Elektroforetik Hareketlilik Assay (EMSA) ve Shift kullanarak Fonksiyonel Olmayan kodlama Genetik Türevleri için tarama DNA afinite Yağış Deneyi (DAPA)

* These authors contributed equally
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Miller, D. E., Patel, Z. H., Lu, X., Lynch, A. T., Weirauch, M. T., Kottyan, L. C. Screening for Functional Non-coding Genetic Variants Using Electrophoretic Mobility Shift Assay (EMSA) and DNA-affinity Precipitation Assay (DAPA). J. Vis. Exp. (114), e54093, doi:10.3791/54093 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Sıralama ve genom çapında ilişkilendirme çalışmaları (GWAS), aday odağı çalışmaları da dahil olmak üzere genotiplendirme dayalı çalışmalar, ve derin sıralama çalışmaları, istatistiksel bir hastalık, özellik veya fenotip ile ilişkili birçok genetik varyantlar belirledik. Erken tahminler aksine, bu varyantlar (85-93%) en kodlayıcı olmayan bölgelerinde bulunur ve protein 1,2 amino asit dizisini değiştirmezler. Bu kodlayıcı olmayan varyantları işlevini yorumlama ve ilişkili hastalık onları bağlayan biyolojik mekanizmaları belirleyen özellik veya fenotip 3-6 zorlu kanıtlanmıştır. gen ifadesinin - Biz önemli bir ara fenotip için varyantları bağlantı moleküler mekanizmaları tanımlamak için genel bir strateji geliştirdik. Bu boru hattı, özellikle genetik varyantlar bağlama TF modülasyonu belirlemek için tasarlanmıştır. Bu strateji tahmin etmek amaçlanmıştır hesaplama yaklaşımları ve moleküler biyoloji teknikleri birleştirenBiyolojik siliko aday varyantları etkileri ve doğrulamak için şu tahminler ampirik (Şekil 1).

Şekil 1
Şekil 1:.. Gri gölgeli bu yazının ilişkili detaylı protokolde yer almayan kodlayıcı olmayan genetik varyantları Adımlar analizi için stratejik yaklaşım bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Bir çok durumda, her bir istatistiksel bağlantılı varyantı ile, yüksek bir bağlantı-dengesizliği (LD) tüm bu dahil varyantların listesini genişleterek başlaması önemlidir. LD R2 istatistik 7 ile ölçülebilir iki farklı kromozom konumlarda allel rastgele olmayan federasyonu, bir ölçüsüdür. R2 lin bir ölçüsüdüriki modeli arasında bir r 2 = 1 belirten mükemmel bağlantı ile iki modeli arasındaki kage dengesizlik. yüksek LD alleller atalarının popülasyonlar arasında kromozom üzerindeki ortak ayırmak bulunmuştur. Güncel genotiplendirme dizileri insan genomu bilinen tüm varyasyonları dahil değildir. Bunun yerine, onlar insan genomunun içinde LD istismar ve LD 8 belirli bir bölgedeki diğer varyantları için temsilci olarak vekaleten oy bilinen çeşitleri bir alt kümesini içerir. anlamlı bir biyolojik etki ile nedensel varyantı-varyantı ile LD çünkü Böylece herhangi bir biyolojik sonucu olmayan bir varyant, belirli bir hastalık ile ilişkili olabilir. Prosedürel, 1,000 genomları son sürümü plink 10,11, tüm genom dernek analizi için bir açık kaynak aracı ile uyumlu ikili dosyaları içine 9 varyant çağrı dosyalarını (vcf) proje dönüştürmek için tavsiye edilir. Daha sonra, her giriş genetik va ile LD r 2> 0.8 ile diğer tüm genetik varyantlarRiant adayları olarak tespit edilebilir. Bir varyant Avrupa kökenli kişilerde, benzer kökenli konularda veri LD genişlemesi için kullanılması gerektiğini tespit edilmiştir eğer, bu üvey örneğin için uygun referans nüfusu kullanmak önemlidir.

LD genişletme genellikle aday türevleri onlarca neden olur ve sadece küçük bir fraksiyonu bir hastalık mekanizmasına katkıda bulunması olasıdır. Genellikle, deneysel bireysel bu varyantların her incelemek için olanaksız olduğunu. Varyantlar öncelik filtre olarak kamuya açık fonksiyonel genomik veri setleri binlerce kaldıraç nedenle faydalıdır. Örneğin, şifreleme konsorsiyum 12, örneğin, DNase seq 13 ATAC olarak teknolojilerden kromatin erişilebilirlik verileri ile birlikte, bağlamlarda çeşitli yonga-DİZ TFs bağlanmasını tarif eden deneyler ve ko-faktörler, ve histon işaretleri binlerce yürüttü -DİZ 14 ve FAIRE seq 15. databBöyle UCSC Genom Tarayıcı 16, Yol Haritası Epigenomics 17, Blueprint epigenom 18 Cistrome 19 ve eşleştirmek 20 olarak ases ve web sunucuları hücre tipleri ve koşullar geniş bir yelpazede bu ve diğer deneysel tekniklerle üretilen verilere ücretsiz erişim sağlar. Deneysel olarak incelemek için pek çok çeşidi vardır, bu veri, ilgili hücre ve doku tiplerinde olası düzenleyici bölgeler içinde yer alan bu öncelik için kullanılabilir. Bundan başka, bir varyantı belirli bir protein için bir çip DİZİ zirve içinde olduğu durumlarda, bu veriler, belirli bir TF (ler) olan ya da etki olabilir bağlama ko-faktör olarak potansiyel neden sağlayabilir.

Sonraki, öncelik ortaya çıkan varyantları EMSA 21,22 kullanarak bağlama tahmin genotip-bağımlı protein doğrulamak için deneysel taranmaktadır. EMSA bir indirgeyici olmayan TBE jeli üzerinde oligo geçiş değişimi ölçer. Floresan etiketli oligo kuluçkalanırNükleer lizat ve nükleer faktörlerin bağlayıcı jel üzerinde oligo hareketini geciktirir. Bu şekilde, tarama sırasında daha güçlü bir floresan sinyal olarak sunacak daha fazla nükleer faktörler bağlı olan oligo içinde. Özellikle, EMSA bağlayıcı etkilenir spesifik protein ilgili tahminlerde gerektirmez.

varyantlar tahmin düzenleyici bölgeler içinde yer alan ve farklı şekilde bağlayıcı nükleer faktörlerin yeteneğine sahip olduğu tespit edildikten sonra, hesaplama yöntemleri olan onlar etkileyebilecek bağlayıcı belirli TF (ler) tahmin etmek istihdam edilmektedir. Biz BDT-BP 23,24, RegulomeDB 25, UniProbe 26 ve Jaspar 27 kullanmayı tercih eder. Aday TF'ler belirlendikten sonra, bu öngörüler özellikle bu TFs (EMSA-Süper kaymalar ve DAPA-Batılıların) karşı antikorlar kullanılarak test edilebilir. Bir EMSA-süperkayma nükleer lizat ve oligo bir TF-özgü antikorun eklenmesini kapsamaktadır. Bir EMSA-süperkayma bir pozitif sonuç repr olduğunuEMSA bandında bir kayma ya da grubun bir kayıp olarak esented (referans 28'de incelenmiştir). Tamamlayıcı DAPA, varyant ve yan nükleotidlerini 20 baz çifti ihtiva eden bir 5'-biyotinlenmiş oligo dupleks spesifik oligolar bağlama nükleer faktörü yakalamak için uygun bir hücre tipinde (ler) den, nükleer lizatı ile inkübe edilir. Oligo dubleks nükleer faktör kompleksi manyetik sütunda mikroboncuklarm streptavidin tesbit edilir. Bağlı nükleer faktörler elüsyon 29,48 doğrudan tahsil edilir. Bağlanma tahminler daha sonra proteine ​​özel antikorlar kullanılarak bir Western blot ile tespit edilebilir. sonradan kullanılarak valide edilebilir hiçbir belirgin tahminler, ya da çok fazla tahminler, kütle-spektrometresi kullanılarak aday TFs belirlemek için bir proteomik çekirdeğe gönderilebilir DAPA deneyleri varyant aşağı açılır menüden elüsyon olduğu durumlarda, bu daha önce açıklanan yöntemleri.

articl kalanındae, genetik varyantları EMSA ve DAPA analizi için detaylı bir protokol sağlanır.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Çözümler ve Reaktiflerin hazırlanması 1.

  1. EMSA ve DAPA kullanılmak üzere özel DNA oligonükleotid probları sipariş edin.
    1. Kısa oligos tasarım spesifik olmayan bağlanma proteini azaltmak için 30, ve 17 bp'lik endojen genomik sekans ile çevrili merkezi doğrudan özel bir varyantı yer (35-45 baz uzunluğunda çifti (bp) arasında). EMSA oligo için, bir 5 'fluorofor ekleyin. DAPA oligos için, 5 'biotin etiketini ekleyin.
    2. duyu ipliği ve ters tamamlayıcı iplikçik hem sipariş edin. Alternatif olarak, sipariş dubleks (pre-tavlı) oligos. oligos adlandırırken, yerleşmiş bir referans genom üzerinde isimlendirme temel.
      Not: "Risk" ve hastalık ve projeye özel olabilir "non-riski" atama "referans" ve "referans olmayan" daha evrensel alakalı ise.
    3. oligo Girişte, kısa bir süre için 100 u arasında nihai bir konsantrasyona kadar nükleaz içermeyen su içeriği ve tekrar süspansiyon aşağı spinM. -20 ° C'de stoklarını yeniden süspanse edildi. alüminyum folyo ile sararak ışıktan bir fluorofor ile etiketlenmiş oligos koruyun.
isim Sıra
rs76562819_REF_FOR GTAATGCCTTAATGAGAGAG bir GTTAGTCATCTTCTCACTTC
rs76562819_REF_REV GAAGTGAGAAGATGACTAAC T CTCTCTCATTAAGGCATTAC
rs76562819_NONREF_FOR GTAATGCCTTAATGAGAGAG G GTTAGTCATCTTCTCACTTC
rs76562819_NONREF_REV GAAGTGAGAAGATGACTAAC CTCTCTCATTAAGGCATTAC

Tablo 1: Örnek EMSA / DAPA oligonükleotid tasarımı diferansiyel bin bir SNP test etmek"NONREF" referans dışı alel açılımı ise ding. "REF", referans alel anlamına gelir. "İÇİN" "REV" onun tamamlayıcısı gösterir iken, ileri iplikçik anlamına gelir. SNP kırmızı görülmektedir.

  1. bir son 10 mM HEPES (pH 7.9) 'ın konsantrasyonunun, 10 mM KCI ve deiyonize su içinde 0.1 mM EDTA ile sitoplazmik ekstraksiyon (CE) tamponu hazırlayın.
  2. Nükleer ekstraksiyon (NE) bir son 20 mM HEPES (pH 7.9) 'ın konsantrasyonunun, 0.4 M NaCI ve deiyonize su içinde 1 mM EDTA tampon hazırlayın.
  3. bir son 10 mM Tris (pH 7,5-8,0) konsantrasyonu, 50 mM NaCI ve deiyonize su içinde 1 mM EDTA ile tavlama tamponu hazırlayın.

Kültürlenmiş hücrelerin çekirdekleri, lizat 2. Hazırlık

Not: Bu deneysel protokol B limfoblastoid hücre çizgileri kullanılarak optimize edilmiştir, ancak birkaç diğer ilgisiz yapışkan / süspansiyon hücre hatları test edilmiş ve evrensel olarak çalışır.

  1. Cultu2 mM L-glutamin,% 10 fetal sığır serumu ve penisilin, 100 ünite / ml streptomisin, 100 ug / ml ihtiva eden 1x antibiyotik antimikotik ve 250 ng Roswell Park Memorial Institute (RPMI) 1640 B-lenfoblastoid hücreleri, yeniden amfoterisin B / ml
    1. 200,000-500,000 canlı hücre / ml 'lik bir mesafeden tohum ve delikli veya gevşek kapaklı dik olarak% 5 karbon dioksit ile 37 ° C'de şişeler inkübe edin.
      Not: 1.000.000 hücre / ml ulaştığında B-lenfoblastoid hücrelerin büyümesi yavaşlar. yukarı pipetleme ve birkaç kez aşağı hücre patlamalar break up ve hızlı bir büyüme oranını korumak için 200,000-500,000 hücre / ml hücreleri dönün.
  2. 5 dakika boyunca, 4 ° C'de, 300 xg durması ve aspirasyonla PBS kaldırmak, iki kez 10 ml buz soğukluğundaki fosfat tamponlu salin (PBS) ile kültürlenen hücreler yıkanır.
  3. 10 7 hücre başına soğuk PBS 1 ml buz gibi bir hemositometre ve tekrar süspansiyon pelet kullanarak hücreleri saymak.
    Not: Örneğin, 2 x 10 7 lize halinde </ Sup> hücreler, 2 ml PBS içinde tekrar süspansiyon.
  4. Kısım 1.5 ml mikrosantrifüj tüplerine 1 mi, her boru PBS içinde 10 7 hücre içerecek şekilde. PBS kapalı 2 dakika 4 ° C ve aspirat için 3300 xg'de santrifüj.
  5. Kullanmak CE tampon çalışma stok 1 mM ditiyotreitol (DTT), 1 x fosfataz inhibitörü ve 1 x proteaz inhibitörü ilave önce. Tekrar süspansiyon hücre CE tampon 400 ul pelet ve 15 dakika boyunca buz üzerinde inkübe edilir.
  6. % 10 Nonidet P-40 25 ul ekleyin ve pipetleme karıştırın. 4 ° C, 3 dakika boyunca maksimum hızda santrifüj. Durusu ve supernatant atın.
  7. Kullanmak NE tampon çalışma stok 1 mM DTT, 1 x fosfataz inhibitörü ve 1 x proteaz inhibitörü ilave önce. Tekrar süspansiyon hücre NE tamponu 30 ul pelet ve vorteks karıştırın.
  8. tüp rotator veya 10 dakika buz üzerinde 4 ° C'de inkübe edin. Santrifüj 2 dakika 4 ° C 3300 xg.
  9. En saklamadan önce berrak süpernatant (nükleer lizat) ve kısım toplayın -806 C proteini düşebilir birden donma-çözülme döngüleri önlemek için. Bichoninic asit deneyi (BCA) 31 kullanarak protein konsantrasyonunu ölçmek için bir 10 ul tablet bırakın.

3. Elektroforetik Devingenlik Değişimi Analizi (EMSA)

  1. Oligo Çalışma Stok ve EMSA Jel hazırlayın.
    1. oligos dubleks sipariş olsaydı, 100 mcM stok çözülme ve 1 sulandırmak: 2.000 tavlama tamponunda 50 nM çalışma stok elde etmek.
    2. oligo tek şeritli sipariş edilen ise, 100 uM stokları çözünmesi ve 100 nM çalışma stokları elde etmek için tavlama tamponu içinde 1:10 oranında seyreltin. mikrosantrifüj tüpü içinde birbirleri ile 100 nM tamamlayıcı zinciri çözeltisi 100 ul birleştirin.
      1. 5 dakika boyunca 95 ° C'de bir ısı bloğunda yerleştirin. Isı bloğu kapatın ve oligo yavaş yavaş kullanımdan önce en az bir saat boyunca oda sıcaklığına kadar soğumasını bekleyin.
    3. EMSA Gel Öncesi çalıştırın.
      1. bir ön döküm% 6 T slaytı kaldırmakjel BE ve kuyulardan herhangi bir tampon kaldırmak için deiyonize suyun altında birkaç kez durulayın. iyonu giderilmiş su, 950 ml 10x TBE, 50 ml ekleyerek 0.5x TBE tamponu 1 L hazırlayın.
      2. jel elektroforezi cihazı monte edin ve 0.5x TBE tamponu ile iç odasını doldurarak sızıntı olup olmadığını kontrol edin. tampon, dış odasına sızar ise, dış bölmesini şekilde kabaca üçte ikisi doldurun.
      3. 60 dakika boyunca 100 V'ta jel ön çalıştırın.
      4. 0.5x TBE tamponu 200 ul her iyi yıkayın.
  2. Tampon Master Mix Cilt hazırlayın.
    1. 100 mM Tris, 500 mM KCI, 10 mM DTT nihai bir konsantrasyona sahip bağlayıcı tampon 10x hazırlanması; iyonu giderilmiş su içinde, pH 7.5 olarak değiştirilmişti.
    2. Mikrosantrifüj tüpü içinde, bütün reaksiyonlar (Tablo 2 ise 10 ul 10x bağlanma tamponu, 10 ul DTT / polisorbat, 5 ul Poli D (IC) ve 2.5 ul somon sperm DNA) ortak olan maddeler arasında meydana gelen bir ana karışımı oluşturur. ek bir% 10 hazırlayınpipetleme nedeniyle hacim kaybı hesaba.
reaktif Final Kons. 1. rxn 2. rxn 3. rxn 4. rxn
Ultra Saf Su 20 ul hacme. 13.5 ul 11.98 ul 13.5μl 11.98 ul
10x Bağlama Tamponu 1x 2 ul 2 ul 2 ul 2 ul
DTT / TW-20 1x 2 ul 2 ul 2 ul 2 ul
Salmon sperm DNA'sı 500 ng / | il 0.5 ul 0.5 ul 0.5 ul 0.5 ul
1 ug / ul Poli d (IC) 1 ug 1 ul 1 ul 1 ul 1 ul
Nükleer Ekstrakt (5.26 ug / ul), 8 ug - 1.52 ul - 1.52 ul
NE Tampon 1.52 ul - 1.52 ul -
Referans alel oligo 50 fmol 1 ul 1 ul - -
Sigara Referans alel oligo 50 fmol - - 1 ul 1 ul

Tablo 2: Örnek EMSA reaksiyon setus. tablo genotip-bağımlı belirli bir SNP için TFs bağlanmasının olduğunu hipotezini test etmek için bir örnek EMSA göstermektedir.

  1. gibi tüm reaktifler ilave edildikten sonra nihai hacim 20 ul olacak her mikrosantrifüj tüpüne nükleaz içermeyen su ilave edilir.
  2. Her mikrosantrifüj tüp ana karışımı uygun miktarda (5.5 ul) ekleyin.
  3. Uygun mikrosantrifüj tüpler nükleer lizat 8 mikrogram ekleyin. Nükleer negatif kontroller olarak ekstraktı (Tablo 2, Rxn 1. ve Rxn # 3) olmadan oligo içeren tüpler ekleyin.
    Not: reaksiyon başına lizat optimal miktarı titrasyonu ile deneysel olarak tespit edilmelidir. Genel olarak, lizat 2-10 ug bir dizi titre yeterlidir.
  4. Uygun mikrosantrifüj tüplerine oligo 50 fmol ekleyin. Flick karıştırın ve kısaca tüpün dibine içeriğini döndürmek için. Oda sıcaklığında 20 dakika boyunca inkübe edin.
    Not: Eğer attemptive bir süper ng oligo ilavesinden önce oda sıcaklığında 20 dakika boyunca antikor ile lizat karışımı inkübe edin. En iyi sonuç için bir ChIP dereceli antikor 1 mikrogram kullanılması tavsiye edilir.
  5. Her mikrosantrifüj tüpüne 10x Turuncu Yükleme Dye 2 ul ekleyin. yukarı pipet ve aşağı karıştırın.
  6. Ayrı bir kuyuya her örnek kovma sonra yukarı ve aşağı pipetleme karıştırmak ve öncesi işletilen% 6 TBE jel içine örnekleri yükleyin. turuncu boya jel yol aşağı 3/4 2/3 göç kadar 80 V jel çalıştırın. Bu, yaklaşık 60-75 dakika sürer.
  7. Bir jel bıçakla açık meraklı plastik kaset jel çıkarın ve kurumasını tutmak için% 0.5 TBE tamponu ile bir kapta jel yerleştirin.
  8. Görüntüyü bozacak herhangi bir kabarcıkları veya kirletici ortadan kaldırmak için emin olmak, kızılötesi ve chemilüminesan görüntüleme sistemi yüzeyinde jel yerleştirin.
  9. tarama sistemi yazılımı kullanarak, "Acquire" sekmesini tıklayınve daha sonra jel tarayıcının yüzeyinde bulunduğu karşılık gelen alanı çevresinde bir kutu çizmek için "Yeni Çiz" seçeneğini seçin.
  10. "Edinme" sekmesinin "Kanallar" bölümünde, oligo üzerinde florofor etiketinin dalga boyuna karşılık gelen kanalı seçin. "Tarayıcı" bölümünde, bir düşük kaliteli önizleme taraması almak için "önizleme" butonuna tıklayınız. jel kısmına aşağı edinilen Önizleme görüntüsünü çevreleyen mavi kutu sürükleyerek tarama alanını ayarlayın yansıması.
    Not: Örneğin, 700 nm florofor ile işaretlenmiş oligos kullanıyorsanız, "700 nm" kanal taramadan önce seçili olduğundan emin olun.
  11. "Tarama Kontroller" bölümünde, "84 uM" çözünürlük seçeneği ve "Orta" kalite seçeneği seçin. jel kalınlığının yarısına ofset odağı ayarlayın. Not: Örneğin, 1 mm'lik bir jel ofset 0.5 mm'lik bir odak kullanmak.
  12. "Tarayıcı" bölümünde, b "Başlat" a tıklayınTarama Egin.
    Not: Tarama sırasında, parlaklık, kontrast ve renk düzeni genellikle tarama sisteminin üreticisine bağlı olarak manuel olarak ayarlanabilir.
  13. Tarama bittikten sonra, "Resim" sekmesini seçin ve yönünü düzeltmek için "oluşturma" bölümünde "Döndür veya çevirin" tıklayın. Ana menüde "Export" tıklayarak görüntü dosyasını kaydedin ve ardından "Tek Resim Görünümü."

4. DNA çekimi saflaştırma deneyi (DAPA)

  1. 5 uM Oligo Çalışma Stokta hazırlanması.
    1. oligos dubleks sipariş olsaydı, 100 uM stok çözülme ve 5 uM çalışma stok elde etmek için tavlama tamponunda 1:20 sulandırmak.
    2. oligo tek iplikli sipariş olsaydı, 100 uM stokları çözülme ve stokları çalışan 10 mcM ulaşmak için tavlama tamponunda 1:10 sulandırmak. birbirleriyle 10 uM tamamlayıcı zincirlerinde 10 ul birleştirin. 95 ° C de bir ısı bloğunda yerleştirin5 dakika. Isı bloğu kapatın ve oligo yavaş yavaş kullanımdan önce oda sıcaklığına kadar soğumasını bekleyin.
  2. başlamadan önce, oda sıcaklığında bağlanma tamponu, düşük sıkılık yıkama tamponu, yüksek sertlikte yıkama tamponu ve elüsyon tamponu ısıtın.
    Not: 50 ng nihai bir konsantrasyon / ml poli D (IC) 'oligo proteinlerin potansiyel spesifik olmayan bağlanmaların azaltmak için bağlama tamponu düşük sıkılık yıkama tamponu ve yüksek sertlikte yıkama tamponu ilave edilebilir.
  3. Her varyant için bağlayıcı karışımlar hazırlayın.
    1. bağlama tamponu 2 hacim nükleer lizat 1 hacim karıştırın.
      Not: lizat gerekli miktar bağlı TF'lerin bolluğu değişen deneysel olarak tespit edilmelidir. Sütun başına nükleer lizat ug 100-250 arasında kullanılması çoğu durumda yeterlidir.
    2. 1x fosfataz inhibitörü, 1x proteaz inhibitörü ve 1x bağlayıcı arttırıcı (isteğe bağlı) ekleyin ve tüpü birkaç kez hafifçe vurarak karıştırın.
      Not: 100x bağlayıcıgüçlendirici, 750 mM MgCl2 ve 300 mM ZnCI2 oluşur. DNA TF bağlayıcı kofaktör veya indirgeyici ajanlar bağlıdır eğer bağlayıcı geliştirici ekleyin. Bu bilgi bilinmiyorsa, bağlanma arttırıcı ekleyin.
    3. her bir ilgili bağlama karışımına 5 uM biyotinlenmiş yakalama DNA (50 mmol) 10 ul ekle. Oda sıcaklığında 20 dakika boyunca inkübe edin.
      Not: İnkübasyon süresi ve sıcaklık, TF bağlı olarak değişebilir. uygun değerler deneysel olarak tespit edilmesi gerekmektedir.
  4. streptavidin mikro boncuklar 100 ul ekleyin. Oda sıcaklığında 10 dakika boyunca inkübe edin.
  5. Her oligo probu test edilen, manyetik ayırıcı bir bağlayıcı sütun yerleştirin. Her bağlayıcı sütununun altında doğrudan ependorf tüp yerleştirin ve sütun durulama bağlayıcı tampon 100 ul geçerlidir.
  6. ayrı sütunlar halinde her bağlayıcı karışımın içeriğini pipet ve sıvı mikrosantrifüj içine sütun aracılığıyla tamamen akmasına izinDevam etmeden önce tüp. bağlayıcı karışımında kullanılan varyant oligo sütunları etiket emin olun. akış örnekleri etiket ve düşük sertlikteki yıkar toplamak için yeni mikrosantrifüj tüpler ile değiştirin.
  7. sütununa düşük sertlikteki yıkama tamponu 100 ul uygulayın; Kolon rezervuar boşalana kadar bekleyin. yıkama 4x tekrarlayın. Düşük sıkılık yıkama örnekleri etiket ve yüksek sertlikte yıkar toplamak için yeni mikrosantrifüj tüpler ile değiştirin.
  8. sütununa yüksek sertlikteki yıkama tamponu 100 ul uygulayın; Kolon rezervuar boşalana kadar bekleyin. yıkama 4x tekrarlayın. yüksek sertlikteki yıkama örnekleri etiket ve ön elüsyon toplamak için yeni mikrosantrifüj tüpler ile değiştirin.
  9. sütun özgü elüsyon tamponu 30 ul ilave edin ve 5 dakika boyunca bekletin. Ön yıkama örnekleri Etiket ve elüsyon toplamak için yeni mikrosantrifüj tüpler ile değiştirin.
    Not: Bu ilişkili protein elüt etmez; geri kalan, yüksek sertlikteki yıkamalarsütunun üzerinden tamponu ve elüsyon verimliliğini en üst düzeye çıkarmak için yıkama tamponu ile değiştirir.
  10. bağlı TFs Zehir için ek 50 ul yerli elüsyon tamponu ekleyin. daha yüksek bir verim daha az konsantre edilmiş, ayrılmış malzeme için, ana elüsyon tamponu ek bir 50 ul ve akış-through toplar.
    Not: bağlı TFs 32 kimliğini belirlemek için kütle spektrometresi ile elüsyon örnekleri analiz edin. Daha sonra, bir Western Blot 33 tarafından takip sodyum dodesil sülfit poliakrilamid jel elektroforezi (SDS-PAGE) ile proteomik sonuçları doğrulamak. kütle spektrometrisi mevcut değilse, genotip bağımlı bağlanma gösteren protein (ler) boyutunu belirlemek için yerine Western blot standart teknik kullanılarak gümüş leke çalıştırın. Girişte detaylı hesaplama yaklaşımları tahmin TFs listesini daraltmak için bu bilgileri kullanabilirsiniz.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

lizat kalitesi özelliği açısından bir EMSA veya DAPA ve değişkenliği yaparken Bu bölümde, ne temsilcisi sonuçları verilmektedir. Örneğin, birden çok kez dondurma ve çözme, protein örnekleri denatürasyon neden olabilir öne sürülmüştür. Bu "dondurma-çözme" döngü bağlamında EMSA analizi tekrarlanabilirliğini incelemek için, bir gen varyant farklı iki adet 35 bp'lik oligo belirtilen miktarda çözülmüş ve yeniden dondurulmuştur nükleer lizat tek bir toplu ile inkübe edildi . zamanların Şekil 2 5 kez bu belirli B-lenfosit nükleer özü donma ve çözülme proteinlerinin bütünlüğünü görünüşte hiçbir etkisinin olmadığını göstermektedir; Ancak, nükleer protein stabilitesi örnekleri göre değişiklik gösterir ve bu şekilde kullanılan her bir hücre hattı üzerinde test edilmelidir. Farklı parti HAZIRLIK gelen varyasyon da mümkündürNükleer lizatları ations. bu varyasyon nedeniyle liziz hücre kanalı numarası veya diğer faktörler önce hücre döngüsünün aşamasına olsun, gerçek sonuçları elde etmek için lizat farklı gruplar kullanılarak EMSA sonuçları kopya önemlidir.

Buna ek olarak, EMSA için sinyal-gürültü oranı optimize etmek için önemlidir. Bu önemli bir değişken oligo konsantrasyonu. Oligo (5-300 fmol) miktarı oligos farklı miktarlarda sinyalini (Şekil 3) nasıl etkilediğini değerlendirmek için titre edildi. kadar oligo 100 fmol bandın yoğunluğunda bir artış gözlendi. Bu noktadan sonra, 100 fmol düşündüren sinyal platolar bu EMSA reaksiyonu için en uygun oligo miktarıdır.

Son olarak, bu yazıda anlatılan stratejisinin bir parçası kullanarak yayınlanmış çalışmaların birinde bir temsilci şekil (Şekil 4) sağlanır. thÇalışma 34 olduğu için, gösterdi STAT1, sinerjistik aktivasyonu ve 35 kompleks bir Tip 1 IFN reseptörü aşağı doğru gen ekspresyonunun inhibisyonu hem de katılan bir transkripsiyon faktörü bağlanma rs6590330 artar lupusa ilgili risk alel. Bu örnekte, STAT1 ilk tandem kütle spektroskopisi (DAPA-MS) bağlanmış yüksek performanslı sıvı kromatografisi kullanılarak proteomik analizi ile takip DAPA ile teşhis edildi. Bir DAPA-Western Blot proteomik analiz (STAT1) den belirlenen TF teyit ve STAT1 fosforile formu olmayan referans (lupus riskli) oligo bağlama olduğunu teyit etmek için kullanıldı. Bu şekil, bu strateji, çeşitli tahliller, bir kodlayıcı olmayan varyant transkripsiyon faktörünün bağlama diferansiyel belirlemek için nasıl kullanılabileceğini göstermektedir.

şekil 2
Şekil 2: tekrarlanabilirlik Analizive EMSA sonuçları dondurma-eritme döngüsü sonuçları. genetik varyantının referans (R) ya da olmayan bir referans (NR) alel ihtiva eden Oligo dondurma ve eritme döngüsünden sonra birden lizat aynı hazırlık araştırmak için kullanıldı. (Lys: Lizat). Her şerit jel (mavi ok) altındaki serbest prob içerir. oligo TFS bağlanması jeli (kırmızı ok) üst yarısında bir bant olarak görülmektedir. Jel (dirsek bakınız) alt yarısında bulunan bantlar olmayan özeldir. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 3,
Şekil 3:., Farklı oligo konsantrasyonlarının etkisi araştırılmıştır oligo çeşitli konsantrasyonları, nükleer lizat tek bir preparat araştırmak için kullanıldı. Fluorescent sinyal oligo sınırlayıcı reaktif olduğunu gösteren daha yüksek miktarda, oligo ile artar. Protein miktarı sınırlayıcı reaktif hale 100-300 fmol yolları, sinyal yaylaları. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 4,
Şekil 4:. Rs6590330 lupus riskli alel DAPA-MS STAT1 ve daha yüksek riski olmayan allel ile karşılaştırıldığında rs6590330 riski alel ihtiva eden oligolar bağlanma pSTAT1 sergi ile değerlendirilen STAT1, bağlama artırır. Biotin-etiketli oligo Epstein-Barr virüsü ile dönüştürülmüş B-hücresi nükleer ekstre ile inkübe edilmiştir. oligo bağlanmış proteinler DAPA kullanılarak ele geçirildi. Proteinler daha sonra anti-pSTAT1 kullanılarak jel elektroforezi, SDS-poliakrilamit ile ayrılmış ve tespit edildi(A) veya anti-STAT1 (B). M: Marker. NR: rs6590330 olmayan risk alel içeren oligo; R: rs6590330 riski alel ihtiva eden oligo; Mutant: rs6590330 aşağı doğru bağlama sitesine kesintiye putatif STAT1 içeren oligo; Hücre lisatı: B hücrelerinden çekirdek ekstresi. bandın nispi yoğunlukları her bir bant aşağıda belirtilmiştir. Sonuçlar, dört deneyi temsil etmektedir; Tüm deneyler 2/4 deneylerde hiçbir STAT1 olarak, risk alel ile prob bağlayıcı STAT1 artışı gözlenmiştir ya da her ikisi risk oligo immünoçökeltme saptandı ise pSTAT1 olmayan risk oligo immünoçökeltme saptanmadı. Bu rakam referans 34'ten modifiye edilmiştir. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

sıralama ve genotiplendirme teknolojilerindeki gelişmeler büyük ölçüde hastalıkla ilgili genetik varyantları tanımlamak için kapasitemizi gelişmiş olmasına rağmen, bu varyantlar etkilenen fonksiyonel mekanizmaları anlamak için yeteneğimizi kalıyor. Sorunun ana kaynağı olasılıkla gen ekspresyonunu kontrol zor-arası tahmin mekanizmaları etkileyen ilgili kodlama genomunun bölgeler birçok hastalıkla ilişkili varyantları n yer olmasıdır. Burada, biz büyük olasılıkla çok kodlayıcı olmayan varyantları işlevine katkıda olayları bağlama genotip-bağımlı TF belirlenmesi için EMSA ve DAPA teknikleri, değerli moleküler araçlar dayalı bir protokol mevcut. Bu iki teknik geçmişte yaygın olarak kullanılmış olmasına rağmen, bunlar sadece en son bağlanma TF genetik varyant analizi için adapte edilmiştir. TFs ötesinde, EMSA da protokol 36 sadece küçük ayarlamalar ile, RNA bağlayıcı proteinlerin genetik varyantları etkisini analiz etmek için kullanılabilir.

. "Ove_content> burada sunulan protokol gerçekleştirmek için basit ve kolay, ama yine de, bazı kısımlarda önceden deneme First ek hususlar gerektirir, titiz istatistiksel analizler gerçekleştirerek değerlendirilmek üzere çeşitlerinin bir başlangıç ​​listesini oluşturmak için önemli olan bu adımda bir hata. birçok varyantlar hastalık riskine katkıda bulunmadan nükleer lizat diferansiyel bağlamak olabilir, tüm alt analizler rayından olabilir. Ayrıca, ilgili hücre tiplerinde yapılan işlevsel genomik verilerin kullanımı çok önemlidir, gibi alakasız hücre tipleri bağlayıcı yalancı pozitif TF üretilmesine yol açabilir Şu anda, en yaygın olarak kullanılan fonksiyonel genomik kaynakları kodlayan 12 ve yol haritası Epigenomics 17 içerir. tahminleri. bilgiye, yararlı bir hastalık ile ilgili hücre tiplerinde gen ekspresyon düzeyleri ile ilgili, örneğin ImmGen 37, BioGPS 38 gibi diğer kaynaklardan elde edilebilir 39 ve SNPsea 20. Örneğin, bu gibi resourCES sadece ilgili hücre tipinde ifade edilir, bu TFs içerir TF bağlayıcı tahminler filtre kullanılabilir.

Böyle EMSA ve DAPA olarak in vitro deneylerin uyarılar dikkate almak da önemlidir. Özellikle, yanlış negatif azaltmak için ayrı nükleer lizat hazırlıkları ile deneyler tekrarlamak gereklidir. Ayrıca, başarılı bir EMSA-süperkayma antikoru bloke TF DNA bağlanma alanı, burada antikor TF bağlanan olan EMSA bandında bir kayma, ya da grubun bir kaybı olarak ortaya çıkabilir. Farklı TF yönelik bir izotip kontrol antikoru ve / veya bir antikorun içeren iki senaryoda, süperkayma özgüllüğünü teyit yararlıdır. ve bir süper gerçekleştirirken Diğer bir faktör DTT / reaksiyonda polisorbat dahil olup olmadığıdır. DTT / polisorbat ilişkisiz DNA kantitatif olarak daha doğru izin yükleme boyası stabilize; Bununla birlikte, aynı zamanda, antikorların disülfit bağlarının sebep azaltabilirEMSA-süperkayma başarısızlıkla ing. Bir kompleks süperkayma çalışırken ve DTT / polisorbat olmadan reaksiyonları denemek için tavsiye edilir. Poli d (IC) ve reaksiyon başına somon sperm DNA optimal miktarı titrasyonu ile deneysel olarak tespit edilmelidir. Genel olarak, 1-6 ug Poli d (IC) ve 50-500 ng salmon sperm bir dizi titre yeterlidir. DAPA için yararlı bir pozitif kontrol (örneğin CIS-BP 23 veya Factorbook 40 olarak veritabanlarından elde edilmiş) iyi olarak, özelliği bağlanma motifi ile tf için bir konsensüs sekansı kullanılarak ve TF özgü bir antikor ile Western çalışan içerir. Her iki analiz için bir karıştırılmış oligo herhangi bir ilgi oligo özgü bağlanma gözlenmiştir olduğunu göstermek için kullanılabilir.

Hem EMSA ve DAPA teknikleri deneysel sınırlamaları vardır. Örneğin, bir TF ve DNA arasındaki bağlanma afinitesi, tampon koşulları, büyük ölçüde etkilenir. İdeal olarak, tampon koşulları endojen conditio taklit etmelidirÇekirdeğin NS optimum bağlanmasını sağlamak için. EMSA için, uygun olmayan tampon koşulları zayıf bant veya tamamen bandın kaybına neden olabilir. DAPA için, ideal olmayan koşullar TF (ler), yıkama adımları sırasında elüt neden olabilir. Bu nedenle, her deney, belirli tampon koşulları altında bağlama TF-oligo tanımlamada etkilidir. en evrensel kullanışlı tampon koşulları yukarıdaki protokol sunulmuştur. İkinci sınırlama EMSA ve DAPA yöntemleri deneysel sonuçlar hangi aracılığıyla TF'ler bağlama oligos için mekanizmalar hakkında çok az bilgi sağlamaktır. TF'ler Oligos doğrudan bağlanabilen ya da diğer faktörler tarafından işe alınması. Buna göre, TF oligos bağlamak ve deneysel bu tahminleri doğrulamak nasıl tahmin etmek hesaplama oligo dizileri analiz etmek önemlidir. Örneğin, spesifik bağlanma sekansı mutasyona uğratılabilir veya bir bağlanma partneri deneysel tükenmiş olabilir. Son olarak, kullanılan ekstresi miktarı her deney t titre edilmesi gerekmektediro En iyi sonuçları elde. Çok fazla lizat bağlayıcı TF-oligo doyurabilecek ve risk ve non-risk allelleri arasındaki bağlanmayı herhangi diferansiyeli gizleyebilir. Ek sorun giderme için, okuyucu çeşitli mükemmel yorum ve yöntem el yazmaları 30,41,42 başvurabilirsiniz.

Burada tarif edilen deneyler ilave olarak, bundan başka, canlı hücreler (Şekil 1, alt) içindeki varyantları da çalışma mevcuttur, in vivo deneylerin çeşitli vardır. Diferansiyel hücreler 34 canlı çoğaltılır in vitro deneylerde gözlemlenen bağlanma ise alel-spesifik kantitatif polimeraz zincir reaksiyonları ile takip kromatin immünopresipitasyon çalışmaları üstlenmiş olabilir (-qPCR ChIP) tanımlamak için. ilgi konusu bir varyant için heterozigoz hücreleri kullanılır, örneğin, qPCR deneyleri TF imüno kromatin iki allel arasında zenginleştirme farkı tespit edebilir. ChIP özellikli çip dereceli antikorlar gerektirir; howeveChIP dereceli TF antikorları kullanılamaz eğer r, bir bayrak-etiketli TF hücreleri transfecting etkili bir alternatif 43'tür. Ayrıca, hedef gen ifadesi üzerinde bağlayıcı diferansiyel etkisi, Genevar 44 tarafından derlenen gibi genotip hücreleri veya kamuya açık kaynaklardan yerel toplanan ifade verilerini kullanarak ilgili hücre tiplerinde ifade niceliksel lokus (eQTL) analizi ile araştırılabilir. Lusiferaz raportör tahlilleri de protein bağlanması gen ifadesini etkileyen diferansiyel derecesini araştırmak için kullanılabilir. Bu gibi deneyler, bağımsız varyantları, bir promotör, güçlendirici veya represör bölgesinde 45-47 bulunan bağımsız olarak çalışmak üzere modifiye edilebilir. Son olarak, bu CRISPR / Cas9 48 olarak genom düzenleme teknolojileri, Nedenselliği teyit için hayati önem taşımaktadır tek varyant, sadece farklı hücre hatları oluşturmak için de kullanılabilir. Bu tür teknolojiler esasen betw gözlenen deneysel varyans azaltabilirFonksiyonel okumalar analiz gen ekspresyonu ya da başka bir hastalığın, ara fenotipi için, genetik olarak farklı bireylerden türetilen een hücre çizgileri düzenlenmiş hücre hattında gerçekleştirildi ve non-düzenlenmiş hücre çizgileri ile karşılaştırılabilir.

sunulan stratejinin ana avantajı bağlayıcı genotip-bağımlı DF kolay ve hızlı algılama olanak tanımasıdır. anahtar genetik varyantları öncelik olarak, başka deneyler biyolojik etkisini belirlemek ve Nedenselliği göstermek için tasarlanabilir. Özellikle, bu protokol GWAS veya ince haritalama tespit edilen herhangi bir hastalık veya fenotip bağlantılı varyantı araştırmak için uygulanabilir. genetik veri ve istatistiki ilişkili genetik varyantları listelerinin büyük bir büyüyen hazinesi zaten mevcuttur. Çoğu durumda, bu varyantların istatistiksel bir ilişki sürüş biyolojik mekanizmaları açık değildir. Bu teklifte belirtilen strateji olmayan birçok kodlama Disea doğru fonksiyonel yorumlanması için izin verirvaryantları se-ilişkili. Bu tür bir bilgi herhangi bir genetik temelli bir hastalık sürüş moleküler mekanizmaları tam aydınlatılması için hayati önem taşımaktadır.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa hiçbir şey yok.

Materials

Name Company Catalog Number Comments
Custom DNA Oligonucleotides Integrated DNA Technologies http://www.idtdna.com/site/order/oligoentry
Potassium Chloride Fisher Scientific BP366-500 KCl, for CE buffer
HEPES (1 M) Fisher Scientific 15630-080 For CE and NE buffer
EDTA (0.5M), pH 8.0 Life Technologies R1021 For CE, NE, and annealing buffer
Sodium Chloride Fisher Scientific BP358-1 NaCl, for NE buffer
Tris-HCl (1M), pH 8.0 Invitrogen BP1756-100 For annealing buffer
Phosphate Buffered Saline (1x) Fisher Scientific MT21040CM PBS, for cell wash
DL-Dithiothreitol solution (1 M) Sigma 646563 Reducing agent
Protease Inhibitor Cocktail Thermo Scientific 87786 Prevents catabolism of TFs
Phosphatase Inhibitor Cocktail  Thermo Scientific 78420 Prevents dephosphorylation of TFs
Nonidet P-40 Substitute IBI Scientific IB01140 NP-40, for nuclear extraction
BCA Protein Assay Kit Thermo Scientific 23225 For measuring protein concentration
Odyssey EMSA Buffer Kit Licor 829-07910 Contains all necessary EMSA buffers
TBE Gels, 6%, 12 Wells Invitrogen EC6265BOX For EMSA
TBE Buffer (10x) Thermo Scientific B52 For EMSA
FactorFinder Starting Kit Miltenyi Biotec 130-092-318 Contains all necessary DAPA buffers
Licor Odyssey CLx Licor Recommended scanner for DAPA/EMSA
Antibiotic-Antimycotic Gibco 15240-062 Contains 10,000 units/ml of penicillin, 10,000 µg/ml of streptomycin, and 25 µg/ml of Fungizone® Antimycotic
Fetal Bovine Serum Gibco 26140-079 FBS, for culture media
RPMI 1640 Medium Gibco 22400-071 Contains L-glutamine and 25 mM HEPES

DOWNLOAD MATERIALS LIST

References

  1. Hindorff, L. A., et al. Potential etiologic and functional implications of genome-wide association loci for human diseases and traits. Proc Natl Acad Sci U S A. 106, (23), 9362-9367 (2009).
  2. Maurano, M. T., et al. Systematic localization of common disease-associated variation in regulatory DNA. Science. 337, (6099), 1190-1195 (2012).
  3. Ward, L. D., Kellis, M. Interpreting noncoding genetic variation in complex traits and human disease. Nat Biotechnol. 30, (11), 1095-1106 (2012).
  4. Paul, D. S., Soranzo, N., Beck, S. Functional interpretation of non-coding sequence variation: concepts and challenges. Bioessays. 36, (2), 191-199 (2014).
  5. Zhang, F., Lupski, J. R. Non-coding genetic variants in human disease. Hum Mol Genet. (2015).
  6. Lee, T. I., Young, R. A. Transcriptional regulation and its misregulation in disease. Cell. 152, (6), 1237-1251 (2013).
  7. Slatkin, M. Linkage disequilibrium--understanding the evolutionary past and mapping the medical future. Nat Rev Genet. 9, (6), 477-485 (2008).
  8. Bush, W. S., Moore, J. H. Chapter 11: Genome-wide association studies. PLoS Comput Biol. 8, (12), e1002822 (2012).
  9. 1000 Genomes Project Consortium. An integrated map of genetic variation from 1,092 human genomes. Nature. 491, (7422), 56-65 (2012).
  10. Chang, C. C., et al. Second-generation PLINK: rising to the challenge of larger and richer datasets. Gigascience. 4, 7 (2015).
  11. Purcell, S., et al. PLINK: a tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet. 81, (3), 559-575 (2007).
  12. ENCODE Project Consortium. An integrated encyclopedia of DNA elements in the human genome. Nature. 489, (7414), 57-74 (2012).
  13. Crawford, G. E., et al. Genome-wide mapping of DNase hypersensitive sites using massively parallel signature sequencing (MPSS). Genome Res. 16, (1), 123-131 (2006).
  14. Buenrostro, J. D., Giresi, P. G., Zaba, L. C., Chang, H. Y., Greenleaf, W. J. Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nat Methods. 10, (12), 1213-1218 (2013).
  15. Giresi, P. G., Kim, J., McDaniell, R. M., Iyer, V. R., Lieb, J. D. FAIRE Formaldehyde-Assisted Isolation of Regulatory Elements) isolates active regulatory elements from human chromatin. Genome Res. 17, (6), 877-885 (2007).
  16. Kent, W. J., et al. The human genome browser at UCSC. Genome Res. 12, (6), 996-1006 (2002).
  17. Roadmap Epigenomics Consortium. Integrative analysis of 111 reference human epigenomes. Nature. 518, (7539), 317-330 (2015).
  18. Martens, J. H., Stunnenberg, H. G. BLUEPRINT: mapping human blood cell epigenomes. Haematologica. 98, (10), 1487-1489 (2013).
  19. Liu, T., et al. Cistrome: an integrative platform for transcriptional regulation studies. Genome Biol. 12, (8), R83 (2011).
  20. Griffon, A., et al. Integrative analysis of public ChIP-seq experiments reveals a complex multi-cell regulatory landscape. Nucleic Acids Res. 43, (4), e27 (2015).
  21. Staudt, L. M., et al. A lymphoid-specific protein binding to the octamer motif of immunoglobulin genes. Nature. 323, (6089), 640-643 (1986).
  22. Singh, H., Sen, R., Baltimore, D., Sharp, P. A. A nuclear factor that binds to a conserved sequence motif in transcriptional control elements of immunoglobulin genes. Nature. 319, (6049), 154-158 (1986).
  23. Weirauch, M. T., et al. Determination and inference of eukaryotic transcription factor sequence specificity. Cell. 158, (6), 1431-1443 (2014).
  24. Ward, L. D., Kellis, M. HaploReg: a resource for exploring chromatin states, conservation, and regulatory motif alterations within sets of genetically linked variants. Nucleic Acids Res. 40, (Database issue), D930-D934 (2012).
  25. Boyle, A. P., et al. Annotation of functional variation in personal genomes using RegulomeDB. Genome Res. 22, (9), 1790-1797 (2012).
  26. Hume, M. A., Barrera, L. A., Gisselbrecht, S. S., Bulyk, M. L. UniPROBE, update 2015: new tools and content for the online database of protein-binding microarray data on protein-DNA interactions. Nucleic Acids Res. 43, (Database issue), D117-D122 (2015).
  27. Mathelier, A., et al. JASPAR 2014: an extensively expanded and updated open-access database of transcription factor binding profiles. Nucleic Acids Res. 42, (Database issue), 142-147 (2014).
  28. Smith, M. F. Jr, Delbary-Gossart, S. Electrophoretic Mobility Shift Assay (EMSA). Methods Mol Med. 50, 249-257 (2001).
  29. Franza, B. R., Josephs, S. F., Gilman, M. Z., Ryan, W., Clarkson, B. Characterization of cellular proteins recognizing the HIV enhancer using a microscale DNA-affinity precipitation assay. Nature. 330, (6146), 391-395 (1987).
  30. LI-COR. Odyssey Infrared EMSA Kit: Instruction Manual. Available from: http://www.licor.com/bio/pack_inserts/?pi=829-07910 (2014).
  31. Thermo Fisher Scientific, Inc. BCA Protein Assay Kit: User Guide. Available from: https://tools.thermofisher.com/content/sfs/manuals/MAN0011430_Pierce_BCA_Protein_Asy_UG.pdf (2014).
  32. Wijeratne, A. B., et al. Phosphopeptide separation using radially aligned titania nanotubes on titanium wire. ACS Appl Mater Interfaces. 7, (21), 11155-11164 (2015).
  33. Silva, J. M., McMahon, M. The Fastest Western in Town: A Contemporary Twist on the Classic Western Blot Analysis. J. Vis. Exp. (84), (2014).
  34. Lu, X., et al. Lupus Risk Variant Increases pSTAT1 Binding and Decreases ETS1 Expression. Am J Hum Genet. 96, (5), 731-739 (2015).
  35. Ramana, C. V., Chatterjee-Kishore, M., Nguyen, H., Stark, G. R. Complex roles of Stat1 in regulating gene expression. Oncogene. 19, (21), 2619-2627 (2000).
  36. Fillebeen, C., Wilkinson, N., Pantopoulos, K. Electrophoretic Mobility Shift Assay (EMSA) for the Study of RNA-Protein Interactions: The IRE/IRP Example. J. Vis. Exp. (94), e52230 (2014).
  37. Heng, T. S., Painter, M. W. Immunological Genome Project, C. The Immunological Genome Project: networks of gene expression in immune cells. Nat Immunol. 9, (10), 1091-1094 (2008).
  38. Wu, C., et al. BioGPS: an extensible and customizable portal for querying and organizing gene annotation resources. Genome Biol. 10, (11), R130 (2009).
  39. Wu, C., Macleod, I., Su, A. I. BioGPS and MyGene.info: organizing online, gene-centric information. Nucleic Acids Res. 41, (Database issue), D561-D565 (2013).
  40. Wang, J., et al. Sequence features and chromatin structure around the genomic regions bound by 119 human transcription factors. Genome Res. 22, (9), 1798-1812 (2012).
  41. Holden, N. S., Tacon, C. E. Principles and problems of the electrophoretic mobility shift assay. J Pharmacol Toxicol Methods. 63, (1), 7-14 (2011).
  42. Miltenyi Biotec, Inc. µMACS FactorFinder Kit: Data sheet. Available from: http://www.miltenyibiotec.com/en/products-and-services/macsmolecular/protein-research/biotinylated-molecule-isolation/macs-factorfinder-kit.aspx (2014).
  43. Xu, J., Liu, H., Park, J. S., Lan, Y., Jiang, R. Osr1 acts downstream of and interacts synergistically with Six2 to maintain nephron progenitor cells during kidney organogenesis. Development. 141, (7), 1442-1452 (2014).
  44. Yang, T. -P., et al. Genevar: a database and Java application for the analysis and visualization of SNP-gene associations in eQTL studies. Bioinformatics. 26, (19), 2474-2476 (2010).
  45. Fort, A., et al. A liver enhancer in the fibrinogen gene cluster. Blood. 117, (1), 276-282 (2011).
  46. Solberg, N., Krauss, S. Luciferase assay to study the activity of a cloned promoter DNA fragment. Methods Mol Biol. 977, 65-78 (2013).
  47. Rahman, M., et al. A repressor element in the 5'-untranslated region of human Pax5 exon 1A. Gene. 263, (1-2), 59-66 (2001).
  48. Mali, P., et al. RNA-Guided Human Genome Engineering via Cas9. Science. 339, (6121), 823-826 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics