequenzen
A'-i TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-ATGGTCGAGATGTCAGAGTA
B'-ii TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-ATGTGAAGTGGCAGTATCTA
C'-iii TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-ATCAGGTAAGGTTCACGGTA
A'-iv TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-GAGTAGCCTTCCCGAGCATT
B'-v TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-ATTGACCAAACTGCGGTGCG
C'-vi TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-TGCCCTATTGTTGCGTCGGA
A'-vii TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-TCTTCTAGTTGTCGAGCAGG
B'-viii TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-TAATCTAATTCTGGTCGCGG
C'-ix TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-GTGATT AAGTCTGCTTCGGC
Cy3-konjugierten Oligonukleotide für die Validierung
EIN' TACGGACTTAGCTCCAGGAT
B ' TAGGCATGATTCAATGAGGC
C ' TAGCGATAGTAGACGAGTGC
ich' TACTCTGACATCTCGACCAT
ii ' TAGATACTGCCACTTCACAT
iii ' TACCGTGAACCTTACCTGAT
iv ' AATGCTGGGGAAGGCTACTC
v ' CGCACCGCAGTTTGGTCAAT
vi " TCCGACGCAACAATAGGGCA
vii ' CCTGCTCGACAACTAGAAGA
viii ' CCGCGACCAGAATTAGATTA
ix ' GCCGAAGCAGACTTAATCAC
"Fo: keep-together.within-page =" 1 "> Tabelle 2 Sequenzen in der DNA-Flow-Strukturierung verwendet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Strömungsmuster Design ist der erste wichtige Schritt bei der Herstellung der 2-D-Mikroarray. Um zwei überlappende DNA-Muster auf einem Glassubstrat zu erzeugen, müssen die Kanal Merkmale des ersten Design senkrecht zu denen des zweiten (1A-B). Die Entwürfe beachten Sie auch die nachgelagerten Anwendungen des Mikroarrays. Im Fall der Einzelzellanalyse wird der Mikroarray verwendet werden, um Proteine, die von einzelnen Zellen in Mikrokammern umschlossen erfassen, damit die Kanalabmessungen mit den Mikrokammern, die mit den 2-D-Arrays auszurichten kompatibel gemacht. Jedes Design wird auf einer Photomaske gemacht und Standard-Photolithographietechniken verwendet, um die Kanalmerkmale in SU-8 auf einem Siliziumwafer (1C-D) herzustellen. Dies dient als Master für Form PDMS. Sobald die Form hergestellt worden ist, wird zu einer PLL-beschichteten Objektträger gebunden ist, und dann mit einem Stickstoffgasstrom Aufbau (1E) gekoppelt ist. Das Set-up haben wirVerwendung ist einfach und hat den Vorteil, dass sie leicht in jedes Labor mit einer druckgeregelten Stickstoffgasquelle eingebaut. Wir verwenden eine Anordnung kostengünstig zu einem Stickstoffgastank verbunden mehrere 3-Wegeventile. Der Luftstrom zum Strukturieren müssen bei niedrigen Drücken (0,5-1 psi) gehalten werden, um die Delaminierung der Glasobjektträger aus der Form zu vermeiden. Lecks innerhalb des PDMS-Form kann die Integrität der Muster beeinträchtigen.

Die DNA-Flow Strukturierungsschritte in diesem Protokoll nutzen ssDNA mit sorgfältig ausgewählten orthogonalen Sequenzen (Abbildung 2A). Vor Durchlaufchromatographie Strukturierung, die spezifische Sequenzen dieser Oligonukleotide sollte die Abwesenheit von Übersprechen untersucht werden. Ein einfacher Test für Übersprechen wird durch Modifizieren der Validierungsverfahren in unserem Protokoll einzuführen (Schritt 2) durchgeführt. Anstelle der Verwendung eines Cocktails von Cy3-markierten komplementären DNA, wird nur eine Art der komplementären Sequenz zu einer Zeit für einen ausgewählten Bereich des Objektträgers verwendet, auf denen mehrereDNA-Sequenzen immobilisiert sind. In Abwesenheit von DNA-Übersprechen, sollte nur ein Streifen (für die 1-D-DNA-Array) oder einen Punkt (für die 2-D-DNA-Array) unter einem Cy3 Filter fluoreszierend sein. Beispiele gründlich validiert orthogonalen Sequenzen können in der Tabelle der Materialien und Geräte zu finden. Die erste DNA-Strukturierungsschritt führt drei Arten von "Anker" Oligonukleotiden. Diese 80-nt-Sequenzen werden von zwei 20-mer Poly-A-Regionen, die mit zwei einzigartigen 20-mer-Sequenzen abwechseln besteht. Die 5'-Amin-Modifikation auf diesen Ankersequenzen ist für Amin-zu-Amin-Vernetzungs 17 mit PLL von BS3 vermittelten notwendig. Die zweite DNA-Strukturierungsschritt erfordert nicht einen Vernetzer. Dieser Schritt stellt "Bridging" Oligonukleotide, die teilweise mit den Anker-Sequenzen hybridisieren. Jeder 60-nt Brückensequenz besteht aus einem 20-mer-Region komplementär zu einem Anker-Sequenz, einem 20-mer Poly-A-Abstandhalter und einer einzigartigen 20-mer-Sequenz. Validierung der DNA-Arrays (Figure 2B-C) wird nach jeder DNA strömungsStrukturierungsSchritt durchgeführt, um die Qualität der Strukturierungsschritte zu bewerten und keine Kreuzkontamination 14 zu gewährleisten. Dies wird durch Einführen von Cy3-konjugierte Oligonukleotid-Sonden, die mit den DNA-Mustern, hybridisieren geführt. Mit dem in Schritt (2.3.2) angegebenen Parameter für die Analyse der Fluoreszenzintensität sollte die DNA-Muster Fluoreszenzintensitäten von mindestens 40.000 au weisen, um die Empfindlichkeit der nachgeschalteten Immunoassays maximieren unter Verwendung des Mikroarrays. Strategische Verwendung unterschiedlicher Cy3-DNA-Sets bei der Validierung entstehen alternative Muster (Figur 2D), was zeigt, die Flexibilität der DNA Strukturierungsschritte 8. Nichtbeachtung einheitlichen Muster könnte von Undichtigkeiten oder mechanische Hindernisse (wie zB Staubpartikel) führen zu erzielen begegnet in den Strömungs-Strukturierungsschritte.

Die Herstellung von Antikörper-Oligonukleotid-Konjugate DEAL ist ein weiterer wichtiger Schritt in thist Protokoll. Die Auswahl von Antikörpern durch das biologische System in Untersuchung bestimmt. Die in Konjugation verwendeten Oligonukleotide sollten Sequenzen, die komplementär zu denen auf dem DNA-Array verankert. Stammlösungen der S-4FB und S-HYNIC Linker sollte frisch zubereitet und aufbewahrt weg von der Feuchtigkeit, um die Hydrolyse zu vermeiden. Die Inkubationszeiten in unserem Konjugation Protokoll sind lang genug, um die gewünschten Funktionalitäten auf den Antikörpern und DNA einzuführen. Die endgültige Kupplungsreaktion nur durch Entfernen der nicht umgesetzten S-4FB konjugierten Oligonukleotiden über FPLC abgeschreckt. Somit sollte FPLC Reinigung direkt nach der Konjugation erfolgen. Bei der Durchführung von FPLC mit der in unserem Protokoll beschriebenen System niedriger Durchflussraten (0,2 bis 0,25 ml / min) kann auch verwendet werden, um die Auflösung zu verbessern. Die Konjugate werden als breiter Peak (Elution Volumen von rund 9-15 ml), die vor einem engeren und höhere DNA-Peak (17-20 ml Elutionsvolumen) wird eluiert. Wir empfehlen nicht, Speichern LösungenKonjugate mit überschüssigem S-4FB-DNA, da dies zu einem Verlust der Antigen-Bindungsstellen in dem Antikörper nach Konjugation mit überschüssigem funktionalisierte DNA führen. Die Empfindlichkeit, Spezifität und Reproduzierbarkeit des Sandwich-ELISAs unter Verwendung DEAL Konjugate wurden in früheren Studien nachgewiesen. 8,9,11,12,16 Um die Qualität der Antikörper-DNA-Konjugate zu bewerten, können die Konjugate auf DNA-Arrays, um die Erzeugung inkubiert werden Antikörperarray, das anschließend in Sandwich-ELISA-Experimenten verwendet wird, um Kalibrierungskurven für die Proteindetektion (3F) zu erzeugen. Diese Kalibrierkurven können rekombinante Proteine ​​in einem herkömmlichen Sandwich-ELISA-Kits bereitgestellt werden. Die Verwendung von hochwertigen Konjugate sollte Vorrücken in linearen Bereichen und unteren Nachweisgrenzen vergleichbar mit denen des Bausatzes ergeben. Als Beispiel die Untergrenzen und die INF & gamma; TNFa für Sandwich-ELISA auf der Antikörperarray (3F) sind ~ 50-100 pg / ml und sind consistent mit dem linearen Erfassungsbereich von ~ 15-1,000 pg / ml im Produktdatenblatt für den herkömmlichen Sandwich-ELISA-Kit angezeigt. Schlechte Signalauslese in nachgelagerten Sandwich-ELISA-Experimenten erhalten könnte auf die geringe Qualität der DNA-Array, die Einmischung der überschüssige DNA in den Konjugat-Lösungen, oder alternativ, unvollständige Konjugation ssDNAs mit Antikörpern zurückgeführt werden.

Hauptanliegen für die Durchführung Sandwich-ELISA auf dem Antikörper-Array gehören Übersprechen zwischen Reagenzien und ob das Signal spiegelt die realen biologischen Ereignisse. Die orthogonalen DNAs, die wir in diesem Protokoll wurden gründlich validiert, um weniger als 0,1% Übersprechen zu haben. Daher ist jede im Immunoassay Bühne beobachtet Nebensprechen ist in erster Linie aus den Antikörpern und ELISA Reagenzien. Die Prüfung auf Übersprechen zwischen Antikörpern im Array sollten vor der Durchführung von Tests an realen Proben durchgeführt werden. Sobald ein Antikörper-Panel aufgebaut ist, sollte ein paar Sandwich-ELISA-Kontrollexperimenten perf seinORMED mit den folgenden Bedingungen: 1. Ohne Antigene, 2. Ohne Nachweis-Antikörper und 3. Nachweis-Antikörper und nur Markierungsreagenzien. Wenn Übersprechen an der Immunoassay Phase beobachtet werden, sollte die Antikörperpaaren und / oder ELISA-Reagenzien ersetzt werden. Es sei darauf hingewiesen, dass die Verwendung von im Handel erhältlichen Antikörper aus herkömmlichen ELISA-Kits garantiert nicht Anwendbarkeit auf die Arrays basierende Sandwich-ELISA-Technik.

Die Vorteile dieser Technologie sind kostengünstige Fertigung, Miniaturgröße und Flexibilität des Designs. Unsere Herstellungsprotokoll muss nicht eine Microarray-Spotter, die nicht zur Verfügung stehen, um viele Benutzer von Antikörper-Arrays können. Die Strömungsmusteraufbau kann leicht in einfachen Labors montiert werden. Für Laboratorien, die nicht mit den Instrumenten für die Photolithographie ausgestattet sind, können die CAD-Konstruktionen bieten wir in unserem Protokoll, um Unternehmen, die Mikrofertigung Dienstleistungen anbieten weitergeleitet. Verkleinerung der herkömmlichen Microarray-inder kompakte Array mit unserem Protokoll gefertigt ermöglicht die Kompatibilität mit Mikrochips in Einzelzell-Experimenten verwendet. Unser Protokoll bietet die Herstellung des Arrays als ssDNA Array zuerst vor der Umwandlung in einem Antikörper-Array. Vorab Strukturierung mit ssDNAs hat eine Reihe von Vorteilen. Erstens sind ssDNAs chemisch stabiler im Vergleich zu Antikörpern, wodurch die ssDNA-gemusterten Folien können in einem Exsikkator für mindestens 6 Monate ohne signifikanten Abbau 8,16 gespeichert werden. Zweitens bietet unser Ansatz ein Endbenutzer die Flexibilität, die Tests benötigt werden, durch einfaches Zusammenmischen der selektiven Konjugate in einer Lösung ohne Modifikation des Mikroarrays zu wählen; Im Gegensatz dazu sind herkömmliche Protein / Antikörperarrays vorgefertigten und auf einem Substrat befestigt ist, so dass der Wechsel von Assays würde die Musterung / Drucken von Proteinen / Antikörper von Anfang an erforderlich. Repräsentative Untersuchungen zeigen die Verwendung des Strichcode-Antikörper-Mikroarray in der Hochdurchsatz-Erkenn von mehreren Signalproteine ​​von einzelnen Zellen. Durch Variation der Strömungsmuster-Designs und / oder die Oligonukleotid Musterlösungen verwendet wird, kann eine Vielzahl von Array-Layouts erkundet werden. Als Beispiel für diese Anwendung kann die funktionelle Proteine, die aus einzelnen Zellen untersucht werden. Der Chip für die Einzelzellanalyse umfasst nicht weniger als ~ 8.700 Mikrokammern, die jeweils mit einer vollständigen 3 x 3-Antikörper-Array (Figur 3H) ausgerichtet ist. Ein solcher Aufbau ermöglicht Hochdurchsatz-Erkennung. Proteine, die von Zellen in Mikrokammern kultiviert sezerniert kann durch diese Anordnung nachweisbar. Das vielseitige Microarray-Design ermöglicht auch Multiplex-Nachweis von Proteinen aus Serum, Zelllysate und Einzelzellen, nachdem die Kombination der Mikroarray mit anderen generischen Komponenten 8,15. Zusätzlich zum Nachweis von Proteinen, die 3 x 3-Antikörper-Array auch nützlich bei der Erfassung von Zellen (Figur 3G).

Der größte Nachteil dieses Ansatzes ist, ihren Mehr komplexity verglichen mit der Herstellung von herkömmlichen Mikroarrays. Strategien zur Strukturierung und zur Array-Design muss sorgfältig konzipiert werden unter Berücksichtigung der spezifischen Anwendungen der hergestellten Array. Dieser Ansatz erfordert auch eine Reihe von kritischen Schritte einschließlich Validierungsverfahren und Prüfungen für Übersprechen. Die 3 x 3-Matrix, die unter Verwendung unserer Protokolls beschränkt auf die Detektion 7-Proteine ​​zu einem Zeitpunkt. Allerdings kann diese Grenze durch die Schaffung von größeren Arrays übertroffen werden. Die hier vorgestellten Protokoll ist nicht auf die Herstellung von 3 x 3 Mikroarrays beschränkt. Wir waren in der Lage, erfolgreich herzustellen 5 x 5 Mikroarrays und anderen Dimensionen der Array-Elemente. Grundsätzlich können auch andere n x m-Arrays unter Verwendung von ähnlichen Techniken, solange die Oligonukleotidsets in der Erstellung der vorläufigen DNA-gemusterte Raster verwendet werden, sind senkrecht zu Übersprechen zwischen Feldelementen zu vermeiden, hergestellt werden. Die Schaffung des erweiterten Arrays wird durch Strömungs patterni erreichtng n Arten von ssDNA Anker für die erste DNA-Strukturierungsschritt, gefolgt von n x m Überbrückungs ssDNA-Sequenzen für den zweiten Strukturierungsschritt. Zum Beispiel, um eine 5 x 5-Array erstellen, können Ankersequenzen A bis E verwendet werden, während Überbrückungssequenzen A'-i auf e'-xxv genutzt werden. Um den Fluss Strukturierungsprozess zu automatisieren, wurde ein Robotik-Plattform entwickelt, 18 obwohl dies nur eine DNA-Flow Strukturierungsschritt genutzt. Im Prinzip kann dieselbe Plattform, um den zweiten Schritt der senkrechten Strömungsmuster verlängert werden, während die Umschaltung zwischen beiden Schritte können manuell erfordern Abziehen der ersten PDMS-Form nach dem ersten Strukturierungsschritt, gefolgt von Waschen und Trocknen der Objektträger (dieser Schritt würde dauert etwa 10 min), vor der Paarung die Folie mit einem anderen PDMS-Form, die senkrecht orientierten zweiten Strukturierungsschritt zu erleichtern.

Wir haben detaillierte Verfahren zur Herstellung eines nxm Array strukturiert diskutiertmit Antikörpern mit hoher Dichte, die ein großes Versprechen für zukünftige Anwendungen in der Proteom-Studien und Zellsignalisierung hält. Das hier vorgestellte Protokoll kann auch als Führung für die Konstruktion aufwendiger DNA / Antikörper-Arrays für andere Zwecke dienen.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Sylgard 184 silicone elastomer base Dow Corning 3097366-1004
Sylgard 184 silicone elastomer curing agent Dow Corning 3097358-1004
SU-8 2025 photoresist MicroChem Y111069
Silicon wafers  University Wafers 452
Poly-L-lysine coated glass slides Thermo Scientific C40-5257-M20
Oligonucleotides Integrated DNA Technologies *Custom-ordered from Integrated DNA Technologies, see Table 2.
Poly-L-lysine adhesive stock solution Newcomer Supply 1339
Bis (sulfosuccinimidyl) suberate  (BS3) Thermo Scientific 21585
1x Phosphate buffered saline, pH 7.4 Quality Biological 114-058-101
Äkta Explorer 100 Fast Protein Liquid Chromatography (FPLC) System GE (Amersham Pharmacia)  18-1112-41
Superose 6 10/300 GL column GE Healthcare Life Sciences 17-5172-01
Capture antibodies various various *Antibody selection depends on application
Succinimidyl-6-hydrazino-nicotinamide (S-HyNic) Solulink S-1002
Succinimidyl-4-formylbenzamide (S-4FB) Solulink S-1004
N,N-dimethylformamide Sigma-Aldrich 227056
Citric acid, anhydrous Acros 42356
Sodium hydroxide Fisher Scientific S318
Amicon Ultra spin filter 10 kDa MWCO EMD Millipore UFC201024
Spin coater Laurell Technologies WS-650-MZ
Biopsy punch with plunger (1.0 mm diameter) Ted Pella, Inc. 15110-10
Diamond scribe (Style 60) SPI supplies 6004
Trimethylchlorosilane Sigma Aldrich 92361

DOWNLOAD MATERIALS LIST

References

  1. Alhamdani, M. S. S., Schroder, C., Hoheisel, J. D. Oncoproteomic profiling with antibody microarrays. Genome Med. 1, (7), (2009).
  2. Angenendt, P. Progress in protein and antibody microarray technology. Drug Discov Today. 10, (7), 503-511 (2005).
  3. Sun, H. Y., Chen, G. Y. J., Yao, S. Q. Recent advances in microarray technologies for proteomics. Chem Biol. 20, (5), 685-699 (2013).
  4. Fan, R., et al. Integrated barcode chips for rapid, multiplexed analysis of proteins in microliter quantities of blood. Nat Biotechnol. 26, (12), 1373-1378 (2008).
  5. Chattopadhyay, P. K., Gierahn, T. M., Roederer, M., Love, J. C. Single-cell technologies for monitoring immune systems. Nat Immunol. 15, (2), 128-135 (2014).
  6. Varadarajan, N., et al. Rapid, efficient functional characterization and recovery of HIV-specific human CD8(+) T cells using microengraving. Proc Natl Acad Sci USA. 109, (10), 3885-3890 (2012).
  7. Ma, S., et al. Electroporation-based delivery of cell-penetrating peptide conjugates of peptide nucleic acids for antisense inhibition of intracellular bacteria. Integr Biol-Uk. 6, (10), 973-978 (2014).
  8. Wang, J., et al. Quantitating cell-cell interaction functions with applications to glioblastoma multiforme cancer cells. Nano Lett. 12, (12), 6101-6106 (2012).
  9. Kravchenko-Balasha, N., Wang, J., Remacle, F., Levine, R. D., Heath, J. R. Glioblastoma cellular architectures are predicted through the characterization of two-cell interactions. Proc Natl Acad Sci USA. 111, (17), 6521-6526 (2014).
  10. Xue, M., et al. Chemical methods for the simultaneous quantitation of metabolites and proteins from single cells. J Am Chem Soc. 137, (12), 4066-4069 (2015).
  11. Shi, Q. H., et al. Single-cell proteomic chip for profiling intracellular signaling pathways in single tumor cells. Proc Natl Acad Sci USA. 109, (2), 419-424 (2012).
  12. Ma, C., et al. A clinical microchip for evaluation of single immune cells reveals high functional heterogeneity in phenotypically similar T cells. Nat Med. 17, (6), 738-743 (2011).
  13. Deng, Y., et al. An integrated microfluidic chip system for single-cell secretion profiling of rare circulating tumor cells. Sci Rep. 4, 7499 (2014).
  14. Vermesh, U., et al. High-density, multiplexed patterning of cells at single-cell resolution for tissue engineering and other applications. Angew Chem Int Ed. 50, (32), 7378-7380 (2011).
  15. Yu, J., et al. Microfluidics-based single-cell functional proteomics for fundamental and applied biomedical applications. Annu Rev Anal Chem. 7, 275-295 (2014).
  16. Bailey, R. C., Kwong, G. A., Radu, C. G., Witte, O. N., Heath, J. R. DNA-encoded antibody libraries: A unified platform for multiplexed cell sorting and detection of genes and proteins. J Am Chem Soc. 129, 1959-1967 (2007).
  17. Alegria-Schaffer, A. General protein-protein cross-linking. Methods Enzymol. 539, 81-87 (2014).
  18. Ahmad, H., et al. A robotics platform for automated batch fabrication of high density, microfluidics-based DNA microarrays, with applications to single cell, multiplex assays of secreted proteins. Rev Sci Instrum. 82, 094301 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics