전기 영동 이동성 분석 (EMSA) 및 Shift 키를 사용하여 기능 비 코딩 유전자 변형에 대한 심사 DNA 화성 강수 분석 (DAPA)

* These authors contributed equally
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Miller, D. E., Patel, Z. H., Lu, X., Lynch, A. T., Weirauch, M. T., Kottyan, L. C. Screening for Functional Non-coding Genetic Variants Using Electrophoretic Mobility Shift Assay (EMSA) and DNA-affinity Precipitation Assay (DAPA). J. Vis. Exp. (114), e54093, doi:10.3791/54093 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

시퀀싱 및 게놈 넓은 협회 연구 (GWAS), 후보의 궤적 연구를 포함하여 유전자형을 기반으로 연구, 그리고 깊은 시퀀싱 연구는 통계적으로 질병, 특성, 또는 표현형과 관련된 많은 유전자 변형을 확인했다. 초기 예측과는 반대로, 이러한 변형 (85-93%)의 대부분은 비 - 코딩 영역에 위치하는 단백질 1,2의 아미노산 서열을 변경하지 않는다. 이들 비 - 코딩 변이체의 기능을 해석하고 관련된 질환에 접속 생물학적 메커니즘을 결정하는 단계, 특성, 또는 표현형 3-6 도전 입증되었다. 유전자 발현 - 우리는 중요한 중간 표현형 변이를 연결하는 분자 메커니즘을 식별하기위한 일반적인 전략을 개발했다. 이 파이프 라인은 특히 유전 적 변이에 의해 결합 TF의 변조를 식별 할 수 있도록 설계되었습니다. 이 전략은 예측하기위한 계산 방법과 분자 생물학 기술을 결합생물학적 인 실리코 후보 변종의 효과 및 확인이 예측 경험적으로 (그림 1).

그림 1
그림 1 :.. 회색 음영이 원고와 관련된 상세한 프로토콜에 포함되지 않은 비 코딩 유전자 변형 단계의 분석을위한 전략적 접근 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

많은 경우, 각각 통계 학적으로 관련된 변이체 높은 링크 - 불평형 (LD)의 모든 것을 포함하는 변이체의 목록을 확대함으로써 시작하는 것이 중요하다. LD는 R 7이 통계에 의해 측정 될 수있는 두 개의 다른 대립 유전자의 염색체 위치에서의 비 - 무작위 교제의 척도이다. R 2는 린의 측정두 가지 변종 사이의 R 2 = 1 나타내는 완벽한 결합으로 두 가지 변형 사이의 케이지는 불균형. 높은 LD의 대립 유전자는 조상의 인구에서 염색체에 공동으로 분리하는 찾을 수 있습니다. 현재 유전자형 배열은 인간 게놈의 모든 알려진 변종을 포함하지 않는다. 대신, 그들은 인간 게놈 내에서 LD을 악용 LD (8)의 특정 지역 내에서 다른 변형에 대한 프록시 역할 알려진 변종의 서브 세트를 포함한다. 이 의미 생물학적 효과와 인과 변형 - 변형와 LD에 있기 때문에, 생물학적 결과없이 변이체는 특정 질환과 연관 될 수있다. 절차 적, 1000 게놈의 최신 버전은 가용 스루풋 10, 11, 전체 게놈 협회 분석을위한 오픈 소스 도구와 호환 바이너리 파일에 9 변형 호출 파일 (VCF)를 프로젝트로 변환하는 것이 좋습니다. 그 후, 각 입력 유전 버지니아와 LD의 R 2> 0.8 다른 모든 유전자 변형쾌활한 후보로서 식별 될 수있다. 변형이 유럽 가계의 주제, 비슷한 조상의 과목에서 데이터가 LD 확장을 사용해야에서 확인 된 경우는,이 ​​스텝 - 예에 대한 적절한 기준 인구를 사용하는 것이 중요합니다.

LD 확장들은 후보 변형 수십 결과 및 이들의 단지 작은 분획이 질병기구에 기여할 것으로 예상된다. 종종, 실험적 개별적으로 각 변형을 조사하기 불가능하다. 변형의 우선 순위를 필터로 공개적으로 사용 가능한 기능 게놈 데이터 세트의 수천을 활용하는 것이 유용하다. 예를 들어, 인 코드 컨소시엄 (12)는의 DNase-SEQ 13 ATAC 같은 기술에서 염색질 접근성 데이터와 함께 콘텍스트의 넓은 범위에서 칩 배열하여 TFS의 결합을 설명하는 실험 및 공동 인자 및 히스톤 마크 수천을 수행 -seq 14 및 서열 FAIRE-15. Datab같은 UCSC 게놈 브라우저 (16), 로드맵 후성 유전체학 (17), 청사진 후성 유전체 (18), Cistrome (19), 및 매핑 20 ASE에 웹 서버는 세포 유형 및 조건의 넓은 범위에 걸쳐 이들과 다른 실험 기법에 의해 생성 된 데이터에 대한 무료 액세스를 제공합니다. 실험적 검토하기에 너무 많은 변형이있을 때, 이러한 데이터는 관련 세포 및 조직 유형의 것으로 조절 영역 내에 위치하는 우선 순위를 사용할 수있다. 또한, 변형 특정 단백질 칩 서열 피크 내에있는 경우,이 데이터는 특정 TF (들) 또는 그의 영향을 줄 수 있습니다 결합 공동 요인으로 잠재적 인 단서를 제공 할 수 있습니다.

다음으로, 우선 순위 결과 변종은 EMSA (21, 22)를 사용하여 결합 예측 유전자형에 의존하는 단백질을 확인하는 실험적으로 상영된다. EMSA은 비 환원성 TBE 겔상에서 올리고의 이동 변화를 측정한다. 형광 표지 올리고는 함께 배양핵 해물, 핵 인자의 결합은 올리고 겔상에서의 이동을 지연시킬 것이다. 이러한 방식으로, 스캔시 강한 형광 신호로 발표 할 예정보다 핵 요소를 결합했다 올리고있다. 특히, EMSA 바인딩 영향을받는 특정 단백질에 대한 예측을 필요로하지 않습니다.

변형이 예측 규제 지역 내에 위치하며, 차동 결합 핵 인자 할 수있는있다가 발견되면, 계산 방법은 누구가에 영향을 줄 수있는 바인딩 특정 TF (들)을 예측하기 위해 사용된다. 우리는 CIS-BP 23, 24, RegulomeDB 25 UniProbe (26), 및이 JasPAR (27)를 사용하는 것을 선호합니다. 후보 TF가 식별되면,이 예측은 구체적으로 다음과 TF (EMSA-supershifts 및 DAPA-서부)에 대한 항체를 사용하여 시험 할 수있다. EMSA-supershift 핵 분해물 및 올리고 TF에 특이 항체의 첨가를 포함한다. EMSA-supershift에서 긍정적 인 결과를 repr입니다EMSA 대역에서 추가의 이동 또는 대역의 손실로 esented (레퍼런스 28에서 검토). 상보 DAPA에서, 변형 및 뉴클레오티드의 측면에 20 염기쌍을 함유하는 5'- 비오틴 올리고 양면은 특히 올리고 결합 핵 인자 캡처 관련된 세포 유형 (들)로부터 핵 파쇄 액과 함께 배양된다. 올리고 이중 핵 인자 복합체는 자기 칼럼에서 마이크로 비드를 스트렙 타비 딘에 의해 고정된다. 결합 된 핵 인자 용출 29,48 통해 직접 수집됩니다. 바인딩 예측이어서 단백질에 특이적인 항체를 사용하여 웨스턴 블롯에 의해 평가 될 수있다. 후속하여 검증 할 수있는 명백한 예측 또는 너무 많은 예측, 질량 분석법을 이용하여 후보의 TF를 식별하기 위해 프로테오믹스 코어로 전송 될 수 DAPA 실험 변이체 풀 - 다운에서 용리가없는 경우에서, 이들은 전술 행동 양식.

articl의 나머지 부분에서즉, 유전자 변형 및 DAPA EMSA 분석 상세한 프로토콜이 제공된다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

솔루션 및 시약 1. 준비

  1. EMSA 및 방위 사업 청에 사용하기위한 사용자 정의 DNA 올리고 뉴클레오티드 프로브를 주문하십시오.
    1. 짧은 올리고 디자인, 바인딩이 아닌 특정 단백질을 감소시키기 위해 30, 및 17 bp의 내인성 게놈 서열에 의해 측면 중앙에 직접 관심의 변형을 배치 (35 ~ 45 염기의 길이 쌍 (BP) 사이). EMSA 올리고 들어, 5 '형광을 추가합니다. 방위 사업 청 올리고 들어, 5 '비오틴 태그를 추가합니다.
    2. 센스 가닥과 역 보완 가닥 모두를 주문하십시오. 또한, 주문 듀플렉스 (프리 어닐링) 올리고. 올리고 이름을 지정할 때 설립 참조 게놈의 명칭을 기반으로.
      참고 : "위험"과 질병 및 프로젝트 특정 할 수있다 "비 위험"지정 "참조"와 "비 참조"더 보편적으로 관련이있다.
    3. 올리고 도착하면, 간단히 100 μ의 최종 농도 클레아없는 물에서 재현 탁 내용과 스핀 다운;엠. 스토어는 -20 ° C에서 주식을 재현 탁. 알루미늄 호일로 포장하여 빛에서 형광 태그 올리고를 보호합니다.
이름 순서
rs76562819_REF_FOR GTAATGCCTTAATGAGAGAG GTTAGTCATCTTCTCACTTC
rs76562819_REF_REV GAAGTGAGAAGATGACTAAC T CTCTCTCATTAAGGCATTAC
rs76562819_NONREF_FOR GTAATGCCTTAATGAGAGAG G GTTAGTCATCTTCTCACTTC
rs76562819_NONREF_REV GAAGTGAGAAGATGACTAAC C CTCTCTCATTAAGGCATTAC

표 1 : 예 EMSA / 방위 사업 청 올리고 뉴클레오티드 디자인은 차동 빈의 SNP를 테스트"NONREF"은 비 기준 대립 약자 동안 딩. "REF"는 기준 대립 유전자를 나타낸다. "에 대한" "REV는"그 보완을 표시하면서, 앞으로 가닥을 의미합니다. SNP는 빨간색으로 볼 수있다.

  1. 최종 10 mM의 HEPES (pH를 7.9)의 농도, 10 밀리미터의 KCl, 탈 이온수 0.1 mM의 EDTA와 세포질 추출 (CE) 버퍼를 준비합니다.
  2. 핵 추출 (NE) 최종 20 mM의 HEPES (pH를 7.9)의 농도, 0.4 M의 NaCl, 및 탈 이온수에 1 mM의 EDTA와 버퍼를 준비합니다.
  3. 최종 10 mM 트리스 (PH 7.5-8.0)의 농도, 50 mM의 염화나트륨, 탈 이온수에 1 mM의 EDTA와 어닐링 버퍼를 준비합니다.

배양 된 세포에서 핵 해물 2. 준비

참고 :이 실험 프로토콜은 B-임파 세포 라인을 사용하여 최적화되었지만, 여러 가지 다른 관련이없는 접착 / 서스펜션 세포주에서 테스트를 거쳤으며 보편적으로 작동합니다.

  1. Cultu2 mM L- 글루타민, 10 % 소 태아 혈청, 페니실린 100 유니트 / ㎖, 스트렙토 마이신 100 ㎍ / ml를 함유 1X 항생제 - 항진균제 250 NG와 로스웰 파크 메모리얼 연구소 (RPMI) 1640 B-임파 세포 재 암포 테리 신 B의 / ㎖
    1. 200,000-500,000 생존 세포 / ml의 범위에서 시드와 통하게되거나 느슨한 캡 세워서 5 % 이산화탄소, 37 ℃에서 플라스크 배양한다.
      참고 :이 1,000,000 이상 세포 / ml에 도달했을 때 B-임파 세포의 성장이 느려집니다. 최대 피펫 팅에 의해 여러 번 아래로 셀 폭발을 휴식과 성장의 빠른 속도를 유지하기 위해 200,000-500,000 세포 / ml로 세포를 반환합니다.
  2. 5 분, 4 ° C에서 300 XG에 스핀 다운 및 흡입을 통해 PBS를 제거, 두 번 10 ml의 차가운 얼음 인산염 완충 식염수 (PBS)로 배양 된 세포를 씻으십시오.
  3. 10 7 세포 당 차가운 PBS 1 ml의 얼음 같은 혈구와에 resuspend 펠렛을 사용하여 세포를 계산합니다.
    참고 : 예를 들어, 2 × 10 7 용균 경우 </ SUP> 셀, 2 ml의 PBS에 재현 탁.
  4. 나누어지는 1.5 ml의 마이크로 원심 튜브에 1 ㎖의 각 튜브는 PBS에서 10 7 세포를 포함하도록. PBS 오프 2 분 4 ° C 및 흡인을위한 3,300 XG에 원심 분리기.
  5. 사용 CE 버퍼의 작업 스톡 1 mM 디티 오 트레이 톨 (DTT), 1X 포스파타제 억제제 및 1X 프로테아제 억제제를 추가하기 전에. 재현 탁 셀 CE 버퍼 400 μL로 펠릿 15 분 동안 얼음 위에서 배양한다.
  6. 10 % Nonidet P-40의 25 μl를 추가하고 피펫으로 혼합한다. 4 ° C, 3 분 동안 최대 속도로 원심 분리기. 가만히 따르다 및 상층 액을 버린다.
  7. 사용 NE 버퍼의 작업 재고 1 mM의 DTT, 1X 포스파타제 억제제, 및 1X 프로테아제 억제제를 추가하기 전에. 재현 탁 세포 NE 버퍼의 30 μL와 펠렛 및 텍싱하여 혼합한다.
  8. 튜브 회전에서 10 분 동안 얼음에 4 ° C에서 품어. 원심 분리기 2 분 4 ° C를위한 3,300 XG.
  9. 에 저장하기 전에 맑은 상층 액 (핵 해물) 및 분취를 수집 -806; C는 단백질을 분해 할 수있다 여러 동결 - 해동 사이클을 방지 할 수 있습니다. bichoninic 산 분석 (BCA) (31)를 사용하여 단백질 농도를 측정하기 위해 10 μL 나누어지는 둡니다.

3. 전기 영동 이동성 이동 분석 (EMSA)

  1. 올리고 작업 주식 및 EMSA 젤을 준비합니다.
    1. 올리고가 양면에 정렬 된 경우, 100 μM 스톡을 해동 한 희석 : 2000 어닐링 완충액에 50 nM의 작업 스톡을 달성했다.
    2. 올리고는 단일 가닥 주문 된 경우, 100 μM 주식을 해동 및 100 nm의 작업 주식을 달성하기 위해 어닐링 버퍼에 1:10 희석. 미세 원심 분리 관에서 서로 100 nM의 상보 가닥 용액 100 ㎕를 결합.
      1. 5 분 동안 95 ℃의 열 블록에 놓는다. 열 블록을 끄고 올리고 천천히 사용 전 적어도 한 시간 동안 실온까지 냉각 할 수있다.
    3. EMSA 젤 사전 실행합니다.
      1. 프리 캐스트 6 % T에서 슬라이드를 제거젤을하고 우물에서 모든 버퍼를 제거하는 탈 이온수에서 여러 번 헹군다. 탈 이온수 950 ml의 10 배 TBE 50 ㎖를 추가하여 0.5 배의 TBE 버퍼 1 L를 준비합니다.
      2. 겔 전기 영동 장치를 조립하고 0.5 배의 TBE 버퍼와 내부 챔버를 작성하여 누출이 있는지 확인합니다. 어떤 버퍼가 외부 챔버로 누출되지 않으면 외부 챔버에게 길의 약 2/3 채운다.
      3. 60 분 동안 100 V에서 젤을 사전 실행합니다.
      4. 0.5 배의 TBE 버퍼 200 μL 잘 각을 플래시합니다.
  2. 버퍼 마스터 믹스 바인딩 준비합니다.
    1. 100 mM 트리스, 500 밀리미터의 KCl, 10 mM의 DTT의 최종 농도로 버퍼를 바인딩 10 배를 준비; 탈 이온수의 pH가 7.5.
    2. 미세 원심 분리 관에, 모든 반응 (표 2 내지 10 μL의 10 배의 결합 완충액 10 μL DTT / 소르 베이트, 5 μL 폴리 D (IC), 2.5 ㎕의 연어 정자 DNA)에 공통 시약 이루어진 마스터 믹스를 생성한다. 추가로 10 %를 준비피펫에 의한 볼륨 손실을 설명합니다.
시약 최종 용액에 농축. # 1 RXN # 2 RXN # 3 RXN # 4 RXN
초순수 20 μL의 부피합니다. 13.5 μL 11.98 μL 13.5μl 11.98 μL
10 배 버퍼 바인딩 1 배 2 μL 2 μL 2 μL 2 μL
DTT / TW-20 1 배 2 μL 2 μL 2 μL 2 μL
연어 정자 DNA 500 NG / μL 0.5 μL 0.5 μL 0.5 μL 0.5 μL
1μg / μL 폴리 D (IC) 1 μg의 1 μL 1 μL 1 μL 1 μL
핵 추출물 (5.26 UG / μL) 8 μg의 - 1.52 μL - 1.52 μL
NE 버퍼 1.52 μL - 1.52 μL -
참조 대립 유전자 올리고 50 fmol 1 μL 1 μL - -
비 참조 대립 유전자 올리고 50 fmol - - 1 μL 1 μL

표 2 : 예 EMSA 반응 세투P. 표는 유전자형 - 의존성 특정 SNP TF들로의 결합이 있다는 가설을 테스트하기 위해 예 EMSA를 나타낸다.

  1. 이러한 모든 시약을 첨가 한 다음 최종 부피가 20 μL 될 것으로 각 microcentrifuge 관에 뉴 클레아없는 물을 추가합니다.
  2. 각 microcentrifuge 관에 마스터 믹스의 적당량 (5.5 μL)를 추가합니다.
  3. 적절한의 microcentrifuge 튜브에 핵 해물의 8 μg의 추가. 핵 부정적인 컨트롤 등의 추출물 (예를 들어, 2, RXN # 1과 RXN # 3)없이 올리고을 포함하는 튜브를 포함합니다.
    주의 : 반응 당 분해물의 최적 량은 적정에 의해 실험적으로 결정되어야한다. 일반적으로, 해물의 2-10 μg의 범위를 적정하면 충분하다.
  4. 적절한의 microcentrifuge 튜브에 올리고 50 fmol를 추가합니다. 톡 믹스 앤 간단히 튜브의 바닥에 내용을 회전합니다. 실온에서 20 분 동안 인큐베이션.
    참고 : 만약 attemptisupershift 겨, 올리고 첨가하기 전에 실온에서 20 분 동안 항체 해물 혼합물을 배양한다. 최상의 결과를위한 칩 학년 항체의 1 μg의 사용을 권장합니다.
  5. 각 microcentrifuge 관에 10 배 오렌지로드 염료의 2 μl를 추가합니다. 최대 피펫 아래로 혼합.
  6. 별도의 우물에 각 샘플을 추방 한 후로 pipetting 아래로 혼합에 의해 사전 실행 6 % TBE 겔에 샘플을로드합니다. 주황색 염료가 젤 내리막 길의 3/4에 2/3를 마이그레이션 할 때까지 80 V에서 젤을 실행합니다. 이 약 60-75 분 정도 소요됩니다.
  7. 겔 칼이 열려 들리 플라스틱 카세트에서 젤을 제거하고 마르지을 유지하기 위해 0.5 % TBE 버퍼와 용기에 젤을 배치합니다.
  8. 이미지를 방해 할 어떤 거품이나 오염 물질을 제거해야되고, 적외선 및 화학 발광 영상 시스템의 표면에 젤을 놓습니다.
  9. 스캐닝 시스템 소프트웨어를 사용하면은 "획득"탭을 클릭합니다다음 겔 스캐너의 표면에있는 위치에 대응하는 영역 주위에 상자를 그립니다 "새 그리기"를 선택합니다.
  10. 은 "획득"탭의 "채널"섹션에서 올리고에 형광 태그의 파장에 해당하는 채널을 선택합니다. 은 "스캐너"섹션에서 낮은 품질의 미리보기 스캔을 얻기 위해 "미리보기"를 클릭합니다. 겔의 부분에 아래로 취득 미리보기 이미지를 둘러싼 파란색 상자를 드래그하여 스캔 영역을 조정하는 이미징합니다.
    참고 : 예를 들어, 700 나노 형광으로 표지 올리고를 사용하는 경우 "700 nm의"채널 스캔하기 전에 선택되어 있는지 확인합니다.
  11. 은 "스캔 제어"섹션에서 "84 μM"해상도 옵션과 "중간"품질 옵션을 선택합니다. 겔의 절반 두께 오프셋에 포커스를 설정한다. 참고 : 예를 들어, 1 mm 겔 오프셋 0.5 mm의 초점을 사용한다.
  12. 은 "스캐너"섹션에서 b에 "시작"버튼을 클릭스캔을 egin.
    주 : 스캔하는 동안, 휘도, 명암 및 색상이 종종 주사 시스템의 제조사에 따라 수동으로 조정될 수있다.
  13. 검사가 완료되면, "영상"탭을 선택하고 방향을 수정하려면 "만들기"절에서 "회전 또는 뒤집기"를 클릭합니다. 메인 메뉴에서 "내보내기"를 클릭하여 이미지 파일을 저장 한 다음 선택 "단일 이미지보기를."

4. DNA 선호도 정화 분석 (DAPA)

  1. 5 μM 올리고 작업 주식의 준비.
    1. 올리고는 양면 인쇄로 주문 된 경우, 100 μM의 주식을 해동하고 5 μm의 작업 주식을 달성하기 위해 어닐링 버퍼에 1:20 희석.
    2. 올리고는 단일 가닥 주문 된 경우, 100 μM 주식을 해동과 주식을 작업 10 μM을 달성하기 위해 어닐링 버퍼에 1:10 희석. 서로 10 μM 상보 가닥의 10 μl를 결합한다. 95 ℃에서 가열 블럭에서 발생5 분. 열 블록을 끄고 올리고 천천히 사용하기 전에 실온까지 냉각 할 수 있습니다.
  2. 시작하기 전에 실온으로 결합 완충액 낮은 엄격 세척 완충액, 고 엄격 세척 완충액 및 용출 완충액을 따뜻하게.
    참고 : 50 ng의 최종 농도 / ㎖ 폴리 D (IC)를 올리고 발 단백질의 잠재적 비 - 특이 적 결합을 감소시키기 위해 결합 완충액 낮은 엄격 세척 완충액, 및 고 엄격 세척 완충액에 첨가 할 수있다.
  3. 각 변형에 대한 바인딩 혼합물을 준비합니다.
    1. 버퍼를 바인딩의 2 권으로 핵 해물의 1 볼륨을 섞는다.
      참고 : 해물의 필요한 양으로 인해 TF가 풍부한 변화를 실험적으로 결정되어야한다. 열 당 핵 해물의 μg의 100 ~ 250 사이를 사용하면 대부분의 경우에 충분하다.
    2. 1 배 포스 파타 아제 억제제, 1X 프로테아제 억제제 및 1 배 결합 증강 (옵션)을 추가하고 튜브를 여러 번 쓸어 넘겨 섞는다.
      참고 : 100 배 바인딩증강은 750 밀리미터의 MgCl 2, 300MM ZnCl 2로 구성되어 있습니다. DNA에 TF의 결합은 보조 인자 또는 환원제에 의존하는 경우 바인딩 인핸서를 추가합니다. 이 정보가 알려져 있지 않은 경우, 상기 바인딩 인핸서를 추가한다.
    3. 각각의 결합 혼합물에 5 μm의 바이오틴 캡처 DNA (50 pmol의) 10 μl를 추가합니다. 실온에서 20 분 동안 인큐베이션.
      참고 : 배양 시간 및 온도는 TF에 따라 다를 수 있습니다. 최적의 값은 실험적으로 결정되어야한다.
  4. 스트렙 타비 딘 마이크로 비드의 100 μl를 추가합니다. 실온에서 10 분 동안 인큐베이션.
  5. 각 올리고 프로브를 테스트중인 경우, 자기 분리기에 바인딩 열을 배치합니다. 각 바인딩 열 아래 직접 microcentrifuge 관을 삽입하고 열을 씻어 바인딩 버퍼 100 μl를 적용합니다.
  6. 분리 컬럼에 각각 결합 혼합물의 내용을 피펫 및 액체가 미세 원심으로 칼럼을 통해 완전히 흐를 수 있도록진행하기 전에 관. 바인딩 혼합물에 사용 된 변형 올리고과 열 레이블을해야합니다. 플로우를 통해 샘플을 레이블과 낮은 엄격 세척를 수집하는 새로운 마이크로 원심 튜브로 교체합니다.
  7. 열을 둘러 엄격 세척 버퍼 100 μl를 적용; 열 저수지가 비어 때까지 기다립니다. 세척 4 배를 반복합니다. 저 엄격 세척 샘플 라벨과 높은 엄격 세척를 수집하는 새로운 마이크로 원심 튜브로 교체합니다.
  8. 칼럼에 높은 엄격 세척 버퍼 100 μl를 적용; 열 저수지가 비어 때까지 기다립니다. 세척 4 배를 반복합니다. 높은 엄격 세척 샘플 라벨 및 사전 용출를 수집하는 새로운 마이크로 원심 튜브로 교체합니다.
  9. 열 네이티브 용출 버퍼의 30 μl를 추가하고 5 분 동안 서 보자. 사전 용출 샘플 라벨 및 용출를 수집하는 새로운 마이크로 원심 튜브로 교체합니다.
    주 :이 결합 된 단백질을 용출하지 않는다; 그것은 나머지 고 엄격 세척컬럼에서 용출 완충액의 효율을 극대화하는 용출 버퍼로 대체.
  10. 바인딩과 TF를 용출하는 추가 50 μl의 기본 용출 버퍼를 추가합니다. 높은 수율 미만 농축 용출액 들어 천연 용출 버퍼의 추가 50 μL를 추가하고 관류를 수집한다.
    주 : 결합 TF들 (32)의 신원을 확인하기 위해 질량 분석을 통해 용출 샘플을 분석한다. 이후, 웨스턴 블롯 (33)이어서 소듐 도데 실 황산나트륨 폴리 아크릴 아미드 겔 전기 영동 (SDS-PAGE)을 통해 결과를 확인 단백체. 질량 분석기를 사용할 수없는 경우, 유전자형 의존적 결합을 나타내는 단백질 (들)의 크기를 결정하는 대신 웨스턴 블롯의 표준 기술을 사용하여 실버 염색을 실행. 소개에 자세히 계산 방법에서 예측과 TF의 목록을 좁힐이 정보를 사용합니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

해물의 품질을 특징으로 관련이있는 EMSA 또는 방위 사업 청, 그리고 다양성을 수행 할 때이 절에서 무엇을 기대해야하는지의 대표적인 결과가 제공된다. 예를 들어, 여러 번 동결 융해 단백질 시료 것은 변성 될 수 있다는 것을 제안하고있다. 이러한 "동결 - 해동"사이클의 맥락에서 EMSA 분석 재현성을 탐색하기 위해, 하나 이상의 유전 적 변형에 다른 두 개의 35 염기쌍 올리고는 지정된 시간 동안 해동 재 동결 하였다 핵 해물 일괄 적으로 배양 하였다 . 시간의 두 그림은 5 번이 특정 B 림프구 핵 추출물을 동결 및 해동하는 단백질의 무결성에 겉으로는 아무 효과가 없다는 것을 보여줍니다; 그러나, 핵 단백질의 안정성은 샘플에 따라 다르며, 따라서 사용되는 각 개별 셀 라인에서 테스트해야합니다. 다른 배치 위해 준비 할으로부터 변화를 가질 수도있다핵 해물의 관리 포인트. 이 변형으로 인해 분해 셀 통로 번호, 또는 다른 인자에 앞서 세포주기의 단계에 있는지의 여부를 실제 결과를 보장하기 위해 파쇄물의 상이한 배치를 사용 EMSA 결과를 복제하는 것이 중요하다.

또한, 상기 EMSA에 대한 신호 대 잡음비를 최적화하는 것이 중요하다. 이것의 중요한 변수는 올리고 농도이다. 올리고 (5-300 fmol)의 양은 올리고 다른 양의 신호 (도 3)에 미치는 영향을 평가하기 위해 적정 하였다. 위로 올리고 100 fmol 주파수 대역의 강도의 증가가 관찰되었다. 이 시점 이후, 100 fmol 제안 신호 고원이 EMSA 반응에 대한 최적 올리고 양이다.

마지막으로,이 논문에서 설명하는 전략의 일부를 사용하여 우리의 발표 된 연구 중 하나에서 대표적인 그림은 (그림 4)이 제공된다. 일에서연구 34, 우리는 보여 주었다 STAT1, 상승 작동 35 복잡한 타입 1 인터페론 수용체의 하류 유전자 발현의 억제 모두에 참여하는 전사 인자의 결합 rs6590330 증가 루푸스 관련 위험 대립. 이 예에서, STAT1는 제 탠덤 질량 분광법 (DAPA-MS)로 결합 된 고성능 액체 크로마토 그래피를 사용 단백체 분석 하였다 DAPA에 의해 확인되었다. 방위 사업 청 - 웨스턴 블롯은 단백체 분석 (STAT1)에서 확인 된 TF를 확인하고 STAT1의 인산화 된 형태가 아닌 참조 (루푸스 위험) 올리고 결합되었는지 확인하기 위해 사용되었다. 이 도면은이 전략의 다양한 분석법 비 코딩 변이체 전사 인자의 결합 차이를 식별 할 수있는 방법을 도시한다.

그림 2
그림 2 : 재현성 분석및 EMSA 결과에 동결 - 해동 사이클의 결과는. 유전자 변형의 기준 (R) 또는 비 - 참조 (NR) 대립 유전자를 포함하는 올리고는 동결 융해 여러 사이클 후의 분해물의 동일한 제제를 조사하는데 사용되었다. (리스 : 해물). 각 레인 젤 (파란색 화살표)의 하단에있는 무료 프로브가 포함되어 있습니다. 올리고으로하여 TFS의 결합하는 겔 (빨간색 화살표)의 상단 절반 밴드로 볼 수 있습니다. 겔 (브래킷 참조)의 하단에 포함 된 밴드 비특이적이다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 3
도 3 :. 다른 올리고 농도의 효과를 평가 올리고 다양한 농도의 핵 분해물의 단일 제제를 조사하는데 사용되었다. 에프luorescent 신호 올리고은 제한 시약 인 것을 나타내는, 증가 된 양의 올리고 증가한다. 단백질의 양이 제한 시약이되는 100 ~ 300 fmol 차선에서 신호 고원. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 4
그림 4 :. rs6590330의 루푸스 위험 대립 유전자는 방위 사업 청-MS STAT1 높은 비 위험 대립 유전자에 비해 rs6590330 위험 대립 유전자를 포함하는 올리고 결합 pSTAT1 전시에 의해 평가로 STAT1이 바인딩 증가한다. 비오틴 - 표지 올리고은 엡스타인 - 바 (Epstein-Barr) 바이러스 형질 전환 된 B 세포 핵 추출물과 함께 배양 하였다. 올리고 결합 단백질은 방위 사업 청을 사용하여 캡처했다. 단백질은 안티 pSTAT1을 사용하여 SDS- 폴리 아크릴 아미드 겔 전기 영동에 의해 분리하고, 검출 된(A) 또는 항 STAT1 (B). M : 마커. NR : rs6590330의 비 위험 대립 유전자를 포함하는 올리고; R : rs6590330 위험 대립 유전자를 포함하는 올리고; 돌연변이 : rs6590330의 다운 스트림 사이트를 바인딩 중단 추정 STAT1을 포함 올리고; 세포 용 해물 : B 세포에서 핵 추출물. 밴드의 상대 강도는 각 밴드 아래에 표시됩니다. 결과는 네 가지 실험의 대표; 모든 실험은 2/4 실험없이 STAT1에서 위험 대립 유전자를 가진 프로브에 결합 STAT1 증가 입증 또는 둘 위험 올리고의 면역 침전 검출 동안 pSTAT1는 비 위험 올리고의 면역 침전으로 검출하면서. 이 그림은 참조 (34)에서 수정되었습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

시퀀싱 및 유전형 기술의 발전이 크게 질병과 관련된 유전자 변형을 식별하는 우리의 능력을 강화하고 있지만, 이러한 변형의 영향을 기능적 메커니즘을 이해하는 능력이 떨어지고있다. 문제의 주된 원인 가능성 유전자 발현을 제어하기 어려워-간 예측 메커니즘에 영향을하는 부호화 게놈 영역 많은 질병 관련 변종 N에 위치된다는 것이다. 여기서는 가능성이 많은 비 - 코딩 변이체의 기능에 기여하는 이벤트를 결합 유전자형 의존 TF를 식별하는 EMSA 및 DAPA 기술 유용한 분자 도구에 기초하여 프로토콜을 제시한다. 이러한 두 가지 기술이 과거에 널리 이용되었지만, 그것들은 단지 최근에 결합 TF의 유전 적 변이 분석하도록 구성되어있다. TF들 외에도 EMSA는 또한 프로토콜 (36) 만 약간의 조정으로 RNA 결합 단백질에 대한 유전자 변형의 효과를 분석하기 위해 사용될 수있다.

. "ove_content> 여기에 제시된 프로토콜을 수행하는 간단하고 쉬운 그럼에도 불구하고, 특정 부분은 이전의 실험 첫 번째로 추가 고려 사항이 필요합니다, 엄격한 통계 분석을 수행하여 고려 변형의 초기 목록을 생성하는 것이 중요하다이 단계에서 오류. 많은 변형이 질환의 위험에 기여하지 않고 핵 해물을 차별적으로 결합 수 있으므로, 모든 다운 스트림 분석 탈선 수있다. 또한, 적절한 세포 유형에서 수행되는 기능 유전체학 데이터의 사용은 중요하다 같은 부적합 세포 유형 바인딩 위양성 TF의 발생으로 이어질 수도 현재 가장 널리 사용되는 기능 유전체학 리소스 인코딩 (12) 및 로드맵 후성 (17)을 포함한다. 예측. 추가 정보 관심 질환 관련 세포 타입에서 유전자의 발현 수준에 대하여, 예컨대 ImmGen 37 BioGPS (38)와 같은 다른 자원으로부터 얻어 질 수있다 3920 SNPsea. 예를 들면, resourCES은 중요한 세포 유형에서 발현되는 이들의 TF를 포함 TF에 결합 예측을 필터링하는데 사용될 수있다.

여기에는 EMSA와 방위 사업 청 등의 시험 관내 실험의주의 사항을 고려하는 것도 중요합니다. 특히, 위음성을 줄이기 위해 별도 핵 파쇄 제제 실험을 반복 할 필요가있다. 또한, 성공적인 EMSA-supershift 항체 블록 TF의 DNA 결합 도메인이있는 항체는 TF에 결합하는 EMSA 대역에서 추가의 변화, 또는 주파수 대역의 손실로서 존재할 수있다. 상이한 TF 향해 이소 타입 대조군 항체 및 / 또는 항체를 포함 하나의 시나리오에서, supershift의 특이성을 확인하는데 유용하다. supershift을 수행하는 또 다른 고려 사항은 DTT / 반응의 폴리 소르 베이트를 포함 할 것인지 여부이다. DTT / 폴리 소르 베이트는 결합되지 않은 DNA의 정확한 정량을 허용 로딩 염료를 안정화; 그러나, 그것은 또한 항체의 이황화 결합이 발생할 줄일 수 있습니다EMSA-supershift의 실패로 보내고. 단지를 supershift 할 때와 DTT / 폴리 소르 베이트없이 반응을 시도하는 것이 좋습니다. 폴리 D (IC)와 반응 당 연어 정자 DNA의 최적 량은 적정에 의해 실험적으로 결정되어야한다. 일반적으로 1-6 μg의 폴리 d 개 (IC) 및 50 ~ 500 ng의 연어 정자의 범위를 적정하면 충분하다. DAPA위한 하나의 유용한 양성 대조군 (예 CIS-BP 23 또는 Factorbook 40 데이터베이스로부터 구입) 잘 특징 결합 모티프를 가진 TF에 대한 컨센서스 서열을 사용하고 TF에 특이적인 항체와 함께 웨스턴를 실행하는 것을 포함한다. 양 분석의 경우, 스크램블링 된 올리고는 관심있는 올리고 특정 바인딩 관찰 것을 보여주기 위해 사용될 수있다.

모두 EMSA와 방위 사업 청 기술은 실험적인 제한이 있습니다. 예를 들어, TF와 DNA 사이의 결합 친화도는 버퍼 조건 많은 부분에 영향을 받는다. 이상적으로는, 완충액 조건은 내인성 공조 모방한다핵의 ns의 최적의 결합을 허용합니다. EMSA를 들어, 부적절한 버퍼 조건은 약한 밴드 또는 전체 밴드의 손실이 발생할 수 있습니다. DAPA 들어 비 이상적인 조건은 TF (S)는 세척 단계 동안 용출시킬 수있다. 따라서, 각각의 분석은 특정 버퍼 조건에서 결합 TF-올리고 식별에서만 유효합니다. 가장 보편적으로 유용 버퍼 조건은 위의 프로토콜에 제시되어있다. 두 번째 제한은 EMSA 및 방위 사업 청 방법의 실험 결과를 통해의 TFS 바인드 올리고의 메커니즘에 대한 약간의 정보를 제공하는 것입니다. TF가이 올리고에 직접 결합 수 또는 다른 요인에 의해 보충 될 수있다. 따라서,이 올리고과 TF에 결합하여 실험적 이러한 예측을 검증하는 방법을 예측하는 계산 올리고 서열을 분석하는 것이 중요하다. 예를 들어, 특정 결합 서열이 돌연변이되거나 또는 결합 파트너 실험적 고갈 될 수있다. 마지막으로, 사용되는 추출물의 양은 각각의 실험에 대해 t 적정해야오 최적의 결과를 얻을. 너무 많은 해물 바인딩 TF-올리고 포화 위험 및 비 위험 대립 유전자 사이의 바인딩 어떤 차이를 모호하게 할 수있다. 추가 문제 해결을 위해, 독자는 몇 가지 우수한 검토 및 방법 원고 30,41,42 참조 할 수 있습니다.

여기에서 설명하는 분석에 더하여, 상기 살아있는 세포 (도 1 아래쪽) 내의 변형의 역할을 연구 할 수있는 생체 내 분석은 다양하다. 차동 셀 (34) 생활에 복제 체외 분석에서 관찰 바인딩 경우 대립 유전자 특정 정량적 중합 효소 연쇄 반응에 의해 다음 크로 마틴 면역이 연구를 수행 할 수있다 (-qPCR에이 칩)를 식별합니다. 관심있는 변이체 이형 세포가 사용되는 경우, 예를 들어, qPCR의 실험 TF 면역 염색질의 두 대립 유전자 사이의 농축의 차이를 검출 할 수있다. 칩은 특정 칩 수준의 항체를 필요로; howeve칩 수준의 TF 항체를 사용할 수없는 경우 R, 플래그 태그가 TF로 세포를 형질하는 것은 효과적인 대안 (43)이다. 또한, 표적 유전자의 발현에 결합 차동 효과는 Genevar (44)에 의해 컴파일 된 것과 같은 유전자형 세포 또는 공개적으로 이용 가능한 자원에서 로컬 수집 발현 데이터를 이용하여 관련 세포 유형에서 발현 양적 형질 위치 (eQTL) 분석을 통하여 조사 할 수있다. 루시페라아제 리포터 분석법은 또한 단백질의 결합이 유전자의 발현에 영향을 차분 정도를 조사하는데 사용될 수있다. 이러한 분석에 관계없이 변형은 프로모터, 인핸서 또는 리프레 45-47 영역에 위치되는지에 작동하도록 변경 될 수있다. 마지막으로, CRISPR / Cas9 48 게놈 편집 기술은 원인을 확인하기위한 중요한 단일 변이체에서만 다를 세포주를 생성하는데 사용될 수있다. 이러한 기술은 실질적 betw 관찰되는 실험 편차를 감소시킬 수있다판독 기능 해석 유전자 발현 또는 다른 질환 중간 표현형 이후 유 전적으로 다양한 환​​자로부터 유래 EEN 세포주 편집 세포주에서 수행 비 편집 세포주와 비교 될 수있다.

제시된 전략의 주요 장점은 결합 유전자형 의존 TF 쉽고 빠른 검출을 가능하게한다는 것이다. 중요한 유전 변이를 우선 순위에 의해, 상기 실험은 생물학적 효과를 확인하고 그 인과 관계를 입증하기 위해 설계 될 수있다. 특히,이 프로토콜은 GWAS 또는 미세 매핑에서 확인 된 질병이나 표현형 관련된 변형을 조사하기 위해 적용 할 수 있습니다. 유전자 데이터와 통계 관련 유전자 변형 목록의 큰 성장 발견 물은 이미 사용할 수 있습니다. 대부분의 경우, 이러한 변형 통계적 관련성을 구동 생물학적 메커니즘은 명확하지 않다. 이 제안에 설명 된 전략은 많은 비 코딩 disea의 정확한 기능 해석 가능변형 자체는 관련. 이러한 지식은 유전자 기반 질병을 구동하는 분자 메커니즘의 전체 해명에 매우 중요합니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 아무것도 없어.

Materials

Name Company Catalog Number Comments
Custom DNA Oligonucleotides Integrated DNA Technologies http://www.idtdna.com/site/order/oligoentry
Potassium Chloride Fisher Scientific BP366-500 KCl, for CE buffer
HEPES (1 M) Fisher Scientific 15630-080 For CE and NE buffer
EDTA (0.5M), pH 8.0 Life Technologies R1021 For CE, NE, and annealing buffer
Sodium Chloride Fisher Scientific BP358-1 NaCl, for NE buffer
Tris-HCl (1M), pH 8.0 Invitrogen BP1756-100 For annealing buffer
Phosphate Buffered Saline (1x) Fisher Scientific MT21040CM PBS, for cell wash
DL-Dithiothreitol solution (1 M) Sigma 646563 Reducing agent
Protease Inhibitor Cocktail Thermo Scientific 87786 Prevents catabolism of TFs
Phosphatase Inhibitor Cocktail  Thermo Scientific 78420 Prevents dephosphorylation of TFs
Nonidet P-40 Substitute IBI Scientific IB01140 NP-40, for nuclear extraction
BCA Protein Assay Kit Thermo Scientific 23225 For measuring protein concentration
Odyssey EMSA Buffer Kit Licor 829-07910 Contains all necessary EMSA buffers
TBE Gels, 6%, 12 Wells Invitrogen EC6265BOX For EMSA
TBE Buffer (10x) Thermo Scientific B52 For EMSA
FactorFinder Starting Kit Miltenyi Biotec 130-092-318 Contains all necessary DAPA buffers
Licor Odyssey CLx Licor Recommended scanner for DAPA/EMSA
Antibiotic-Antimycotic Gibco 15240-062 Contains 10,000 units/ml of penicillin, 10,000 µg/ml of streptomycin, and 25 µg/ml of Fungizone® Antimycotic
Fetal Bovine Serum Gibco 26140-079 FBS, for culture media
RPMI 1640 Medium Gibco 22400-071 Contains L-glutamine and 25 mM HEPES

DOWNLOAD MATERIALS LIST

References

  1. Hindorff, L. A., et al. Potential etiologic and functional implications of genome-wide association loci for human diseases and traits. Proc Natl Acad Sci U S A. 106, (23), 9362-9367 (2009).
  2. Maurano, M. T., et al. Systematic localization of common disease-associated variation in regulatory DNA. Science. 337, (6099), 1190-1195 (2012).
  3. Ward, L. D., Kellis, M. Interpreting noncoding genetic variation in complex traits and human disease. Nat Biotechnol. 30, (11), 1095-1106 (2012).
  4. Paul, D. S., Soranzo, N., Beck, S. Functional interpretation of non-coding sequence variation: concepts and challenges. Bioessays. 36, (2), 191-199 (2014).
  5. Zhang, F., Lupski, J. R. Non-coding genetic variants in human disease. Hum Mol Genet. (2015).
  6. Lee, T. I., Young, R. A. Transcriptional regulation and its misregulation in disease. Cell. 152, (6), 1237-1251 (2013).
  7. Slatkin, M. Linkage disequilibrium--understanding the evolutionary past and mapping the medical future. Nat Rev Genet. 9, (6), 477-485 (2008).
  8. Bush, W. S., Moore, J. H. Chapter 11: Genome-wide association studies. PLoS Comput Biol. 8, (12), e1002822 (2012).
  9. 1000 Genomes Project Consortium. An integrated map of genetic variation from 1,092 human genomes. Nature. 491, (7422), 56-65 (2012).
  10. Chang, C. C., et al. Second-generation PLINK: rising to the challenge of larger and richer datasets. Gigascience. 4, 7 (2015).
  11. Purcell, S., et al. PLINK: a tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet. 81, (3), 559-575 (2007).
  12. ENCODE Project Consortium. An integrated encyclopedia of DNA elements in the human genome. Nature. 489, (7414), 57-74 (2012).
  13. Crawford, G. E., et al. Genome-wide mapping of DNase hypersensitive sites using massively parallel signature sequencing (MPSS). Genome Res. 16, (1), 123-131 (2006).
  14. Buenrostro, J. D., Giresi, P. G., Zaba, L. C., Chang, H. Y., Greenleaf, W. J. Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nat Methods. 10, (12), 1213-1218 (2013).
  15. Giresi, P. G., Kim, J., McDaniell, R. M., Iyer, V. R., Lieb, J. D. FAIRE Formaldehyde-Assisted Isolation of Regulatory Elements) isolates active regulatory elements from human chromatin. Genome Res. 17, (6), 877-885 (2007).
  16. Kent, W. J., et al. The human genome browser at UCSC. Genome Res. 12, (6), 996-1006 (2002).
  17. Roadmap Epigenomics Consortium. Integrative analysis of 111 reference human epigenomes. Nature. 518, (7539), 317-330 (2015).
  18. Martens, J. H., Stunnenberg, H. G. BLUEPRINT: mapping human blood cell epigenomes. Haematologica. 98, (10), 1487-1489 (2013).
  19. Liu, T., et al. Cistrome: an integrative platform for transcriptional regulation studies. Genome Biol. 12, (8), R83 (2011).
  20. Griffon, A., et al. Integrative analysis of public ChIP-seq experiments reveals a complex multi-cell regulatory landscape. Nucleic Acids Res. 43, (4), e27 (2015).
  21. Staudt, L. M., et al. A lymphoid-specific protein binding to the octamer motif of immunoglobulin genes. Nature. 323, (6089), 640-643 (1986).
  22. Singh, H., Sen, R., Baltimore, D., Sharp, P. A. A nuclear factor that binds to a conserved sequence motif in transcriptional control elements of immunoglobulin genes. Nature. 319, (6049), 154-158 (1986).
  23. Weirauch, M. T., et al. Determination and inference of eukaryotic transcription factor sequence specificity. Cell. 158, (6), 1431-1443 (2014).
  24. Ward, L. D., Kellis, M. HaploReg: a resource for exploring chromatin states, conservation, and regulatory motif alterations within sets of genetically linked variants. Nucleic Acids Res. 40, (Database issue), D930-D934 (2012).
  25. Boyle, A. P., et al. Annotation of functional variation in personal genomes using RegulomeDB. Genome Res. 22, (9), 1790-1797 (2012).
  26. Hume, M. A., Barrera, L. A., Gisselbrecht, S. S., Bulyk, M. L. UniPROBE, update 2015: new tools and content for the online database of protein-binding microarray data on protein-DNA interactions. Nucleic Acids Res. 43, (Database issue), D117-D122 (2015).
  27. Mathelier, A., et al. JASPAR 2014: an extensively expanded and updated open-access database of transcription factor binding profiles. Nucleic Acids Res. 42, (Database issue), 142-147 (2014).
  28. Smith, M. F. Jr, Delbary-Gossart, S. Electrophoretic Mobility Shift Assay (EMSA). Methods Mol Med. 50, 249-257 (2001).
  29. Franza, B. R., Josephs, S. F., Gilman, M. Z., Ryan, W., Clarkson, B. Characterization of cellular proteins recognizing the HIV enhancer using a microscale DNA-affinity precipitation assay. Nature. 330, (6146), 391-395 (1987).
  30. LI-COR. Odyssey Infrared EMSA Kit: Instruction Manual. Available from: http://www.licor.com/bio/pack_inserts/?pi=829-07910 (2014).
  31. Thermo Fisher Scientific, Inc. BCA Protein Assay Kit: User Guide. Available from: https://tools.thermofisher.com/content/sfs/manuals/MAN0011430_Pierce_BCA_Protein_Asy_UG.pdf (2014).
  32. Wijeratne, A. B., et al. Phosphopeptide separation using radially aligned titania nanotubes on titanium wire. ACS Appl Mater Interfaces. 7, (21), 11155-11164 (2015).
  33. Silva, J. M., McMahon, M. The Fastest Western in Town: A Contemporary Twist on the Classic Western Blot Analysis. J. Vis. Exp. (84), (2014).
  34. Lu, X., et al. Lupus Risk Variant Increases pSTAT1 Binding and Decreases ETS1 Expression. Am J Hum Genet. 96, (5), 731-739 (2015).
  35. Ramana, C. V., Chatterjee-Kishore, M., Nguyen, H., Stark, G. R. Complex roles of Stat1 in regulating gene expression. Oncogene. 19, (21), 2619-2627 (2000).
  36. Fillebeen, C., Wilkinson, N., Pantopoulos, K. Electrophoretic Mobility Shift Assay (EMSA) for the Study of RNA-Protein Interactions: The IRE/IRP Example. J. Vis. Exp. (94), e52230 (2014).
  37. Heng, T. S., Painter, M. W. Immunological Genome Project, C. The Immunological Genome Project: networks of gene expression in immune cells. Nat Immunol. 9, (10), 1091-1094 (2008).
  38. Wu, C., et al. BioGPS: an extensible and customizable portal for querying and organizing gene annotation resources. Genome Biol. 10, (11), R130 (2009).
  39. Wu, C., Macleod, I., Su, A. I. BioGPS and MyGene.info: organizing online, gene-centric information. Nucleic Acids Res. 41, (Database issue), D561-D565 (2013).
  40. Wang, J., et al. Sequence features and chromatin structure around the genomic regions bound by 119 human transcription factors. Genome Res. 22, (9), 1798-1812 (2012).
  41. Holden, N. S., Tacon, C. E. Principles and problems of the electrophoretic mobility shift assay. J Pharmacol Toxicol Methods. 63, (1), 7-14 (2011).
  42. Miltenyi Biotec, Inc. µMACS FactorFinder Kit: Data sheet. Available from: http://www.miltenyibiotec.com/en/products-and-services/macsmolecular/protein-research/biotinylated-molecule-isolation/macs-factorfinder-kit.aspx (2014).
  43. Xu, J., Liu, H., Park, J. S., Lan, Y., Jiang, R. Osr1 acts downstream of and interacts synergistically with Six2 to maintain nephron progenitor cells during kidney organogenesis. Development. 141, (7), 1442-1452 (2014).
  44. Yang, T. -P., et al. Genevar: a database and Java application for the analysis and visualization of SNP-gene associations in eQTL studies. Bioinformatics. 26, (19), 2474-2476 (2010).
  45. Fort, A., et al. A liver enhancer in the fibrinogen gene cluster. Blood. 117, (1), 276-282 (2011).
  46. Solberg, N., Krauss, S. Luciferase assay to study the activity of a cloned promoter DNA fragment. Methods Mol Biol. 977, 65-78 (2013).
  47. Rahman, M., et al. A repressor element in the 5'-untranslated region of human Pax5 exon 1A. Gene. 263, (1-2), 59-66 (2001).
  48. Mali, P., et al. RNA-Guided Human Genome Engineering via Cas9. Science. 339, (6121), 823-826 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics