कार्यात्मक गैर-कोडिंग आनुवंशिक वेरिएंट के लिए स्क्रीनिंग का उपयोग electrophoretic गतिशीलता शिफ्ट परख (EMSA) और डीएनए आत्मीयता वर्षा परख (DAPA)

* These authors contributed equally
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Miller, D. E., Patel, Z. H., Lu, X., Lynch, A. T., Weirauch, M. T., Kottyan, L. C. Screening for Functional Non-coding Genetic Variants Using Electrophoretic Mobility Shift Assay (EMSA) and DNA-affinity Precipitation Assay (DAPA). J. Vis. Exp. (114), e54093, doi:10.3791/54093 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

अनुक्रमण और जीनोम चौड़ा संघ स्टडीज (GWAS), उम्मीदवार ठिकाना अध्ययन सहित जीनोटाइपिंग आधारित अध्ययन, और गहरी अनुक्रमण अध्ययन, कई आनुवंशिक वेरिएंट कि सांख्यिकीय एक बीमारी, लक्षण, या phenotype के साथ जुड़े रहे हैं की पहचान की है। जल्दी भविष्यवाणियों के विपरीत, इन वेरिएंट (85-93%) की सबसे अधिक गैर-कोडिंग क्षेत्रों में स्थित हैं और प्रोटीन 1,2 के अमीनो एसिड अनुक्रम बदल नहीं है। इन गैर-कोडिंग वेरिएंट के समारोह की व्याख्या करना और उन्हें जुड़े रोग से जोड़ने के जैविक तंत्र का निर्धारण करने, विशेषता, या phenotype चुनौतीपूर्ण 3-6 साबित कर दी है। जीन अभिव्यक्ति - हम एक सामान्य रणनीति आणविक तंत्र है कि एक महत्वपूर्ण मध्यवर्ती phenotype के लिए वेरिएंट लिंक की पहचान करने के लिए विकसित किया है। इस पाइप लाइन के लिए विशेष रूप से टीएफ आनुवंशिक वेरिएंट द्वारा बाध्यकारी के मॉडुलन की पहचान करने के लिए बनाया गया है। इस रणनीति के कम्प्यूटेशनल दृष्टिकोण और भविष्यवाणी करने के उद्देश्य से आणविक जीव विज्ञान तकनीक को जोड़ती हैसिलिको में उम्मीदवार वेरिएंट की जैविक प्रभाव, और इन भविष्यवाणियों को सत्यापित अनुभव से (चित्रा 1)।

आकृति 1
चित्रा 1:।। कि इस पांडुलिपि में विस्तृत ग्रे में छायांकित हैं के साथ जुड़े प्रोटोकॉल में शामिल नहीं हैं गैर-कोडिंग आनुवंशिक वेरिएंट कदम के विश्लेषण के लिए सामरिक दृष्टिकोण यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

कई मामलों में, यह वेरिएंट की सूची का विस्तार प्रत्येक सांख्यिकीय रूप से जुड़े संस्करण के साथ उच्च लिंकेज-असंतुलन (एलडी) में उन सभी को शामिल करने से शुरू करने के लिए महत्वपूर्ण है। एलडी दो अलग गुणसूत्र पदों पर alleles की गैर यादृच्छिक एसोसिएशन, जो आर 2 आंकड़ा 7 से मापा जा सकता का एक उपाय है। आर 2 लिन का एक उपाय हैKage दो वेरिएंट के बीच एक आर 2 = 1 denoting सही लिंकेज के साथ दो वेरिएंट के बीच असंतुलन। उच्च एलडी में alleles पैतृक आबादी भर में गुणसूत्र पर सह-अलग पाए जाते हैं। वर्तमान जीनोटाइपिंग सरणियों मानव जीनोम में सभी ज्ञात वेरिएंट में शामिल नहीं है। इसके बजाय, वे मानव जीनोम के भीतर एलडी शोषण और ज्ञात वेरिएंट कि एलडी 8 के एक विशेष क्षेत्र के भीतर अन्य वेरिएंट के लिए परदे के पीछे के रूप में कार्य की एक सबसेट शामिल हैं। इस प्रकार, किसी भी जैविक परिणाम के बिना एक संस्करण एक विशेष रोग के साथ जुड़ा हो सकता है, क्योंकि यह कारण संस्करण-एक सार्थक जैविक प्रभाव के साथ संस्करण के साथ एलडी में है। Procedurally, इसे बदलने के लिए 1,000 जीनोम की नवीनतम रिलीज plink 10,11, पूरे जीनोम एसोसिएशन के विश्लेषण के लिए एक खुला स्रोत उपकरण के साथ संगत द्विआधारी फाइलों में 9 संस्करण कॉल फ़ाइलें (वीसीएफ) परियोजना की सिफारिश की है। बाद में, एलडी आर 2> 0.8 के साथ अन्य सभी आनुवंशिक वेरिएंट प्रत्येक इनपुट आनुवंशिक VA के साथरियांत उम्मीदवार के रूप में पहचाना जा सकता है। यह इस कदम उदाहरण के लिए उचित संदर्भ आबादी का उपयोग करने के लिए महत्वपूर्ण है अगर एक संस्करण यूरोपीय वंश के विषयों, इसी वंश के विषयों से डेटा एलडी विस्तार के लिए इस्तेमाल किया जाना चाहिए में पहचान की थी।

एलडी विस्तार अक्सर उम्मीदवार वेरिएंट के दर्जनों में परिणाम है, और यह संभावना है कि केवल इन में से एक छोटा सा अंश रोग तंत्र के लिए योगदान करते हैं। अक्सर, यह प्रयोगात्मक व्यक्तिगत रूप से इन वेरिएंट के प्रत्येक जांच करने के लिए अव्यवहार्य है। इसलिए यह वेरिएंट को प्राथमिकता के लिए एक फिल्टर के रूप में सार्वजनिक रूप से उपलब्ध कार्यात्मक जीनोमिक डेटासेट के हजारों लाभ उठाने के लिए उपयोगी है। उदाहरण के लिए, सांकेतिक शब्दों में संघ के 12 चिप seq प्रयोगों TFS के बंधन का वर्णन है और सह कारकों, और हिस्टोन के निशान के हजारों संदर्भों की एक विस्तृत श्रृंखला में, क्रोमेटिन पहुंच डेटा के साथ प्रौद्योगिकियों से इस तरह के DNase-सेक 13, ATAC के रूप में किया गया है साथ -seq 14, और न आने-सेक 15। databases और ऐसे UCSC जीनोम ब्राउज़र 16, रोडमैप Epigenomics 17 खाका epigenome 18, Cistrome 19, और 20 REMAP के रूप में वेब सर्वर प्रकार की कोशिकाओं और स्थितियों की एक विस्तृत रेंज भर में इन और अन्य प्रयोगात्मक तकनीक द्वारा उत्पादित डेटा के लिए स्वतंत्र पहुँच प्रदान करते हैं। प्रयोगात्मक जांच करने के लिए भी कई वेरिएंट कर रहे हैं, इन आंकड़ों प्रासंगिक सेल और प्रकार के ऊतकों में होने की संभावना विनियामक क्षेत्रों के भीतर स्थित उन प्राथमिकता करने के लिए इस्तेमाल किया जा सकता है। इसके अलावा, उन मामलों में जहां एक संस्करण एक विशेष प्रोटीन के लिए एक चिप seq चोटी के भीतर है, इन आंकड़ों के संभावित सुराग विशिष्ट टीएफ (s) या सह कारकों जिसका बाध्यकारी को प्रभावित किया जा सकता है के रूप प्रदान कर सकते हैं।

अगले, जिसके परिणामस्वरूप प्राथमिकता के आधार पर वेरिएंट प्रयोगात्मक भविष्यवाणी जीनोटाइप निर्भर प्रोटीन को मान्य करने के EMSA 21,22 का उपयोग कर बाध्यकारी जांच कर रहे हैं। EMSA एक गैर कम करने TBE जेल पर oligo के प्रवास में परिवर्तन के उपाय। Fluorescently लेबल oligo साथ incubated हैपरमाणु lysate, और परमाणु कारकों के बंधन जेल पर oligo के आंदोलन को धीमा होगा। इस तरह से, oligo कि अधिक परमाणु कारकों बाध्य किया गया है स्कैनिंग पर एक मजबूत फ्लोरोसेंट संकेत के रूप में पेश होगा। विशेष रूप से, EMSA विशिष्ट प्रोटीन जिसका बाध्यकारी प्रभावित हो जाएगा के बारे में भविष्यवाणी की आवश्यकता नहीं है।

एक बार जब वेरिएंट की पहचान कर रहे भविष्यवाणी की नियामक क्षेत्रों के भीतर स्थित है और विभिन्न बाध्यकारी परमाणु कारकों में सक्षम हैं कि, कम्प्यूटेशनल विधियों विशिष्ट टीएफ (s) जिसका बाध्यकारी वे प्रभावित कर सकता है भविष्यवाणी करने के लिए कार्यरत हैं। हम सीआईएस-बीपी 23,24, RegulomeDB 25, UniProbe 26, और 27 JASPAR का उपयोग करने के लिए पसंद करते हैं। एक बार उम्मीदवार TFS पहचान कर रहे हैं, इन भविष्यवाणियों विशेष रूप से इन TFS (EMSA-supershifts और DAPA-पाश्चात्य) के खिलाफ एंटीबॉडी का उपयोग कर परीक्षण किया जा सकता है। एक EMSA-supershift परमाणु lysate और oligo के लिए एक टीएफ विशिष्ट एंटीबॉडी के अलावा शामिल है। एक EMSA-supershift में एक सकारात्मक परिणाम रेपर है(संदर्भ 28 में समीक्षा) EMSA बैंड में एक और पारी, या बैंड का एक नुकसान के रूप में esented। पूरक DAPA में, एक 5'-biotinylated oligo संस्करण और 20 आधार जोड़ी न्यूक्लियोटाइड flanking युक्त द्वैध किसी भी परमाणु कारकों विशेष रूप से बाध्यकारी ओलिगोस पर कब्जा करने के लिए प्रासंगिक सेल प्रकार (ओं) से परमाणु lysate साथ incubated हैं। oligo द्वैध परमाणु कारक परिसर में एक चुंबकीय स्तंभ में microbeads streptavidin से स्थिर है। बाध्य परमाणु कारकों क्षालन 29,48 के माध्यम से सीधे एकत्र कर रहे हैं। बंधन भविष्यवाणियों तो एक पश्चिमी धब्बा प्रोटीन के लिए विशिष्ट एंटीबॉडी का उपयोग द्वारा मूल्यांकन किया जा सकता है। मामलों में जहां कोई स्पष्ट भविष्यवाणियों, या बहुत अधिक भविष्यवाणियों, DAPA प्रयोगों के संस्करण पुल-चढ़ाव से elutions बड़े पैमाने पर स्पेक्ट्रोमेट्री का उपयोग उम्मीदवार TFS की पहचान करने के लिए एक प्रोटिओमिक्स कोर करने के लिए भेजा जा सकता है देखते हैं, जो बाद में उपयोग करते हुए मान्य किया जा सकता में ये पहले से वर्णित तरीकों।

articl के शेष मेंई, आनुवंशिक वेरिएंट की EMSA और DAPA विश्लेषण के लिए विस्तृत प्रोटोकॉल प्रदान की जाती है।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. समाधान और अभिकर्मकों की तैयारी

  1. EMSA और DAPA में उपयोग के लिए कस्टम डीएनए oligonucleotide जांच के आदेश।
    1. बाध्यकारी गैर विशिष्ट प्रोटीन को कम करने के लिए, कम ओलिगोस डिजाइन 30, और केंद्र अपने 17 बीपी अंतर्जात जीनोमिक अनुक्रम से घिरे सीधे हित के संस्करण जगह (लंबाई में 35-45 आधार जोड़े (बीपी) के बीच)। EMSA ओलिगोस के लिए, एक 5 'fluorophore जोड़ें। DAPA ओलिगोस के लिए, एक 5 'बायोटिन टैग को जोड़ने।
    2. ताकि दोनों भावना किनारा और उसके रिवर्स पूरक किनारा। वैकल्पिक रूप से, क्रम में डुप्लेक्स (पूर्व annealed) ओलिगोस। जब ओलिगोस नामकरण, एक की स्थापना संदर्भ जीनोम पर नामकरण का आधार।
      नोट: "रिस्क" और "गैर-जोखिम" पदनाम रोग और परियोजना विशिष्ट हो सकता है, जबकि "संदर्भ" और "गैर-संदर्भ" अधिक सार्वभौमिक प्रासंगिक हैं।
    3. ओलिगोस के आगमन पर, संक्षेप में 100 μ के अंतिम एकाग्रता के लिए सामग्री और nuclease मुक्त पानी में resuspend नीचे स्पिन, एम। स्टोर -20 डिग्री सेल्सियस पर शेयर resuspended। एल्यूमीनियम पन्नी के साथ लपेटकर द्वारा प्रकाश से एक fluorophore के साथ टैग ओलिगोस को सुरक्षित रखें।
नाम अनुक्रम
rs76562819_REF_FOR GTAATGCCTTAATGAGAGAG एक GTTAGTCATCTTCTCACTTC
rs76562819_REF_REV GAAGTGAGAAGATGACTAAC टी CTCTCTCATTAAGGCATTAC
rs76562819_NONREF_FOR GTAATGCCTTAATGAGAGAG जी GTTAGTCATCTTCTCACTTC
rs76562819_NONREF_REV GAAGTGAGAAGATGACTAAC सी CTCTCTCATTAAGGCATTAC

तालिका 1: उदाहरण EMSA / DAPA oligonucleotide डिजाइन अंतर बिन के लिए एक एसएनपी परीक्षण करने के लिएडिंग। "रेफरी", संदर्भ एलील के लिए खड़ा है, जबकि "NONREF" गैर संदर्भ एलील के लिए खड़ा है। "के लिए" आगे कतरा के लिए खड़ा है, जबकि "द रेव" अपने पूरक इंगित करता है। एसएनपी लाल रंग में देखा जाता है।

  1. 10 मिमी HEPES (7.9 पीएच) के अंतिम एकाग्रता, 10 मिमी KCl, और विआयनीकृत पानी में 0.1 मिमी EDTA के साथ cytoplasmic निष्कर्षण (सीई) बफर तैयार करें।
  2. परमाणु निष्कर्षण (NE) 20 मिमी HEPES (7.9 पीएच) के अंतिम एकाग्रता, 0.4 एम NaCl, और विआयनीकृत पानी में 1 मिमी EDTA के साथ बफर तैयार करें।
  3. 10 मिमी Tris (7.5-8.0 पीएच) के अंतिम एकाग्रता, 50 मिमी NaCl, और विआयनीकृत पानी में 1 मिमी EDTA के साथ annealing बफर तैयार करें।

संवर्धित कोशिकाओं से परमाणु lysate के 2. तैयारी

नोट: इस प्रयोगात्मक प्रोटोकॉल बी lymphoblastoid सेल लाइनों का उपयोग कर अनुकूलित किया गया था, लेकिन कई अन्य असंबंधित पक्षपाती / निलंबन सेल लाइनों में परीक्षण किया गया है और सार्वभौमिक काम करता है।

  1. cultu2 मिमी एल glutamine, 10% भ्रूण गोजातीय सीरम, और 1x एंटीबायोटिक कवकनाशी पेनिसिलिन की 100 इकाइयों / एमएल, स्ट्रेप्टोमाइसिन की 100 माइक्रोग्राम / एमएल युक्त और 250 एनजी के साथ रोसवेल पार्क मेमोरियल संस्थान (RPMI) 1640 में बी-lymphoblastoid कोशिकाओं को फिर amphotericin बी की / मिलीलीटर
    1. 200,000-500,000 व्यवहार्य कोशिकाओं / एमएल के एक रेंज में बीज और निकाल या ढीले टोपी के साथ एक ईमानदार स्थिति में 5% कार्बन डाइऑक्साइड के साथ 37 डिग्री सेल्सियस पर बोतल सेते हैं।
      नोट: बी-lymphoblastoid कोशिकाओं के विकास को धीमा कर देती है, जब वे 1,000,000 कोशिकाओं / एमएल तक पहुँचने। ऊपर pipetting द्वारा और कई बार नीचे सेल विस्फोटों को तोड़ने और 200,000-500,000 कोशिकाओं / एमएल कोशिकाओं लौटने के विकास का एक तीव्र दर बनाए रखने के लिए।
  2. दो बार, 10 मिलीलीटर बर्फ ठंड फॉस्फेट बफर खारा (पीबीएस) के साथ संवर्धित कोशिकाओं को धो 5 मिनट के लिए 4 डिग्री सेल्सियस पर नीचे स्पिन, 300 XG और आकांक्षा के माध्यम से पीबीएस को हटा दें।
  3. 10 7 कोशिकाओं प्रति 1 मिलीलीटर बर्फ के रूप में एक hemocytometer और resuspend गोली का उपयोग कर ठंड पीबीएस कोशिकाओं की गणना।
    नोट: उदाहरण के लिए, यदि 2 10 x 7 lysing </ Sup> कोशिकाओं, 2 मिलीलीटर पीबीएस में resuspend।
  4. अशेष 1.5 मिलीलीटर microcentrifuge ट्यूबों के लिए 1 मिलीलीटर ताकि प्रत्येक ट्यूब पीबीएस में 10 7 सेल शामिल हैं। 2 मिनट 4 डिग्री सेल्सियस और पीबीएस बंद महाप्राण के लिए 3300 XG पर अपकेंद्रित्र।
  5. , का उपयोग सीई बफर का काम कर रहे एक शेयर को 1 मिमी dithiothreitol (डीटीटी), 1x फॉस्फेट अवरोध, और 1x protease अवरोध जोड़ने से पहले। सीई बफर के 400 μl के साथ Resuspend सेल गोली और 15 मिनट के लिए बर्फ पर सेते हैं।
  6. 10% Nonidet P-40 के 25 μl जोड़ें और pipetting द्वारा मिश्रण। 4 डिग्री सेल्सियस, 3 मिनट के लिए अधिकतम गति पर अपकेंद्रित्र। छानना और सतह पर तैरनेवाला त्यागें।
  7. , का उपयोग NE बफर का काम कर रहे एक शेयर को 1 मिमी डीटीटी, 1x फॉस्फेट अवरोध, और 1x protease अवरोध जोड़ने से पहले। NE बफर के 30 μl के साथ Resuspend सेल गोली और vortexing द्वारा मिश्रण।
  8. एक ट्यूब रोटेटर में या 10 मिनट के लिए बर्फ पर 4 डिग्री सेल्सियस पर सेते हैं। अपकेंद्रित्र 2 मिनट 4 डिग्री सेल्सियस के लिए 3300 XG।
  9. पर भंडारण से पहले स्पष्ट सतह पर तैरनेवाला (परमाणु lysate) और विभाज्य लीजिए -806, सी कई फ्रीज पिघलना चक्र है कि प्रोटीन नीचा हो सकता है से बचने के लिए। एक 10 μl विभाज्य छोड़ दो bichoninic एसिड परख (बीसीए), 31 का उपयोग प्रोटीन एकाग्रता को मापने के लिए।

3. electrophoretic गतिशीलता शिफ्ट परख (EMSA)

  1. Oligo कार्य स्टॉक और EMSA जेल तैयार करें।
    1. अगर ओलिगोस द्वैध में आदेश दिए थे, पिघलना 100 माइक्रोन के शेयर और 1 पतला: annealing बफर में 2,000 एक 50 एनएम काम कर शेयर हासिल करने के लिए।
    2. अगर ओलिगोस एकल असहाय आदेश दिए थे, 100 माइक्रोन के शेयरों पिघलना और annealing बफर 1:10 पतला 100 एनएम काम कर कंपनियों के शेयरों को प्राप्त करने के लिए। एक microcentrifuge ट्यूब में एक दूसरे के साथ 100 एनएम पूरक किनारा समाधान के 100 μl जुडा है।
      1. 5 मिनट के लिए 95 डिग्री सेल्सियस पर एक गर्मी ब्लॉक में रखें। गर्मी ब्लॉक बंद और ओलिगोस धीरे-धीरे कम से कम एक घंटे के लिए उपयोग करने से पहले कमरे के तापमान को शांत करने के लिए अनुमति देते हैं।
    3. EMSA जेल प्री-चलाते हैं।
      1. एक पूर्व डाली 6% टी से स्लाइड निकालेंजेल बीई और विआयनीकृत पानी के नीचे कुल्ला कई बार कुओं से किसी भी बफर हटा दें। विआयनीकृत पानी की 950 मिलीलीटर के लिए 10x TBE के 50 एमएल जोड़कर 0.5x TBE बफर के 1 एल तैयार करें।
      2. जेल वैद्युतकणसंचलन तंत्र को इकट्ठा करने और 0.5x TBE बफर के साथ भीतरी कक्ष भरने के द्वारा लीक के लिए जाँच करें। कोई बफर बाहरी कक्ष में लीक करते हैं, तो बाहरी कक्ष रास्ते का लगभग दो तिहाई भरें।
      3. 60 मिनट के लिए 100 वी पर जेल प्री-चलाते हैं।
      4. 0.5x TBE बफर के 200 μl के साथ अच्छी तरह से प्रत्येक फ्लश।
  2. बाध्यकारी बफर मास्टर मिश्रण तैयार करें।
    1. 100 मिमी Tris, 500 मिमी KCl, 10 मिमी डीटीटी के अंतिम एकाग्रता के साथ बाध्यकारी बफर 10x तैयार करें; विआयनीकृत पानी में 7.5 पीएच।
    2. एक microcentrifuge ट्यूब में, अभिकर्मकों सभी प्रतिक्रियाओं (; 2 टेबल 10 μl 10x बाध्यकारी बफर, 10 μl डीटीटी / polysorbate, 5 μl पाली डी (आईसी), और 2.5 μl सामन शुक्राणु डीएनए) के लिए आम से मिलकर एक मास्टर मिश्रण बनाने के लिए। एक अतिरिक्त 10% तैयारमात्रा pipetting की वजह से नुकसान के लिए खाते।
अभिकर्मक अंतिम सान्द्र। Rxn # 1 Rxn # 2 Rxn # 3 Rxn # 4
ultrapure पानी 20 μl खंड के लिए। 13.5 μl 11.98 μl 13.5μl 11.98 μl
10x बंधन बफर 1x 2 μl 2 μl 2 μl 2 μl
डीटीटी / TW-20 1x 2 μl 2 μl 2 μl 2 μl
सामन शुक्राणु डीएनए 500 एनजी / μl 0.5 μl 0.5 μl 0.5 μl 0.5 μl
1μg / μl पाली डी (आईसी) 1 माइक्रोग्राम 1 μl 1 μl 1 μl 1 μl
परमाणु निकालने (5.26 यूजी / μl) 8 माइक्रोग्राम - 1.52 μl - 1.52 μl
NE बफर 1.52 μl - 1.52 μl -
संदर्भ एलील oligo 50 fmol 1 μl 1 μl - -
गैर-संदर्भ एलील oligo 50 fmol - - 1 μl 1 μl

तालिका 2: उदाहरण EMSA प्रतिक्रिया सेतुपी। तालिका एक उदाहरण EMSA जीनोटाइप निर्भर एक विशिष्ट एसएनपी को TFS के बंधन नहीं है कि परिकल्पना का परीक्षण करने के लिए दिखाता है।

  1. प्रत्येक microcentrifuge ट्यूब nuclease मुक्त पानी जोड़ें ऐसी है कि अंतिम मात्रा निम्न सभी अभिकर्मकों के अलावा 20 μl होगा।
  2. प्रत्येक microcentrifuge ट्यूब मास्टर मिश्रण की उचित मात्रा (5.5 μl) जोड़ें।
  3. परमाणु lysate के 8 माइक्रोग्राम प्रति उचित microcentrifuge ट्यूबों में जोड़े। नकारात्मक नियंत्रण के रूप में परमाणु निकालने (जैसे 2 टेबल, Rxn # 1 और Rxn 3 #) के बिना oligo युक्त ट्यूबों को शामिल करें।
    नोट: प्रतिक्रिया प्रति lysate की अधिकतम राशि अनुमापन द्वारा प्रयोगात्मक निर्धारित किया जाना चाहिए। आम तौर पर, lysate के 2-10 ग्राम की एक सीमा titrating पर्याप्त है।
  4. oligo के 50 fmol उचित microcentrifuge ट्यूबों में जोड़े। झाड़ मिश्रण और संक्षेप में ट्यूब के नीचे करने के लिए सामग्री को स्पिन करने के लिए। कमरे के तापमान पर 20 मिनट के लिए सेते हैं।
    नोट: यदि attemptiएक supershift एनजी, कमरे के तापमान ओलिगोस के अलावा पहले से कम 20 मिनट के लिए एंटीबॉडी के साथ lysate मिश्रण सेते हैं। यह सबसे अच्छा परिणाम के लिए एक चिप ग्रेड एंटीबॉडी के 1 ग्राम का उपयोग करने की सिफारिश की है।
  5. प्रत्येक microcentrifuge ट्यूब 10x ऑरेंज लोडिंग डाई के 2 μl जोड़ें। पिपेट और नीचे मिश्रण करने के लिए।
  6. ऊपर और नीचे pipetting मिश्रण करने के लिए और फिर एक अलग कुएं में प्रत्येक नमूना खदेड़ने से पूर्व रन 6% TBE जेल में नमूने लोड। 80 वी में जेल चला जब तक नारंगी डाई जेल नीचे रास्ते से 3/4 2/3 चले गए है। यह लगभग 60-75 मिनट लेना चाहिए।
  7. यह एक जेल चाकू के साथ खुला prying द्वारा प्लास्टिक कैसेट से जेल निकालें और 0.5% TBE बफर के साथ एक कंटेनर में जेल जगह इसे बाहर सुखाने से रखने के लिए।
  8. एक अवरक्त और chemiluminescence इमेजिंग प्रणाली की सतह पर जेल की जगह, किसी भी बुलबुले या दूषित पदार्थ उस छवि को बाधित करेगा समाप्त करने के लिए सुनिश्चित किया जा रहा।
  9. स्कैनिंग सिस्टम सॉफ्टवेयर का प्रयोग, "अधिग्रहण" टैब पर क्लिक करेंऔर फिर ऐसा क्षेत्र है जहां जेल स्कैनर की सतह पर स्थित है के लिए इसी चारों ओर एक बॉक्स आकर्षित करने के लिए "ड्रा नया" का चयन करें।
  10. "अधिग्रहण" टैब के "चैनल" अनुभाग में, चैनल oligo पर fluorophore टैग की तरंग दैर्ध्य के लिए इसी का चयन करें। "स्कैनर" अनुभाग में, एक कम गुणवत्ता पूर्वावलोकन स्कैन पाने के लिए "पूर्वावलोकन" पर क्लिक करें। जेल के हिस्से को नीचे का अधिग्रहण पूर्वावलोकन छवि आसपास के नीले बॉक्स खींचकर स्कैन क्षेत्र समायोजित imaged किया जाना है।
    नोट: उदाहरण के लिए, एक 700 एनएम fluorophore के साथ लेबल ओलिगोस का उपयोग करते हुए, तो यकीन है कि "700 एनएम" चैनल स्कैनिंग से पहले चयनित है।
  11. "स्कैन नियंत्रण" अनुभाग में, "84 माइक्रोन के" संकल्प विकल्प और "मध्यम" गुणवत्ता विकल्प चुनें। जेल का आधा मोटाई के लिए ऑफसेट करने के लिए ध्यान केंद्रित करने के लिए सेट करें। नोट: उदाहरण के लिए, एक 1 मिमी जेल एक 0.5 मिमी फोकस ऑफसेट का प्रयोग करेंगे।
  12. "स्कैनर" अनुभाग में, "शुरू" पर क्लिक खस्कैन egin।
    नोट: स्कैन के दौरान, चमक, इसके विपरीत, और रंग योजना अक्सर स्कैनिंग प्रणाली के निर्माता के आधार पर मैन्युअल रूप से समायोजित किया जा सकता है।
  13. बाद स्कैन समाप्त हो गया है, "छवि" टैब का चयन करें और अभिविन्यास सही करने के लिए "बनाएँ" खंड में "बारी बारी से या फ्लिप" पर क्लिक करें। मुख्य मेनू में "निर्यात" पर क्लिक करके छवि फ़ाइल सहेजें और फिर चुनें "एकल छवि देखें।"

4. डीएनए आत्मीयता शुद्धि परख (DAPA)

  1. 5 सुक्ष्ममापी Oligo काम कर रहे शेयर की तैयारी।
    1. अगर ओलिगोस द्वैध में आदेश दिए थे, 100 माइक्रोन के शेयर पिघलना और annealing बफर में 01:20 पतला एक 5 माइक्रोन के काम कर शेयर हासिल करने के लिए।
    2. अगर ओलिगोस एकल असहाय आदेश दिए थे, 100 माइक्रोन के शेयरों पिघलना और annealing बफर 1:10 पतला 10 कार्य शेयरों सुक्ष्ममापी प्राप्त करने के लिए। 10 माइक्रोन के एक दूसरे के साथ पूरक किस्में के 10 μl जुडा है। के लिए 95 डिग्री सेल्सियस पर एक गर्मी ब्लॉक में रखें5 मिनट। गर्मी ब्लॉक बंद और ओलिगोस धीरे धीरे कमरे के तापमान का उपयोग करने से पहले शांत करने के लिए अनुमति देते हैं।
  2. शुरू करने से पहले, बाध्यकारी बफर, कम तंगी धोने बफर, उच्च तंगी धोने बफर, और क्षालन बफर कमरे के तापमान को गर्म है।
    नोट: 50 एनजी के अंतिम एकाग्रता / एमएल पाली डी (आईसी) बाध्यकारी बफर, कम तंगी धोने बफर, और उच्च तंगी धो बफर करने के लिए जोड़ा जा सकता है ओलिगोस के लिए प्रोटीन की संभावित गैर विशिष्ट बंधन को कम करने के लिए।
  3. प्रत्येक संस्करण के लिए बाध्यकारी मिश्रण तैयार करें।
    1. बाध्यकारी बफर के 2 संस्करणों के साथ परमाणु lysate के 1 मात्रा मिलाई।
      नोट: lysate के लिए आवश्यक राशि की वजह से TFS की बहुतायत अलग-अलग करने के लिए प्रयोगात्मक निर्धारित किया जाना चाहिए। स्तंभ प्रति परमाणु lysate के 100-250 ग्राम के बीच का प्रयोग ज्यादातर मामलों में पर्याप्त है।
    2. 1x फॉस्फेट अवरोध, 1x protease अवरोध, और 1x बाध्यकारी बढ़ाने (वैकल्पिक) जोड़ें और ट्यूब कई बार flicking द्वारा मिश्रण।
      नोट: 100x बाध्यकारीबढ़ाने 750 मिमी 2 MgCl और 300mm ZnCl 2 के होते हैं। बाध्यकारी बढ़ाने जोड़े यदि डीएनए के लिए TF के बंधन सहकारकों या एजेंटों को कम करने पर निर्भर करता है। इस जानकारी ज्ञात नहीं है, तो बाध्यकारी बढ़ाने जोड़ें।
    3. प्रत्येक संबंधित बाध्यकारी मिश्रण करने के लिए 5 सुक्ष्ममापी biotinylated कब्जा डीएनए (50 pmol) के 10 μl जोड़ें। कमरे के तापमान पर 20 मिनट के लिए सेते हैं।
      नोट: ऊष्मायन समय और तापमान टीएफ के आधार पर भिन्न हो सकते हैं। इष्टतम मूल्यों प्रयोगात्मक निर्धारित किए जाने की जरूरत है।
  4. streptavidin microbeads के 100 μl जोड़ें। कमरे के तापमान पर 10 मिनट के लिए सेते हैं।
  5. प्रत्येक oligo जांच परीक्षण किया जा रहा है, चुंबकीय विभाजक में एक बाध्यकारी स्तंभ जगह है। प्रत्येक बाध्यकारी कॉलम के तहत सीधे एक microcentrifuge ट्यूब रखें और स्तंभ कुल्ला करने के लिए बाध्यकारी बफर के 100 μl लागू होते हैं।
  6. अलग-अलग कॉलम में प्रत्येक बाध्यकारी मिश्रण की सामग्री को पिपेट और तरल microcentrifuge में कॉलम के माध्यम से पूरी तरह से प्रवाह करने की अनुमतिआगे बढ़ने से पहले ट्यूब। संस्करण oligo कि बाध्यकारी मिश्रण में इस्तेमाल किया गया था के साथ कॉलम लेबल करने के लिए सुनिश्चित करें। प्रवाह के माध्यम से नमूने लेबल और कम तंगी washes इकट्ठा करने के लिए नया microcentrifuge ट्यूब के साथ की जगह।
  7. स्तंभ के लिए कम तंगी धोने बफर के 100 μl लागू करें; रुको जब तक स्तंभ जलाशय खाली है। धोने 4x दोहराएँ। कम तंगी धोने के नमूने लेबल और उच्च तंगी washes इकट्ठा करने के लिए नया microcentrifuge ट्यूब के साथ की जगह।
  8. स्तंभ के लिए उच्च तंगी धोने बफर के 100 μl लागू करें; रुको जब तक स्तंभ जलाशय खाली है। धोने 4x दोहराएँ। उच्च तंगी धोने के नमूने लेबल और पूर्व क्षालन इकट्ठा करने के लिए नया microcentrifuge ट्यूब के साथ की जगह।
  9. स्तंभ के मूल निवासी क्षालन बफर के 30 μl जोड़ें और 5 मिनट के लिए खड़े हो जाओ। पूर्व क्षालन नमूने लेबल और क्षालन इकट्ठा करने के लिए नया microcentrifuge ट्यूब के साथ की जगह।
    नोट: इस बाध्य प्रोटीन elute नहीं करता है; यह शेष उच्च तंगी washesस्तंभ के बाहर बफर और क्षालन बफर के साथ यह जगह क्षालन की क्षमता को अधिकतम करने के लिए।
  10. बाध्य TFS elute करने के लिए एक अतिरिक्त 50 μl मूल निवासी क्षालन बफर जोड़ें। एक उच्च उपज लेकिन कम केंद्रित eluate के लिए, देशी क्षालन बफर के एक अतिरिक्त 50 μl जोड़ें और प्रवाह के माध्यम से इकट्ठा।
    नोट: मास स्पेक्ट्रोमेट्री के माध्यम से क्षालन नमूनों का विश्लेषण बाध्य TFS 32 की पहचान निर्धारित करने के लिए। बाद में, सोडियम dodecyl sulfite जेल वैद्युतकणसंचलन (एसडीएस पृष्ठ) के माध्यम से प्रोटिओमिक परिणाम एक पश्चिमी धब्बा 33 के द्वारा पीछा सत्यापित करें। अगर मास स्पेक्ट्रोमेट्री उपलब्ध नहीं है, एक पश्चिमी धब्बा के बजाय मानक तकनीक का उपयोग प्रोटीन (एस) जीनोटाइप निर्भर बाध्यकारी दिखाने का आकार निर्धारित करने के लिए एक चांदी दाग ​​चलाते हैं। शुरूआत में विस्तृत कम्प्यूटेशनल दृष्टिकोण से भविष्यवाणी की TFS की सूची को कम करने के लिए इस जानकारी का उपयोग करें।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

इस खंड में, क्या उम्मीद करने के प्रतिनिधि परिणाम जब एक EMSA या DAPA, और परिवर्तनशीलता के lysate की गुणवत्ता होती है संबंध के साथ प्रदर्शन प्रदान की जाती हैं। उदाहरण के लिए, यह सुझाव दिया गया है कि ठंड और विगलन प्रोटीन के नमूने कई बार विकृतीकरण में हो सकता है। इन "फ्रीज पिघलना" चक्र के संदर्भ में EMSA विश्लेषण के reproducibility पता लगाने के क्रम में, दो 35 बीपी एक आनुवंशिक संस्करण पर भिन्न ओलिगोस परमाणु lysate के एक ही बैच कि thawed और फिर से जम गया था संकेत दिया राशि के लिए साथ incubated रहे थे । बार का आंकड़ा दर्शाता है कि 2 से 5 गुना तक ठंड और विगलन इस विशेष बी लिम्फोसाइट परमाणु निकालने प्रोटीन की अखंडता पर मालूम होता है कोई प्रभाव नहीं है; हालांकि, परमाणु प्रोटीन की स्थिरता के नमूने से भिन्न होता है और इस तरह इस्तेमाल प्रत्येक व्यक्ति के सेल लाइन पर परीक्षण किया जाना चाहिए। यह भी अलग अलग बैच prepar से भिन्नता है संभव हैपरमाणु lysates के ations। इस बदलाव सेल चक्र सेल, सेल बीतने संख्या, या अन्य कारकों के लिए पहले चरण की वजह से है या नहीं, यह वास्तविक परिणाम सुनिश्चित करने के लिए lysate के विभिन्न बैचों का उपयोग कर EMSA परिणामों को दोहराने के लिए महत्वपूर्ण है।

इसके अतिरिक्त, यह EMSA के लिए संकेत करने वाली शोर अनुपात अनुकूलन करने के लिए महत्वपूर्ण है। इस में एक महत्वपूर्ण चर oligo एकाग्रता है। Oligo (5-300 fmol) की मात्रा का आकलन करने के लिए कैसे ओलिगोस के विभिन्न मात्रा के संकेत (चित्रा 3) को प्रभावित titrated किया गया था। अप oligo के 100 fmol को बैंड की तीव्रता में वृद्धि मनाया गया। इस बिंदु के बाद, संकेत पठारों 100 fmol सुझाव इस EMSA प्रतिक्रिया के लिए इष्टतम oligo राशि है।

अन्त में, हमारे प्रकाशित रणनीति इस पांडुलिपि में वर्णित के हिस्से का उपयोग करते हुए अध्ययनों में से एक से एक प्रतिनिधि आंकड़ा (चित्रा 4) प्रदान की जाती है। वें मेंअध्ययन 34 है, हम पता चला कि STAT1, एक प्रतिलेखन कारक है कि दोनों synergistic सक्रियण और जीन अभिव्यक्ति टाइप 1 IFN रिसेप्टर परिसर 35 के बहाव के निषेध में भाग लेता है के बंधन rs6590330 बढ़ जाती है की एक प्रकार का वृक्ष जुड़े जोखिम एलील। इस उदाहरण में, STAT1 पहली उच्च प्रदर्शन तरल क्रोमैटोग्राफी मिलकर जन स्पेक्ट्रोस्कोपी (DAPA एमएस) के लिए युग्मित का उपयोग कर प्रोटिओमिक विश्लेषण के बाद DAPA द्वारा की पहचान की थी। एक DAPA-पश्चिमी धब्बा टीएफ प्रोटिओमिक विश्लेषण (STAT1) से पहचान की पुष्टि करें और पुष्टि करते हैं कि STAT1 की फॉस्फोरिलेटेड प्रपत्र गैर संदर्भ (एक प्रकार का वृक्ष जोखिम) oligo के लिए बाध्य किया गया था करने के लिए इस्तेमाल किया गया था। यह आंकड़ा दिखाता है कि कैसे इस रणनीति में विभिन्न assays के एक गैर-कोडिंग संस्करण के लिए अंतर प्रतिलेखन कारक के बंधन की पहचान करने के लिए इस्तेमाल किया जा सकता है।

चित्र 2
चित्रा 2: reproducibility के विश्लेषणऔर EMSA परिणामों पर फ्रीज पिघलना चक्र का परिणाम हैं। ओलिगोस संदर्भ (आर) या एक आनुवंशिक संस्करण के गैर संदर्भ (एनआर) एलील युक्त ठंड और विगलन के कई चक्र के बाद lysate के एक ही तैयारी की जांच के लिए इस्तेमाल किया गया। (लिस: lysate)। प्रत्येक लेन जेल (नीले तीर) के तल पर मुफ्त जांच में शामिल है। oligo को TFS के बंधन जेल (लाल तीर) के शीर्ष छमाही में एक बैंड के रूप में देखा जा सकता है। जेल (ब्रैकेट देखें) के नीचे आधा भीतर निहित बैंड गैर विशिष्ट हैं। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र तीन
चित्रा 3:। अलग oligo सांद्रता के प्रभाव का आकलन ओलिगोस के विभिन्न सांद्रता परमाणु lysate के एक भी तैयारी की जांच के लिए इस्तेमाल किया गया। एफluorescent संकेत यह दर्शाता है कि oligo सीमित अभिकर्मक है, मात्रा में वृद्धि oligo के साथ बढ़ जाती है। 100-300 fmol गलियों, जहां प्रोटीन की मात्रा सीमित अभिकर्मक हो जाता है पर संकेत पठारों। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 4
चित्रा 4:। Rs6590330 का एक प्रकार का वृक्ष जोखिम एलील STAT1, बंधन के रूप में DAPA एमएस STAT1 और उच्च गैर-जोखिम एलील की तुलना में जोखिम rs6590330 एलील युक्त ओलिगोस के लिए बाध्य pSTAT1 प्रदर्शनी द्वारा मूल्यांकन बढ़ जाती है। बायोटिन लेबल ओलिगोस एपस्टीन बर्र वायरस तब्दील बी सेल परमाणु निकालने के साथ incubated रहे थे। oligo करने के लिए बाध्य प्रोटीन DAPA का उपयोग कर कब्जा कर लिया गया। प्रोटीन तो एसडीएस जेल वैद्युतकणसंचलन से अलग कर दिया और पाया गया विरोधी pSTAT1 का उपयोग कर(ए) या ​​विरोधी STAT1 (बी)। एम: मार्कर। NR: oligo rs6590330 की गैर-जोखिम एलील युक्त; आर: oligo rs6590330 का खतरा एलील युक्त; उत्परिवर्ती: oligo एक बाधित ख्यात STAT1 साइट rs6590330 के बहाव बाध्यकारी युक्त; सेल lysate: बी कोशिकाओं से परमाणु निकालने। बैंड के रिश्तेदार तीव्रता प्रत्येक बैंड नीचे संकेत कर रहे हैं। परिणाम चार प्रयोगों के प्रतिनिधि हैं; जबकि सभी प्रयोगों जोखिम एलील के साथ जांच के लिए बाध्य STAT1 वृद्धि हुई प्रदर्शन किया, 2/4 प्रयोगों कोई STAT1 में या pSTAT1, गैर जोखिम oligo से immunoprecipitate में पाया गया था, जबकि दोनों जोखिम oligo से immunoprecipitate में पाया गया। यह आंकड़ा संदर्भ 34 से संशोधित किया गया है। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

हालांकि अनुक्रमण और जीनोटाइपिंग प्रौद्योगिकियों के क्षेत्र में प्रगति बहुत हमारी क्षमता रोग के साथ जुड़े आनुवंशिक वेरिएंट की पहचान करने के लिए बढ़ाया है, हमारे इन वेरिएंट से प्रभावित कार्यात्मक तंत्र को समझने की क्षमता चल रहा है। समस्या का एक प्रमुख स्रोत है कि कई रोग से जुड़े वेरिएंट एन में स्थित हैं पर कोडिंग जीनोम के क्षेत्रों, संभावना जीन अभिव्यक्ति को नियंत्रित करने के लिए कठिन करने वाली भविष्यवाणी तंत्र को प्रभावित जो है। यहाँ, हम EMSA और DAPA तकनीक, जीनोटाइप निर्भर टीएफ बाध्यकारी घटनाओं की संभावना है कि कई गैर-कोडिंग वेरिएंट के समारोह के लिए योगदान की पहचान के लिए बहुमूल्य आणविक उपकरणों पर आधारित एक प्रोटोकॉल उपस्थित थे। हालांकि इन दो तकनीकों अतीत में बड़े पैमाने पर इस्तेमाल किया गया है, वे हाल ही में बाध्यकारी टीएफ के आनुवंशिक संस्करण के विश्लेषण के लिए अनुकूलित किया गया है। परे TFS, EMSA भी प्रोटोकॉल से 36 केवल मामूली समायोजन के साथ शाही सेना बाध्यकारी प्रोटीन पर आनुवंशिक वेरिएंट के प्रभाव का विश्लेषण करने के लिए इस्तेमाल किया जा सकता है।

। Ove_content "> इस के साथ साथ प्रस्तुत प्रोटोकॉल प्रदर्शन करने के लिए सरल और आसान है, फिर भी, कुछ भागों से पहले प्रयोग के प्रथम अतिरिक्त विचार की आवश्यकता होती है, यह कठोर सांख्यिकीय विश्लेषण प्रदर्शन से विचार के लिए वेरिएंट की एक प्रारंभिक सूची उत्पन्न करने के लिए महत्वपूर्ण है इस चरण में एक त्रुटि। सभी बहाव के विश्लेषण के पटरी से उतर सकते हैं, कई वेरिएंट परमाणु lysate विभिन्न बाँध रोग के जोखिम के लिए योगदान के बिना हो सकता है। इसके अतिरिक्त, उचित प्रकार की कोशिकाओं में प्रदर्शन कार्यात्मक जीनोमिक्स डेटा के उपयोग के लिए महत्वपूर्ण है, के रूप में अप्रासंगिक प्रकार की कोशिकाओं बाध्यकारी झूठी सकारात्मक टीएफ की पीढ़ी के लिए नेतृत्व कर सकते हैं भविष्यवाणियों। वर्तमान में, सबसे व्यापक रूप से इस्तेमाल किया कार्यात्मक जीनोमिक संसाधनों सांकेतिक शब्दों में बदलना 12 और रोडमैप Epigenomics 17 में शामिल हैं। अतिरिक्त जानकारी सेल-प्रकार में जीन अभिव्यक्ति के स्तर ब्याज की एक बीमारी के लिए प्रासंगिक के बारे में, इस तरह के ImmGen 37, BioGPS 38 के रूप में अन्य संसाधनों से प्राप्त किया जा सकता है 39, और 20 SNPsea। उदाहरण के लिए, इस तरह के संसाधनसीईएस केवल उन TFS कि प्रासंगिक प्रकार की कोशिकाओं में व्यक्त कर रहे हैं शामिल करने के लिए TF बाध्यकारी भविष्यवाणियों फिल्टर करने के लिए इस्तेमाल किया जा सकता है।

यह भी ऐसी EMSA और DAPA के रूप में इन विट्रो प्रयोगों के निरंतर विचार करने के लिए महत्वपूर्ण है। विशेष रूप से, यह अलग परमाणु lysate तैयारी के साथ प्रयोगों को दोहराने के लिए झूठी नकारात्मक कम करने के लिए आवश्यक है। इसके अलावा, एक सफल EMSA-supershift EMSA बैंड में एक और पारी, जिसमें एंटीबॉडी टीएफ को बांधता है, या बैंड का एक नुकसान है, जिसमें एंटीबॉडी ब्लॉकों टीएफ के डीएनए बाध्यकारी डोमेन के रूप में पेश कर सकते हैं। एक निर्धारण नियंत्रण एंटीबॉडी और / या एक अलग टीएफ की दिशा में एक एंटीबॉडी सहित या तो परिदृश्य में, supershift की विशिष्टता की पुष्टि करने में उपयोगी है। एक supershift प्रदर्शन में एक और विचार है कि क्या डीटीटी / प्रतिक्रिया में polysorbate शामिल करने के लिए है। डीटीटी / polysorbate लोडिंग डाई अनबाउंड डीएनए का ज्यादा सटीक मात्रा का ठहराव के लिए अनुमति स्थिर; हालांकि, यह भी कम कर सकते हैं एंटीबॉडी के डाइसल्फ़ाइड लिंकेज परिणामEMSA-supershift की विफलता में हैैं। इसके साथ और डीटीटी / polysorbate बिना जब एक जटिल supershift करने के प्रयास में प्रतिक्रियाओं की कोशिश करने के लिए सिफारिश की है। पाली डी (आईसी) और प्रतिक्रिया प्रति सामन शुक्राणु डीएनए के अधिकतम राशि अनुमापन द्वारा प्रयोगात्मक निर्धारित किया जाना चाहिए। आम तौर पर, 1-6 माइक्रोग्राम प्रति पाली डी (आईसी) और 50-500 एनजी सामन शुक्राणु एक सीमा titrating पर्याप्त है। DAPA के लिए एक उपयोगी सकारात्मक नियंत्रण एक अच्छी तरह से होती बाध्यकारी मूल भाव (जैसे सीआईएस-बीपी 23 या 40 Factorbook के रूप में डेटाबेस से प्राप्त) के साथ एक TF के लिए एक आम सहमति अनुक्रम का उपयोग और एक एंटीबॉडी कि टीएफ के लिए विशिष्ट साथ एक पश्चिमी चल शामिल है। दोनों assays के लिए, एक तले oligo दिखाने के लिए कि किसी भी बाध्यकारी मनाया ब्याज की ओलिगोस के लिए विशिष्ट है इस्तेमाल किया जा सकता है।

दोनों EMSA और DAPA तकनीक प्रयोगात्मक सीमाएं हैं। उदाहरण के लिए, एक टीएफ और डीएनए के बीच बंधन आत्मीयता बफर की स्थिति से बड़े हिस्से में प्रभावित है। आदर्श रूप में, बफर की स्थिति अंतर्जात conditio की नकल करना चाहिएनाभिक के एनएस इष्टतम बाइंडिंग के लिए अनुमति देने के लिए। EMSA के लिए, अनुचित बफर की स्थिति एक कमजोर बैंड या पूरी तरह से एक बैंड का नुकसान हो सकता है। DAPA के लिए, गैर आदर्श स्थितियों टीएफ (s) धोने चरणों के दौरान eluted जा करने के लिए कारण हो सकता है। इसलिए, प्रत्येक परख TF-oligo कुछ बफर की शर्तों के तहत बाध्यकारी की पहचान करने में ही प्रभावी है। सबसे सार्वभौमिक उपयोगी बफर की स्थिति से ऊपर प्रोटोकॉल में प्रस्तुत कर रहे हैं। एक दूसरी सीमा है कि EMSA और DAPA तरीकों से प्रयोगात्मक परिणामों के माध्यम से जो ओलिगोस को TFS बाँध तंत्र के बारे में कम जानकारी प्रदान करना है। TFS ओलिगोस को सीधे बाध्य कर सके या अन्य कारकों द्वारा भर्ती किया। तदनुसार, यह भविष्यवाणी करने के लिए कैसे TFS ओलिगोस करने के लिए बाध्य और प्रयोगात्मक इन भविष्यवाणियों को सत्यापित कर सकते हैं computationally oligo दृश्यों का विश्लेषण करने के लिए महत्वपूर्ण है। उदाहरण के लिए, एक विशिष्ट बंधन अनुक्रम उत्परिवर्तित जा सकता है या एक बाध्यकारी साथी प्रयोगात्मक समाप्त किया जा सकता। अंत में, इस्तेमाल किया निकालने की राशि प्रत्येक प्रयोग टी के लिए titrated करने की जरूरत हैओ इष्टतम परिणाम प्राप्त। बहुत ज्यादा lysate TF-oligo बाध्यकारी तर और किसी भी अंतर जोखिम और गैर-जोखिम alleles के बीच बाध्यकारी अस्पष्ट हो सकती है। अतिरिक्त समस्या निवारण के लिए, पाठक कई उत्कृष्ट समीक्षा और विधि पांडुलिपियों 30,41,42 उल्लेख कर सकते हैं।

यहाँ वर्णित assays के अलावा, वहाँ इन विवो assays के आगे जीवित कोशिकाओं (चित्रा 1, नीचे) के भीतर वेरिएंट की भूमिका का अध्ययन करने के लिए उपलब्ध की एक किस्म है। यदि अंतर इन विट्रो assays कोशिकाओं 34 रह में दोहराया है के भीतर मनाया बंधन chromatin immunoprecipitation एलील विशिष्ट मात्रात्मक पोलीमर्स श्रृंखला प्रतिक्रियाओं के द्वारा पीछा (चिप qPCR) के अध्ययन किया जा सकता है की पहचान। उदाहरण के लिए, ब्याज की एक संस्करण के लिए विषमयुग्मजी कोशिकाओं का इस्तेमाल कर रहे हैं, qPCR प्रयोगों टीएफ immunoprecipitated क्रोमेटिन में दो alleles के बीच संवर्धन में अंतर का पता लगाने कर सकते हैं। चिप विशिष्ट चिप ग्रेड एंटीबॉडी की आवश्यकता है, Howeveआर, अगर चिप ग्रेड टीएफ एंटीबॉडी उपलब्ध नहीं हैं, एक झंडा टैग टीएफ के साथ कोशिकाओं transfecting एक कारगर विकल्प 43 है। इसके अतिरिक्त, अंतर लक्ष्य जीन अभिव्यक्ति पर बाध्यकारी के प्रभाव genotyped कोशिकाओं या सार्वजनिक रूप से उपलब्ध संसाधनों का इस तरह Genevar 44 से संकलित उन लोगों के रूप से स्थानीय स्तर पर एकत्र अभिव्यक्ति डेटा का उपयोग कर के माध्यम से अभिव्यक्ति मात्रात्मक विशेषता लोकी (eQTL) प्रासंगिक प्रकार की कोशिकाओं में विश्लेषण की जांच की जा सकती है। Luciferase संवाददाता assays भी डिग्री है जो प्रोटीन के बंधन जीन अभिव्यक्ति को प्रभावित करता है अंतर का पता लगाने के लिए इस्तेमाल किया जा सकता है। ऐसे assays कि क्या वेरिएंट एक प्रमोटर, बढ़ाने, या repressor क्षेत्र 45-47 में स्थित हैं की परवाह किए बिना काम करने के लिए संशोधित किया जा सकता है। अंत में, इस तरह के CRISPR / Cas9 48 के रूप में जीनोम संपादन प्रौद्योगिकियों, सेल लाइनों है कि एक ही संस्करण है, जो करणीय की पुष्टि के लिए महत्वपूर्ण है पर केवल अलग उत्पन्न करने के लिए इस्तेमाल किया जा सकता है। इस तरह की तकनीकों को काफी हद तक प्रयोगात्मक विचरण betw मनाया कम कर सकते हैंeen सेल लाइनों, आनुवंशिक रूप से विविध विषयों से निकाली गई कार्यात्मक readouts विश्लेषण जीन अभिव्यक्ति से या किसी अन्य बीमारी के मध्यवर्ती phenotype के बाद से संपादित सेल लाइन पर किया जा सकता है, और गैर संपादित सेल लाइनों की तुलना में।

प्रस्तुत रणनीति का मुख्य लाभ यह है कि यह जीनोटाइप निर्भर टीएफ बाध्यकारी के आसान और तेजी से पता लगाने के लिए सक्षम बनाता है। कुंजी आनुवंशिक वेरिएंट को प्राथमिकता करके, आगे के प्रयोगों उनके जैविक प्रभाव की पहचान करने और उनकी करणीय का प्रदर्शन करने के लिए तैयार किया जा सकता है। विशेष रूप से, इस प्रोटोकॉल के किसी भी बीमारी या phenotype जुड़े संस्करण GWAS या ठीक-मानचित्रण से पहचान की जांच करने के लिए लागू किया जा सकता है। एक बड़े, आनुवंशिक डेटा और सांख्यिकीय जुड़े आनुवंशिक वेरिएंट की सूचियों की बढ़ती निधि पहले से ही उपलब्ध है। ज्यादातर मामलों में, जैविक इन वेरिएंट के सांख्यिकीय एसोसिएशन ड्राइविंग तंत्र स्पष्ट नहीं है। रणनीति इस प्रस्ताव में उल्लिखित कई गैर-कोडिंग disea की सटीक कार्यात्मक व्याख्या के लिए अनुमति देता हैएसई जुड़े वेरिएंट। इस तरह के ज्ञान किसी भी आनुवंशिक रोग आधारित ड्राइविंग आणविक तंत्र की पूरी व्याख्या के लिए महत्वपूर्ण है।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों के पास खुलासे के लिए कुछ भी नहीं है।

Materials

Name Company Catalog Number Comments
Custom DNA Oligonucleotides Integrated DNA Technologies http://www.idtdna.com/site/order/oligoentry
Potassium Chloride Fisher Scientific BP366-500 KCl, for CE buffer
HEPES (1 M) Fisher Scientific 15630-080 For CE and NE buffer
EDTA (0.5M), pH 8.0 Life Technologies R1021 For CE, NE, and annealing buffer
Sodium Chloride Fisher Scientific BP358-1 NaCl, for NE buffer
Tris-HCl (1M), pH 8.0 Invitrogen BP1756-100 For annealing buffer
Phosphate Buffered Saline (1x) Fisher Scientific MT21040CM PBS, for cell wash
DL-Dithiothreitol solution (1 M) Sigma 646563 Reducing agent
Protease Inhibitor Cocktail Thermo Scientific 87786 Prevents catabolism of TFs
Phosphatase Inhibitor Cocktail  Thermo Scientific 78420 Prevents dephosphorylation of TFs
Nonidet P-40 Substitute IBI Scientific IB01140 NP-40, for nuclear extraction
BCA Protein Assay Kit Thermo Scientific 23225 For measuring protein concentration
Odyssey EMSA Buffer Kit Licor 829-07910 Contains all necessary EMSA buffers
TBE Gels, 6%, 12 Wells Invitrogen EC6265BOX For EMSA
TBE Buffer (10x) Thermo Scientific B52 For EMSA
FactorFinder Starting Kit Miltenyi Biotec 130-092-318 Contains all necessary DAPA buffers
Licor Odyssey CLx Licor Recommended scanner for DAPA/EMSA
Antibiotic-Antimycotic Gibco 15240-062 Contains 10,000 units/ml of penicillin, 10,000 µg/ml of streptomycin, and 25 µg/ml of Fungizone® Antimycotic
Fetal Bovine Serum Gibco 26140-079 FBS, for culture media
RPMI 1640 Medium Gibco 22400-071 Contains L-glutamine and 25 mM HEPES

DOWNLOAD MATERIALS LIST

References

  1. Hindorff, L. A., et al. Potential etiologic and functional implications of genome-wide association loci for human diseases and traits. Proc Natl Acad Sci U S A. 106, (23), 9362-9367 (2009).
  2. Maurano, M. T., et al. Systematic localization of common disease-associated variation in regulatory DNA. Science. 337, (6099), 1190-1195 (2012).
  3. Ward, L. D., Kellis, M. Interpreting noncoding genetic variation in complex traits and human disease. Nat Biotechnol. 30, (11), 1095-1106 (2012).
  4. Paul, D. S., Soranzo, N., Beck, S. Functional interpretation of non-coding sequence variation: concepts and challenges. Bioessays. 36, (2), 191-199 (2014).
  5. Zhang, F., Lupski, J. R. Non-coding genetic variants in human disease. Hum Mol Genet. (2015).
  6. Lee, T. I., Young, R. A. Transcriptional regulation and its misregulation in disease. Cell. 152, (6), 1237-1251 (2013).
  7. Slatkin, M. Linkage disequilibrium--understanding the evolutionary past and mapping the medical future. Nat Rev Genet. 9, (6), 477-485 (2008).
  8. Bush, W. S., Moore, J. H. Chapter 11: Genome-wide association studies. PLoS Comput Biol. 8, (12), e1002822 (2012).
  9. 1000 Genomes Project Consortium. An integrated map of genetic variation from 1,092 human genomes. Nature. 491, (7422), 56-65 (2012).
  10. Chang, C. C., et al. Second-generation PLINK: rising to the challenge of larger and richer datasets. Gigascience. 4, 7 (2015).
  11. Purcell, S., et al. PLINK: a tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet. 81, (3), 559-575 (2007).
  12. ENCODE Project Consortium. An integrated encyclopedia of DNA elements in the human genome. Nature. 489, (7414), 57-74 (2012).
  13. Crawford, G. E., et al. Genome-wide mapping of DNase hypersensitive sites using massively parallel signature sequencing (MPSS). Genome Res. 16, (1), 123-131 (2006).
  14. Buenrostro, J. D., Giresi, P. G., Zaba, L. C., Chang, H. Y., Greenleaf, W. J. Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nat Methods. 10, (12), 1213-1218 (2013).
  15. Giresi, P. G., Kim, J., McDaniell, R. M., Iyer, V. R., Lieb, J. D. FAIRE Formaldehyde-Assisted Isolation of Regulatory Elements) isolates active regulatory elements from human chromatin. Genome Res. 17, (6), 877-885 (2007).
  16. Kent, W. J., et al. The human genome browser at UCSC. Genome Res. 12, (6), 996-1006 (2002).
  17. Roadmap Epigenomics Consortium. Integrative analysis of 111 reference human epigenomes. Nature. 518, (7539), 317-330 (2015).
  18. Martens, J. H., Stunnenberg, H. G. BLUEPRINT: mapping human blood cell epigenomes. Haematologica. 98, (10), 1487-1489 (2013).
  19. Liu, T., et al. Cistrome: an integrative platform for transcriptional regulation studies. Genome Biol. 12, (8), R83 (2011).
  20. Griffon, A., et al. Integrative analysis of public ChIP-seq experiments reveals a complex multi-cell regulatory landscape. Nucleic Acids Res. 43, (4), e27 (2015).
  21. Staudt, L. M., et al. A lymphoid-specific protein binding to the octamer motif of immunoglobulin genes. Nature. 323, (6089), 640-643 (1986).
  22. Singh, H., Sen, R., Baltimore, D., Sharp, P. A. A nuclear factor that binds to a conserved sequence motif in transcriptional control elements of immunoglobulin genes. Nature. 319, (6049), 154-158 (1986).
  23. Weirauch, M. T., et al. Determination and inference of eukaryotic transcription factor sequence specificity. Cell. 158, (6), 1431-1443 (2014).
  24. Ward, L. D., Kellis, M. HaploReg: a resource for exploring chromatin states, conservation, and regulatory motif alterations within sets of genetically linked variants. Nucleic Acids Res. 40, (Database issue), D930-D934 (2012).
  25. Boyle, A. P., et al. Annotation of functional variation in personal genomes using RegulomeDB. Genome Res. 22, (9), 1790-1797 (2012).
  26. Hume, M. A., Barrera, L. A., Gisselbrecht, S. S., Bulyk, M. L. UniPROBE, update 2015: new tools and content for the online database of protein-binding microarray data on protein-DNA interactions. Nucleic Acids Res. 43, (Database issue), D117-D122 (2015).
  27. Mathelier, A., et al. JASPAR 2014: an extensively expanded and updated open-access database of transcription factor binding profiles. Nucleic Acids Res. 42, (Database issue), 142-147 (2014).
  28. Smith, M. F. Jr, Delbary-Gossart, S. Electrophoretic Mobility Shift Assay (EMSA). Methods Mol Med. 50, 249-257 (2001).
  29. Franza, B. R., Josephs, S. F., Gilman, M. Z., Ryan, W., Clarkson, B. Characterization of cellular proteins recognizing the HIV enhancer using a microscale DNA-affinity precipitation assay. Nature. 330, (6146), 391-395 (1987).
  30. LI-COR. Odyssey Infrared EMSA Kit: Instruction Manual. Available from: http://www.licor.com/bio/pack_inserts/?pi=829-07910 (2014).
  31. Thermo Fisher Scientific, Inc. BCA Protein Assay Kit: User Guide. Available from: https://tools.thermofisher.com/content/sfs/manuals/MAN0011430_Pierce_BCA_Protein_Asy_UG.pdf (2014).
  32. Wijeratne, A. B., et al. Phosphopeptide separation using radially aligned titania nanotubes on titanium wire. ACS Appl Mater Interfaces. 7, (21), 11155-11164 (2015).
  33. Silva, J. M., McMahon, M. The Fastest Western in Town: A Contemporary Twist on the Classic Western Blot Analysis. J. Vis. Exp. (84), (2014).
  34. Lu, X., et al. Lupus Risk Variant Increases pSTAT1 Binding and Decreases ETS1 Expression. Am J Hum Genet. 96, (5), 731-739 (2015).
  35. Ramana, C. V., Chatterjee-Kishore, M., Nguyen, H., Stark, G. R. Complex roles of Stat1 in regulating gene expression. Oncogene. 19, (21), 2619-2627 (2000).
  36. Fillebeen, C., Wilkinson, N., Pantopoulos, K. Electrophoretic Mobility Shift Assay (EMSA) for the Study of RNA-Protein Interactions: The IRE/IRP Example. J. Vis. Exp. (94), e52230 (2014).
  37. Heng, T. S., Painter, M. W. Immunological Genome Project, C. The Immunological Genome Project: networks of gene expression in immune cells. Nat Immunol. 9, (10), 1091-1094 (2008).
  38. Wu, C., et al. BioGPS: an extensible and customizable portal for querying and organizing gene annotation resources. Genome Biol. 10, (11), R130 (2009).
  39. Wu, C., Macleod, I., Su, A. I. BioGPS and MyGene.info: organizing online, gene-centric information. Nucleic Acids Res. 41, (Database issue), D561-D565 (2013).
  40. Wang, J., et al. Sequence features and chromatin structure around the genomic regions bound by 119 human transcription factors. Genome Res. 22, (9), 1798-1812 (2012).
  41. Holden, N. S., Tacon, C. E. Principles and problems of the electrophoretic mobility shift assay. J Pharmacol Toxicol Methods. 63, (1), 7-14 (2011).
  42. Miltenyi Biotec, Inc. µMACS FactorFinder Kit: Data sheet. Available from: http://www.miltenyibiotec.com/en/products-and-services/macsmolecular/protein-research/biotinylated-molecule-isolation/macs-factorfinder-kit.aspx (2014).
  43. Xu, J., Liu, H., Park, J. S., Lan, Y., Jiang, R. Osr1 acts downstream of and interacts synergistically with Six2 to maintain nephron progenitor cells during kidney organogenesis. Development. 141, (7), 1442-1452 (2014).
  44. Yang, T. -P., et al. Genevar: a database and Java application for the analysis and visualization of SNP-gene associations in eQTL studies. Bioinformatics. 26, (19), 2474-2476 (2010).
  45. Fort, A., et al. A liver enhancer in the fibrinogen gene cluster. Blood. 117, (1), 276-282 (2011).
  46. Solberg, N., Krauss, S. Luciferase assay to study the activity of a cloned promoter DNA fragment. Methods Mol Biol. 977, 65-78 (2013).
  47. Rahman, M., et al. A repressor element in the 5'-untranslated region of human Pax5 exon 1A. Gene. 263, (1-2), 59-66 (2001).
  48. Mali, P., et al. RNA-Guided Human Genome Engineering via Cas9. Science. 339, (6121), 823-826 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics