Le dépistage de la fonctionnelle non-codant des variants génétiques utilisant mobilité électrophorétique Maj Assay (EMSA) et l'ADN-affinité Précipitations Assay (DAPA)

* These authors contributed equally
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Miller, D. E., Patel, Z. H., Lu, X., Lynch, A. T., Weirauch, M. T., Kottyan, L. C. Screening for Functional Non-coding Genetic Variants Using Electrophoretic Mobility Shift Assay (EMSA) and DNA-affinity Precipitation Assay (DAPA). J. Vis. Exp. (114), e54093, doi:10.3791/54093 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Des études de séquençage et de génotypage à base d'études, y compris l'ensemble du génome des études d'association (GWAS), des études de locus candidat, et profond de séquençage, ont identifié de nombreuses variantes génétiques qui sont statistiquement associés à une maladie, trait, ou d'un phénotype. Contrairement aux prévisions initiales, la plupart de ces variantes (85-93%) sont situées dans des régions non codantes et ne changent pas la séquence d'acides aminés des protéines 1,2. L' interprétation de la fonction de ces variantes non codantes et déterminer les mécanismes biologiques qui les relient à la maladie associée, trait ou un phénotype a révélé difficile 3-6. Nous avons développé une stratégie générale visant à identifier les mécanismes moléculaires qui lient les variantes à une importante phénotype intermédiaire - l'expression du gène. Ce pipeline est spécifiquement conçu pour identifier la modulation de la liaison par des variants génétiques TF. Cette stratégie combine les approches de calcul et des techniques de biologie moléculaire visant à prédireeffets biologiques des variants candidats in silico, et vérifier ces prédictions empiriquement (Figure 1).

Figure 1
Figure 1:.. Approche stratégique pour l'analyse des étapes non codantes variantes génétiques qui ne sont pas inclus dans le protocole détaillé associé à ce manuscrit sont en gris S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Dans de nombreux cas, il est important de commencer en élargissant la liste des variantes à inclure tous ceux en haute liaison-déséquilibre (LD) avec chaque variante statistiquement associée. LD est une mesure d'association non aléatoire des allèles à deux positions chromosomiques différentes, qui peut être mesurée par la r 2 statistique 7. r 2 est une mesure du linkage déséquilibre entre deux variantes, avec un r 2 = 1 désignant liaison parfaite entre deux variantes. Allèles en haute LD se trouvent à la co-ségrégation sur le chromosome à travers les populations ancestrales. tableaux de génotypage actuels ne comprennent pas toutes les variantes connues dans le génome humain. Au lieu de cela, ils exploitent la LD dans le génome humain et comprennent un sous - ensemble des variantes connues qui agissent comme substituts pour les autres variantes dans une région particulière de LD 8. Ainsi, une variante sans aucune conséquence biologique peut être associée à une maladie particulière, car il est en LD avec la variante-causal variante avec un effet biologique significatif. La procédure, il est recommandé de convertir la dernière version de 1000 génomes projeter 9 fichiers variante d'appel (VCF) dans des fichiers binaires compatibles avec PLINK 10,11, un outil open-source pour toute analyse d'association du génome. Par la suite, toutes les autres variantes génétiques avec LD r 2> 0,8 avec chacun va génétique d'entréeRiant peut être identifié en tant que candidats. Il est important d'utiliser la population de référence appropriée pour ce beau - par exemple, si un variant a été identifié chez les sujets d'origine européenne, des données provenant de sujets d'ascendance similaires devraient être utilisés pour l' expansion de LD.

l'expansion LD se traduit souvent par des dizaines de variantes de candidats, et il est probable que seule une petite fraction de ceux-ci contribuent au mécanisme de la maladie. Souvent, il est impossible d'étudier expérimentalement chacune de ces variantes individuellement. Il est donc utile de tirer parti des milliers de jeux de données accessibles au public de génomique fonctionnelle comme un filtre pour prioriser les variantes. Par exemple, le consortium ENCODE 12 a effectué des milliers d'expériences de ChIP-seq décrivant la liaison de TFs et co-facteurs, et les marques de histones dans un large éventail de contextes, ainsi que des données chromatine d'accessibilité des technologies telles que DNase-seq 13, ATAC -seq 14 et suivants 15-FAIRE. Databases et les serveurs Web tels que le navigateur UCSC Genome 16, Feuille de route Epigenomics 17, Blueprint Epigénome 18, cistrome 19 et ReMap 20 offrent un accès gratuit aux données produites par ces autres techniques expérimentales et à travers un large éventail de types et conditions cellulaires. Quand il y a trop de variantes pour examiner expérimentalement, ces données peuvent être utilisées pour établir des priorités de ceux situés dans les régions régulatrices probables dans les types de cellules et de tissus concernés. En outre, dans les cas où une variante est dans un pic de ChIP-seq pour une protéine spécifique, ces données peuvent fournir des pistes potentielles à la TF (s) spécifique ou co-facteurs dont la liaison pourrait affecter.

Ensuite, les variants résultants en priorité sont sélectionnés expérimentalement pour valider la liaison en utilisant EMSA 21,22 prédit une protéine dépendante du génotype. EMSA mesure la variation de la migration de l'oligonucléotide sur un gel TBE non réducteur. oligo- marqué par fluorescence est mis en incubation avec lelysat nucléaire, et la liaison des facteurs nucléaires retarder le mouvement de l'oligo sur le gel. De cette manière, oligo qui a lié des facteurs plus nucléaires présentera comme un signal fluorescent plus fort lors de la numérisation. Notamment, l'EMSA ne nécessite pas des prédictions sur les protéines spécifiques dont la liaison sera affectée.

Une fois que les variantes sont identifiées qui sont situés dans des régions régulatrices prévues et sont capables de facteurs nucléaires différentiellement contraignants, les méthodes de calcul sont utilisées pour prédire la TF spécifique (s) dont la liaison qu'ils pourraient affecter. Nous préférons utiliser CIS-BP 23,24, RegulomeDB 25, UNIProbe 26 et JASPAR 27. Une fois que le candidat TFs sont identifiés, ces prévisions peuvent être spécifiquement testées en utilisant des anticorps contre ces TFs (EMSA-supershifts et DAPA-Westerns). Une EMSA-supershift implique l'addition d'un anticorps spécifique TF au lysat nucléaire et oligo. Un résultat positif dans un EMSA-supershift est réédesented comme un nouveau changement dans la bande EMSA, ou une perte de la bande (examiné en référence 28). Dans le DAPA complémentaire, d'un duplex oligonucléotidique 5'-biotinylée contenant de la variante et la 20 paire de bases de nucléotides flanquantes sont mises en incubation avec un lysat nucléaire du type de cellule approprié (s) pour capturer des facteurs nucléaires se liant spécifiquement oligos. Le complexe facteur nucléaire duplex oligonucléotide est immobilisé par des microbilles de streptavidine dans une colonne magnétique. Les facteurs liés nucléaires sont collectés directement par élution 29,48. prédictions de liaison peuvent alors être évalués par un transfert de Western en utilisant des anticorps spécifiques de la protéine. Dans les cas où il n'y a pas de prédictions évidentes, ou trop de prédictions, les élutions de variantes pull-downs des expériences de DAPA peuvent être envoyés à un noyau de protéomique pour identifier les TFs candidats en utilisant la spectrométrie de masse, qui peuvent ensuite être validées en utilisant ces décrits précédemment méthodes.

Dans la suite de l'article, le protocole détaillé pour EMSA et DAPA analyse des variants génétiques est fourni.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Préparation des solutions et réactifs

  1. Commandez des sondes ADN d'oligonucléotides personnalisés pour une utilisation dans EMSA et DAPA.
    1. Pour réduire la protéine liaison non spécifique, concevoir des oligos courts (entre 35-45 paires de bases (pb) de longueur) 30, et placer la variante d'intérêt dans le centre flanqué de sa séquence génomique endogène 17 pb. Pour oligos EMSA, ajoutez un 'fluorophore 5. Pour oligos DAPA, ajouter une balise 5 'de la biotine.
    2. Commander à la fois le brin sens et son complément inverse brin. Sinon, l'ordre duplex (pré-recuites) oligos. Lorsque vous nommez les oligos, fonder la nomenclature sur un génome de référence établie.
      Note: Le «risque» et la désignation «non-risque» peut être la maladie et projet spécifique, tandis que «référence» et «non-référence" sont plus universellement pertinents.
    3. À l'arrivée des oligos, centrifuger brièvement vers le bas le contenu et les remettre en suspension dans l'eau sans nucléase à une concentration finale de 100 μ; M. Magasin resuspendu stock à -20 ° C. Protéger oligos marqués avec un fluorophore de la lumière en enroulant une feuille d'aluminium.
prénom Séquence
rs76562819_REF_FOR GTAATGCCTTAATGAGAGAG A GTTAGTCATCTTCTCACTTC
rs76562819_REF_REV GAAGTGAGAAGATGACTAAC T CTCTCTCATTAAGGCATTAC
rs76562819_NONREF_FOR GTAATGCCTTAATGAGAGAG G GTTAGTCATCTTCTCACTTC
rs76562819_NONREF_REV GAAGTGAGAAGATGACTAAC C CTCTCTCATTAAGGCATTAC

Tableau 1: Exemple EMSA / DAPA conception d'oligonucléotides pour tester un SNP pour bin différentielding. "REF" signifie l'allèle de référence, tandis que "NONREF" signifie l'allèle non-référence. "POUR" représente le brin avant, tandis que "REV" indique son complément. Le SNP est vu en rouge.

  1. Préparer l'extraction cytoplasmique (CE), un tampon avec une concentration finale de 10 mM de HEPES (pH 7,9), 10 mM de KCl et 0,1 mM d'EDTA dans de l'eau déminéralisée.
  2. Préparer l'extraction nucléaire (NE) du tampon à une concentration finale de 20 mM de HEPES (pH 7,9), 0,4 M de NaCl et 1 mM d'EDTA dans de l'eau déminéralisée.
  3. Préparer un tampon d'hybridation à une concentration finale de 10 mM de Tris (pH 7,5 à 8,0), 50 mM de NaCl et 1 mM d'EDTA dans de l'eau déminéralisée.

2. Préparation de lysat nucléaire à partir des cellules cultivées

Remarque: Le protocole expérimental a été optimisé en utilisant des lignées de cellules lymphoblastoïdes B, mais a été testée dans plusieurs autres lignées cellulaires adhérentes non apparentées / suspension et fonctionne de manière universelle.

  1. Culture des cellules B lymphoblastoïdes à Roswell Memorial Institute Park (RPMI) 1640 avec 2 mM de L-glutamine, du sérum de veau fœtal à 10%, et 1 x antibiotique antimycotique contenant 100 unités / ml de pénicilline, 100 ug / ml de streptomycine et 250 ng / ml d'amphotéricine B.
    1. Semences dans une gamme de 200,000-500,000 cellules viables / ml et on incube les flacons à 37 ° C avec 5% de dioxyde de carbone en position verticale avec des bouchons ventilés ou en vrac.
      Remarque: La croissance des cellules B lymphoblastoïdes ralentit quand elles atteignent plus de 1.000.000 cellules / ml. Brisez explosions de cellules par pipetage de haut en bas plusieurs fois et revenir cellules 200,000-500,000 cellules / ml pour maintenir un taux de croissance rapide.
  2. Laver les cellules en culture deux fois avec 10 ml de glace froide phosphate saline tamponnée (PBS), centrifuger à 4 ° C, 300 g pendant 5 min et retirez PBS par aspiration.
  3. Compter les cellules en utilisant un hémocytomètre et remettre le culot en 1 ml PBS glacé par 10 7 cellules.
    Remarque: Par exemple, si lyser 2 x 10 7 </ Sup> cellules, remettre en suspension dans 2 ml de PBS.
  4. Aliquote de 1 ml à 1,5 ml microtubes de sorte que chaque tube contient 10 7 cellules dans du PBS. Centrifuger à 3300 xg pendant 2 min 4 ° C et Aspirer PBS.
  5. Avant utilisation, ajouter mM dithiothréitol 1 (DTT), inhibiteur de la phosphatase 1x et 1x inhibiteur de la protéase à un stock de travail de tampon de la CE. Resuspendre le culot de cellules avec 400 pi de tampon CE et laisser incuber sur de la glace pendant 15 minutes.
  6. Ajouter 25 ul de 10% de Nonidet P-40 et mélanger par pipetage. Centrifugeuse à 4 ° C, vitesse max pendant 3 min. Décanter et jeter le surnageant.
  7. Avant utilisation, ajouter mM DTT, inhibiteur de la phosphatase 1x et 1x inhibiteur 1 de la protéase à un stock de travail de tampon NE. Resuspendre le culot cellulaire avec 30 pi de tampon NE et mélanger par tourbillonnement.
  8. Incuber à 4 ° C dans un dispositif de rotation du tube ou sur la glace pendant 10 min. Centrifugeuse 3300 xg pendant 2 min 4 ° C.
  9. Recueillir le surnageant clair (lysat nucléaire) et aliquote avant de les stocker à -806; C afin d'éviter de multiples cycles de congélation-décongélation qui peuvent dégrader la protéine. Laisser un aliquote de 10 pi pour mesurer la concentration de protéines en utilisant le dosage de l' acide bichoninic (BCA) 31.

3. Mobilité électrophorétique Maj Assay (EMSA)

  1. Préparer Oligo Stock de travail et EMSA Gel.
    1. Si oligos ont été commandés en duplex, dégeler les 100 uM stock et diluer 1: 2000 dans un tampon de recuit pour obtenir un stock de travail de 50 nM.
    2. Si les oligos ont été commandés à simple brin, décongeler les stocks de 100 um et dilué 1:10 dans du tampon d'hybridation pour atteindre 100 valeurs de travail nm. Combiner 100 ul de la solution de complément de brin de 100 nm avec l'autre dans un microtube.
      1. Placez dans un bloc thermique à 95 ° C pendant 5 min. Désactiver le bloc thermique et permettent oligos refroidir lentement jusqu'à la température ambiante pendant au moins une heure avant utilisation.
    3. Pré-exécuter le Gel EMSA.
      1. Retirer la lame d'un pré-cast 6% TBE gel et rincer sous l'eau déminéralisée plusieurs fois pour éliminer tout tampon dans les puits. Préparer 1 litre de tampon 0,5 x TBE en ajoutant 50 ml de TBE 10x à 950 ml d'eau déminéralisée.
      2. Assembler l'appareil d'électrophorèse sur gel et vérifier les fuites en remplissant la chambre intérieure avec un tampon 0,5x TBE. Si aucun tampon fuit dans la chambre extérieure, remplir la chambre extérieure à peu près deux tiers du chemin.
      3. Pré-exécuter le gel à 100 V pendant 60 min.
      4. Rincer chaque puits avec 200 pi de tampon 0,5x TBE.
  2. Préparer Binding Buffer Master Mix.
    1. 10x préparer un tampon de liaison avec une concentration finale de 100 mM de Tris, 500 mM de KCl, 10 mM de DTT; pH 7,5 dans de l'eau déminéralisée.
    2. Dans un tube de microcentrifugeuse, créer un mélange maître constitué des réactifs communs à toutes les réactions (10 ul 10x tampon de liaison, 10 pi de DTT / polysorbate, 5 pi Poly d (IC), et d' ADN de sperme de saumon 2,5 pi; tableau 2). Préparer un montant supplémentaire de 10%pour tenir compte de la perte de volume due à pipetage.
Réactif Conc final. Rxn n ° 1 Rxn n ° 2 Rxn n ° 3 Rxn n ° 4
eau ultrapure 20 ul de vol. 13,5 pi 11.98 ul 13.5μl 11.98 ul
10x Binding Buffer 1 fois 2 ul 2 ul 2 ul 2 ul
DTT / TW-20 1 fois 2 ul 2 ul 2 ul 2 ul
ADN de sperme de saumon 500 ng / ul 0,5 ul 0,5 ul 0,5 ul 0,5 ul
1 pg / pl Poly d (IC) 1 pg 1 ul 1 ul 1 ul 1 ul
Extrait nucléaire (5,26 ug / ul) 8 pg - 1,52 pi - 1,52 pi
NE Buffer 1,52 pi - 1,52 pi -
Référence allèle oligo 50 fmol 1 ul 1 ul - -
Non-Référence allèle oligo 50 fmol - - 1 ul 1 ul

Tableau 2: Exemple EMSA réaction setup. Le tableau illustre un exemple EMSA pour tester l'hypothèse selon laquelle il est le génotype dépendant liaison de TFs à un SNP spécifique.

  1. Ajouter de l'eau sans nuclease à chaque microtube de telle sorte que le volume final après l'addition de tous les réactifs est de 20 ul.
  2. Ajouter la quantité appropriée (5,5 pi) de mélange maître à chaque tube de microcentrifugeuse.
  3. Ajouter 8 pg de lysat nucléaire aux microtubes appropriés. Inclure des tubes contenant l'oligo sans extrait nucléaire comme témoins négatifs (par exemple le tableau 2, Rxn # 1 et Rxn 3 #).
    Note: La quantité optimale de lysat par réaction doit être déterminée expérimentalement par titrage. Généralement, titration une gamme de 2-10 pg de lysat est suffisante.
  4. Ajouter 50 fmoles d'oligo aux microtubes appropriés. Flick pour mélanger et faire tourner brièvement le contenu au fond du tube. Incuber pendant 20 min à température ambiante.
    Note: Si attempting un supershift, incuber le mélange de lysat avec l'anticorps pendant 20 minutes à température ambiante avant l'addition d'oligos. Il est recommandé d'utiliser 1 pg d'un anticorps ChIP de qualité pour de meilleurs résultats.
  5. Ajouter 2 pi de 10x orange Loading Dye à chaque tube de microcentrifugeuse. Pipeter haut et en bas pour mélanger.
  6. Charger les échantillons dans le gel à 6% TBE pré-exécution par pipetage de haut en bas pour mélanger, puis expulser chaque échantillon dans un puits séparé. Exécutez le gel à 80 V jusqu'à ce que le colorant orange, a migré du 02.03 au 03.04 le chemin vers le bas du gel. Cela devrait prendre environ 60-75 min.
  7. Retirer le gel de la cassette en plastique en le soulevant avec un couteau de gel et placer le gel dans un récipient avec un tampon de TBE à 0,5% pour l'empêcher de se dessécher.
  8. Placer le gel sur la surface d'un système d'imagerie infrarouge et de chimioluminescence, en étant sûr d'éliminer toutes les bulles ou les contaminants qui perturbent l'image.
  9. Utilisation du logiciel de système de balayage, cliquez sur l'onglet "Acquisition"puis sélectionnez "Dessiner Nouveau" pour dessiner une zone autour de la zone correspondant à l'endroit où le gel est situé sur la surface du scanner.
  10. Dans la section "Chaînes" de l'onglet "Acquisition", sélectionnez le canal correspondant à la longueur d'onde de la balise fluorophore sur l'oligo. Dans la section "Scanner", cliquez sur "preview" pour obtenir un aperçu de la numérisation à faible qualité. Réglez la zone de numérisation en faisant glisser la boîte bleue qui entoure l'image de prévisualisation acquis jusqu'à la partie du gel à imager.
    Remarque: Par exemple, si en utilisant les oligos marqués avec un fluorophore nm 700, assurez-vous que le canal "700 nm" est sélectionné avant la numérisation.
  11. Dans la section "Commandes de numérisation", sélectionnez l'option "84 uM" résolution et l'option de qualité "moyenne". Définir le focus pour compenser la moitié de l'épaisseur du gel. Remarque: Par exemple, un gel de 1 mm serait d'utiliser un 0,5 mm de décalage de focalisation.
  12. Dans la section "Scanner", cliquez sur "Démarrer" à bEgin l'analyse.
    Remarque: Lors de l'analyse, le régime luminosité, le contraste, et la couleur peut souvent être ajustée manuellement selon le fabricant du système de balayage.
  13. Une fois l'analyse terminée, sélectionnez l'onglet "Image" et cliquez sur "Rotation ou Flip" dans la section "Créer" pour corriger l'orientation. Enregistrez le fichier d'image en cliquant sur "Exporter" dans le menu principal, puis sélectionnez "Image Single View."

4. ADN Purification par affinité de dosage (DAPA)

  1. Préparation de 5 uM Oligo travail Stock.
    1. Si oligos ont été commandés en duplex, dégeler les 100 uM stock et diluer 1:20 dans un tampon de recuit pour obtenir un stock de travail de 5 uM.
    2. Si les oligos ont été commandés à simple brin, décongeler les stocks de 100 um et dilué 1:10 dans du tampon d'hybridation pour obtenir des stocks 10 iM de travail. Combiner 10 pl de 10 pM brins complémentaires les uns avec les autres. Placez dans un bloc thermique à 95 ° C pendant5 min. Éteignez le bloc de chaleur et laisser les oligos refroidir lentement à la température ambiante avant utilisation.
  2. Avant de commencer, réchauffer le tampon de liaison, un tampon de lavage de faible stringence, un tampon de lavage à haute stringence, et un tampon d'élution à température ambiante.
    Remarque: Une concentration finale de 50 ng / ml de poly d (IC) peut être ajouté au tampon de fixation, un tampon de lavage à faible stringence, et un tampon de lavage de stringence élevée pour réduire le potentiel de liaison non spécifique des protéines à oligos.
  3. Préparer les mélanges de liaison pour chaque variante.
    1. Mélanger 1 volume de lysat nucléaire avec 2 volumes de tampon de liaison.
      Remarque: La quantité requise de lysat doit être déterminée expérimentalement en raison de l'abondance des TFs variables. Utilisation entre 100-250 pg de lysat nucléaire par colonne est suffisante dans la plupart des cas.
    2. Ajouter inhibiteur 1x phosphatase, un inhibiteur de protéase 1x et activateur de liaison 1x (en option) et mélanger en tapotant le tube plusieurs fois.
      Note: 100x liaisonactivateur est constitué de 750 mM MgCl 2 et 300 mM ZnCl2. Ajouter activateur de liaison si la liaison de l'ADN TF dépend des cofacteurs ou des agents réducteurs. Si cette information est inconnue, ajouter l'activateur de liaison.
    3. Ajouter 10 pi de 5 pM d'ADN de capture biotinylée (50 pmol) à chaque mélange de liaison respectif. Incuber pendant 20 min à température ambiante.
      Nota: Le temps d'incubation et la température peut varier en fonction de la TF. Les valeurs optimales doivent être déterminées expérimentalement.
  4. Ajouter 100 pi de microbilles de streptavidine. Incuber pendant 10 min à température ambiante.
  5. Pour chaque sonde oligo testée, placer une colonne de liaison dans le séparateur magnétique. Placer un tube de microcentrifugation directement sous chaque colonne de liaison et d'appliquer 100 pi de tampon de liaison pour rincer la colonne.
  6. Pipeter le contenu de chaque mélange de liaison dans des colonnes séparées et de permettre au liquide de circuler complètement à travers la colonne dans la microcentrifugeusele tube avant de poursuivre. Assurez-vous d'étiqueter les colonnes avec la variante oligo qui a été utilisé dans le mélange de liaison. Etiqueter les échantillons accréditives et les remplacer par de nouveaux tubes à centrifuger pour collecter les lavages à faible stringence.
  7. Appliquer 100 pi de faible stringence tampon de lavage à la colonne; attendre jusqu'à ce que le réservoir de la colonne est vide. Répétez lavage 4x. Etiqueter les échantillons de lavage à faible stringence et les remplacer par de nouveaux tubes à centrifuger pour collecter les lavages à haute stringence.
  8. Appliquer 100 pi de haute stringence tampon de lavage à la colonne; attendre jusqu'à ce que le réservoir de la colonne est vide. Répétez lavage 4x. Etiqueter les échantillons de lavage à haute stringence et les remplacer par de nouveaux tubes à centrifuger pour recueillir le pré-élution.
  9. Ajouter 30 pi de tampon d'élution native à la colonne et laisser reposer pendant 5 min. Etiqueter les échantillons de pré-élution et les remplacer par de nouveaux tubes à centrifuger pour recueillir l'élution.
    Remarque: Cela n'éluer pas la protéine liée; il lave le reste haute stringencele tampon de la colonne et on le remplace par un tampon d'élution pour optimiser l'efficacité de l'élution.
  10. Ajouter un 50 ul élution native tampon supplémentaire pour éluer les TFs liés. Pour un rendement plus élevé, mais éluat moins concentré, ajouter un 50 pi supplémentaires de tampon d'élution natif et de recueillir l'écoulement.
    Note: Analyser des échantillons d'élution par spectrométrie de masse pour déterminer l'identité du TFs lié 32. Par la suite, vérifier les résultats protéomiques par le biais dodécylsulfate de sodium électrophorèse sur gel de polyacrylamide au sulfite (SDS-PAGE) , suivie d'un transfert Western 33. Si la spectrométrie de masse ne sont pas disponibles, exécutez une tache d'argent en utilisant la technique standard au lieu d'un Western blot pour déterminer la taille de la protéine (s) représentant la liaison génotype-dépendante. Utilisez ces informations pour affiner la liste des TFs prédites des approches de calcul détaillées dans l'introduction.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Dans cette section, les résultats représentatifs de ce qui les attend sont fournies lors de l'exécution d'un EMSA ou DAPA, et la variabilité en ce qui concerne la qualité de lysat est caractérisé. Par exemple, il a été suggéré que le gel et les échantillons de protéines de décongélation plusieurs fois peut entraîner une dénaturation. Afin d'explorer la reproductibilité de l'analyse EMSA dans le contexte de ces cycles "gel-dégel", deux 35 oligos pb différentes à une variante génétique ont été incubées avec un seul lot de lysat nucléaire qui a été décongelé et re-congelé pour le montant indiqué . reprises la figure 2 montre que la congélation et la décongélation de cet extrait nucléaire particulier des lymphocytes B jusqu'à 5 fois n'a apparemment aucun effet sur ​​l'intégrité des protéines; Cependant, la stabilité de la protéine nucléaire varie selon les échantillons et doit donc être testé sur chaque lignée cellulaire individuelle utilisée. Il est également possible d'avoir une variation de différents lots de préparations de lysats nucléaires. Si cette variation est due à la phase du cycle cellulaire avant la lyse, le nombre de passages des cellules, ou d'autres facteurs, il est important de reproduire les résultats EMSA en utilisant différents lots de lysat pour assurer des résultats réels.

En outre, il est important d'optimiser le rapport signal-bruit pour l'EMSA. Une variable importante à cet égard est la concentration en oligo. La quantité d'oligo (fmoles 5-300) a été titrée pour déterminer comment les différentes quantités d'oligos affectent le signal (figure 3). On a observé une augmentation de l'intensité de la bande jusqu'à 100 fmoles d'oligo. Après ce point, les plateaux de signal suggérant 100 fmol est la quantité d'oligo optimale pour cette réaction EMSA.

Enfin, une figure représentative de l' un de nos études publiées en utilisant une partie de la stratégie décrite dans ce manuscrit est fourni (Figure 4). In th34 est l' étude, nous avons montré que le risque allèle de type lupus associé de rs6590330 augmente la liaison de STAT1, un facteur de transcription qui participe à la fois l' activation et l' inhibition synergique de l' expression génique en aval du récepteur de 1 ' IFN de type complexe 35. Dans cet exemple, STAT1 a d'abord été identifié par la DAPA suivie d'une analyse protéomique en utilisant la chromatographie liquide à haute performance couplée à la spectrométrie de masse en tandem (MS-DAPA). Un transfert de DAPA-Ouest a été utilisé pour confirmer la TF identifiée à partir de l'analyse protéomique (STAT1) et confirmer que la forme phosphorylée de STAT1 est obligatoire à la non-référence (lupus-risque) oligo. Cette figure illustre la façon dont les différents essais de cette stratégie peut être utilisée pour identifier la liaison du facteur de transcription différentielle une variante non codante.

Figure 2
Figure 2: Analyse de la reproductibilitéet les conséquences des cycles de gel-dégel sur les résultats de l' EMSA. oligos contenant la référence (R) ou non-référence (NR) allèle d'une variante génétique ont été utilisés pour sonder la même préparation de lysat après de multiples cycles de gel et de dégel. (Lys: Lysat). Chaque piste contient la sonde libre au fond du gel (flèche bleue). La liaison des TFs à l'oligo peut être considérée comme une bande dans la moitié supérieure du gel (flèche rouge). Les bandes contenues dans la moitié inférieure du gel (voir support) ne sont pas spécifiques. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 3
Figure 3:. Evaluation de l'effet de différentes concentrations d'oligo Diverses concentrations d'oligos ont été utilisés pour sonder une seule préparation de lysat nucléaire. Fluorescent signal augmente avec l'augmentation des quantités d'oligo, ce qui indique que l'oligonucléotide est le réactif limitant. Les plateaux de signaux au niveau des voies de 100-300 fmoles, où la quantité de protéines devient le réactif limitant. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 4
Figure 4: L'allèle lupus risque de rs6590330 augmente la liaison STAT1, évaluée par DAPA-MS STAT1 et pSTAT1 présentent une plus forte liaison aux oligos contenant l'allèle de risque de rs6590330 par rapport à l'allèle non-risque.. oligos marqués à la biotine ont été incubées avec d'Epstein-Barr de lymphocytes B transformées par le virus d'extrait nucléaire. Les protéines liées à l'oligo ont été capturés en utilisant DAPA. Les protéines ont ensuite été séparées par SDS-polyacrylamide à une électrophorèse sur gel et détectées en utilisant l'anti-pSTAT1(A) ou anti-STAT1 (B). M: Marqueur. NR: oligonucleotide contenant l'allèle de non-risque de rs6590330; R: oligo contenant l'allèle risque de rs6590330; Mutant: oligo contenant un site en aval de rs6590330 liaison STAT1 putative perturbé; Lysat cellulaire: extrait nucléaire de cellules B. Les intensités relatives des bandes sont indiquées en dessous de chaque bande. Les résultats sont représentatifs de quatre expériences; alors que toutes les expériences ont démontré augmenté STAT1 liaison aux sondes avec l'allèle de risque, 2/4 expériences ne STAT1 ou pSTAT1 a été détectée dans l'immunoprécipité de la non-oligo risque, alors que les deux ont été détectés dans l'immunoprécipité de l'oligo de risque. Ce chiffre a été modifié par la référence 34. S'il vous plaît cliquez ici pour voir une version plus grande de cette figure.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Bien que les progrès dans les technologies de séquençage et de génotypage ont grandement amélioré notre capacité à identifier les variants génétiques associés à la maladie, notre capacité à comprendre les mécanismes fonctionnels impactés par ces variantes est à la traîne. Une source importante du problème est que de nombreuses variantes associées à la maladie sont situés dans n sur le codage des régions du génome, qui affectent probablement plus difficiles à prédire-mécanismes qui contrôlent l'expression des gènes. Ici, nous présentons un protocole basé sur les techniques de l'EMSA et DAPA, des outils moléculaires utiles pour identifier les événements qui contribuent probablement à la fonction de nombreuses variantes non codantes de liaison génotype dépendant TF. Bien que ces deux techniques ont été largement utilisés dans le passé, ils ont récemment été adaptées pour l'analyse génétique de variante de TF de liaison. Au - delà de TFs, EMSA peut également être utilisé pour analyser l'effet des variants génétiques sur les protéines de liaison d' ARN avec seulement des ajustements mineurs au protocole 36.

ove_content "> Le protocole présenté ici est simple et facile à réaliser;. Néanmoins, certaines pièces nécessitent des considérations supplémentaires avant l'expérimentation d'abord, il est important de générer une première liste de variantes pour examen en effectuant des analyses statistiques rigoureuses Une erreur dans cette étape. peut faire dérailler toutes les analyses en aval, car de nombreuses variantes peuvent se lier lysat nucléaire différentiellement sans contribuer au risque de maladie. en outre, l'utilisation des données de génomique fonctionnelle réalisée dans des types cellulaires pertinents est cruciale, les types de cellules comme non pertinentes peuvent conduire à la génération de TF faux positif contraignant prévisions. Actuellement, les ressources génomiques fonctionnelles les plus couramment utilisés comprennent ENCODE 12 et la feuille de route Epigenomics 17. des informations supplémentaires concernant les niveaux d'expression des gènes dans les cellules-types pertinents à une maladie d'intérêt peuvent être obtenues à partir d' autres ressources telles que ImmGen 37, BioGPS 38, 39 et 20 SNPsea. Par exemple, une telle resourbureaux peuvent être utilisés pour filtrer les prédictions de liaison TF pour inclure uniquement les facteurs de transcription qui sont exprimés dans différents types cellulaires pertinents.

Il est également important de tenir compte des mises en garde des expériences in vitro tels que EMSA et DAPA. En particulier, il est nécessaire de répéter les expériences avec des préparations de lysat nucléaire séparés pour réduire les faux négatifs. En outre, un EMSA-supershift réussie peut se présenter comme un autre changement dans la bande EMSA, dans lequel l'anticorps se lie au TF, ou une perte de bande, dans laquelle l'ADN d'anticorps bloque le TF domaine de liaison. Dans les deux cas de figure, comprenant un anticorps de contrôle d'isotype et / ou un anticorps dirigé vers un autre TF est utile pour confirmer la spécificité du supershift. Une autre considération lors de l'exécution d'un supershift est d'inclure DTT / polysorbate dans la réaction. DTT / polysorbate stabilise le colorant de chargement permettant une quantification plus précise de l'ADN non lié; toutefois, il peut également réduire les liaisons disulfure des anticorps résultenttion dans l'échec de l'EMSA-supershift. Il est recommandé d'essayer des réactions avec et sans DTT / polysorbate lors d'une tentative de Supershift un complexe. La quantité optimale de poly d (IC) et le saumon de l'ADN de sperme par réaction doit être déterminée expérimentalement par titrage. En général, titrer une plage de 1-6 ug de poly d (IC) et 50-500 ng de sperme de saumon est suffisante. Un contrôle positif utile pour DAPA implique l' utilisation d' une séquence consensus pour une TF avec un motif de liaison bien caractérisée (obtenue à partir des bases de données telles que CIS-BP 23 ou Factorbook 40) et l' exécution d' un Western avec un anticorps spécifique à cette TF. Pour les deux essais, un oligo brouillé peut être utilisé pour montrer que toute liaison observée est spécifique aux oligos d'intérêt.

Les deux techniques EMSA et DAPA ont des limites expérimentales. Par exemple, l'affinité de liaison entre un TF et l'ADN est affectée en grande partie par les conditions de tampon. Idéalement, les conditions de tampon devraient imiter la conditio endogènens du noyau pour permettre une liaison optimale. Pour EMSA, les conditions de tampon inappropriées peuvent entraîner une bande faible ou la perte d'une bande entièrement. Pour DAPA, les conditions non idéales peuvent provoquer le TF (s) à éluer au cours des étapes de lavage. Par conséquent, chaque essai est seulement efficace pour identifier la liaison sous certaines conditions de tampon TF-oligo. Les conditions de tampon plus universellement utiles sont présentés dans le protocole ci-dessus. Une deuxième limite est que les résultats expérimentaux de méthodes EMSA et DAPA fournissent peu d'informations sur les mécanismes par lesquels TFs se lient aux oligos. TFs pourrait se lier à oligos directement ou être recrutés par d'autres facteurs. Par conséquent, il est important d'analyser les séquences oligonucléotidiques de calcul pour prédire comment les facteurs de transcription peuvent se lier à des oligos et de vérifier ces prédictions expérimentalement. Par exemple, une séquence de liaison spécifique peut être mutée ou un partenaire de liaison peut être expérimentalement épuisée. Enfin, la quantité d'extrait utilisé doit être titré pour chaque expérience to acquérir des résultats optimaux. Trop lysat peut saturer la liaison TF-oligo et occulter toute liaison différentielle entre les risques et non-risque allèles. Pour le dépannage, le lecteur peut se référer à plusieurs excellents examen et méthode manuscrits 30,41,42.

En plus des tests décrits ici, il existe une variété d'essais in vivo disponibles pour étudier le rôle des variants au sein des cellules vivantes (figure 1, en ​​bas). Immunoprécipitation de la chromatine suivie quantitative des réactions en chaîne par polymérase spécifiques d'allèles (ChIP-qPCR) les études peuvent être entreprises pour identifier si la liaison différentielle observée dans les essais in vitro est répliqués dans des cellules 34 vivant. Par exemple, si les cellules hétérozygotes pour une variante d'intérêt sont utilisés, des expériences de qPCR peuvent détecter la différence d'enrichissement entre les deux alleles dans la chromatine immunoprécipitée TF. ChIP nécessite des anticorps spécifiques ChIP de qualité; uter, si des anticorps TF ChIP-grade ne sont pas disponibles, la transfection de cellules avec un TF flag-tagged est une alternative efficace 43. En outre, l'effet de la liaison sur l' expression du gène cible différentielle peut être étudiée à travers l' expression quantitative trait loci (eQTL) analyse dans des types cellulaires pertinents en utilisant les données d'expression collectées localement à partir de cellules génotypés ou des ressources accessibles au public , tels que ceux compilés par Genevar 44. des dosages de rapporteur de luciférase peuvent également être utilisés pour étudier le degré auquel la liaison différentielle de la protéine affecte l'expression génique. De tels dosages peuvent être modifiés pour fonctionner indépendamment du fait que les variants sont situés dans un promoteur, un amplificateur ou répresseur région 45-47. Enfin, les technologies du génome édition, telles que CRISPR / cas9 48, peuvent être utilisés pour générer des lignées cellulaires qui ne diffèrent que dans une seule variante, ce qui est vital pour confirmer le lien de causalité. Ces technologies peuvent réduire sensiblement la variance expérimentale observée entrdes lignées de cellules dérivées de sujets een génétiquement différentes, étant donné que l'expression des gènes fonctionnels d'analyse des lectures ou d'une autre maladie phénotype intermédiaire peuvent être réalisées sur la lignée cellulaire modifiée et comparées aux lignées de cellules non modifiées.

Le principal avantage de la stratégie présentée est qu'il permet une détection facile et rapide de la liaison génotype-dépendante TF. En privilégiant les variants génétiques clés, d'autres expériences peuvent être conçus pour identifier leur effet biologique et démontrer leur causalité. Notamment, ce protocole peut être appliqué à enquêter sur une maladie ou un phénotype associé variant identifié à partir de GWAS ou de cartographie fine. Un grand trésor, de plus en plus des données génétiques et des listes de variants génétiques statistiquement associés est déjà disponible. Dans la plupart des cas, les mécanismes biologiques de conduite association statistique de ces variantes ne sont pas claires. La stratégie exposée dans la présente proposition permet une interprétation fonctionnelle précise du nombre diseà non codantevariantes se-associé. Une telle connaissance est indispensable à la pleine compréhension des mécanismes moléculaires de conduite toute maladie génétique basée.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n'ont rien à dévoiler.

Materials

Name Company Catalog Number Comments
Custom DNA Oligonucleotides Integrated DNA Technologies http://www.idtdna.com/site/order/oligoentry
Potassium Chloride Fisher Scientific BP366-500 KCl, for CE buffer
HEPES (1 M) Fisher Scientific 15630-080 For CE and NE buffer
EDTA (0.5M), pH 8.0 Life Technologies R1021 For CE, NE, and annealing buffer
Sodium Chloride Fisher Scientific BP358-1 NaCl, for NE buffer
Tris-HCl (1M), pH 8.0 Invitrogen BP1756-100 For annealing buffer
Phosphate Buffered Saline (1x) Fisher Scientific MT21040CM PBS, for cell wash
DL-Dithiothreitol solution (1 M) Sigma 646563 Reducing agent
Protease Inhibitor Cocktail Thermo Scientific 87786 Prevents catabolism of TFs
Phosphatase Inhibitor Cocktail  Thermo Scientific 78420 Prevents dephosphorylation of TFs
Nonidet P-40 Substitute IBI Scientific IB01140 NP-40, for nuclear extraction
BCA Protein Assay Kit Thermo Scientific 23225 For measuring protein concentration
Odyssey EMSA Buffer Kit Licor 829-07910 Contains all necessary EMSA buffers
TBE Gels, 6%, 12 Wells Invitrogen EC6265BOX For EMSA
TBE Buffer (10x) Thermo Scientific B52 For EMSA
FactorFinder Starting Kit Miltenyi Biotec 130-092-318 Contains all necessary DAPA buffers
Licor Odyssey CLx Licor Recommended scanner for DAPA/EMSA
Antibiotic-Antimycotic Gibco 15240-062 Contains 10,000 units/ml of penicillin, 10,000 µg/ml of streptomycin, and 25 µg/ml of Fungizone® Antimycotic
Fetal Bovine Serum Gibco 26140-079 FBS, for culture media
RPMI 1640 Medium Gibco 22400-071 Contains L-glutamine and 25 mM HEPES

DOWNLOAD MATERIALS LIST

References

  1. Hindorff, L. A., et al. Potential etiologic and functional implications of genome-wide association loci for human diseases and traits. Proc Natl Acad Sci U S A. 106, (23), 9362-9367 (2009).
  2. Maurano, M. T., et al. Systematic localization of common disease-associated variation in regulatory DNA. Science. 337, (6099), 1190-1195 (2012).
  3. Ward, L. D., Kellis, M. Interpreting noncoding genetic variation in complex traits and human disease. Nat Biotechnol. 30, (11), 1095-1106 (2012).
  4. Paul, D. S., Soranzo, N., Beck, S. Functional interpretation of non-coding sequence variation: concepts and challenges. Bioessays. 36, (2), 191-199 (2014).
  5. Zhang, F., Lupski, J. R. Non-coding genetic variants in human disease. Hum Mol Genet. (2015).
  6. Lee, T. I., Young, R. A. Transcriptional regulation and its misregulation in disease. Cell. 152, (6), 1237-1251 (2013).
  7. Slatkin, M. Linkage disequilibrium--understanding the evolutionary past and mapping the medical future. Nat Rev Genet. 9, (6), 477-485 (2008).
  8. Bush, W. S., Moore, J. H. Chapter 11: Genome-wide association studies. PLoS Comput Biol. 8, (12), e1002822 (2012).
  9. 1000 Genomes Project Consortium. An integrated map of genetic variation from 1,092 human genomes. Nature. 491, (7422), 56-65 (2012).
  10. Chang, C. C., et al. Second-generation PLINK: rising to the challenge of larger and richer datasets. Gigascience. 4, 7 (2015).
  11. Purcell, S., et al. PLINK: a tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet. 81, (3), 559-575 (2007).
  12. ENCODE Project Consortium. An integrated encyclopedia of DNA elements in the human genome. Nature. 489, (7414), 57-74 (2012).
  13. Crawford, G. E., et al. Genome-wide mapping of DNase hypersensitive sites using massively parallel signature sequencing (MPSS). Genome Res. 16, (1), 123-131 (2006).
  14. Buenrostro, J. D., Giresi, P. G., Zaba, L. C., Chang, H. Y., Greenleaf, W. J. Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nat Methods. 10, (12), 1213-1218 (2013).
  15. Giresi, P. G., Kim, J., McDaniell, R. M., Iyer, V. R., Lieb, J. D. FAIRE Formaldehyde-Assisted Isolation of Regulatory Elements) isolates active regulatory elements from human chromatin. Genome Res. 17, (6), 877-885 (2007).
  16. Kent, W. J., et al. The human genome browser at UCSC. Genome Res. 12, (6), 996-1006 (2002).
  17. Roadmap Epigenomics Consortium. Integrative analysis of 111 reference human epigenomes. Nature. 518, (7539), 317-330 (2015).
  18. Martens, J. H., Stunnenberg, H. G. BLUEPRINT: mapping human blood cell epigenomes. Haematologica. 98, (10), 1487-1489 (2013).
  19. Liu, T., et al. Cistrome: an integrative platform for transcriptional regulation studies. Genome Biol. 12, (8), R83 (2011).
  20. Griffon, A., et al. Integrative analysis of public ChIP-seq experiments reveals a complex multi-cell regulatory landscape. Nucleic Acids Res. 43, (4), e27 (2015).
  21. Staudt, L. M., et al. A lymphoid-specific protein binding to the octamer motif of immunoglobulin genes. Nature. 323, (6089), 640-643 (1986).
  22. Singh, H., Sen, R., Baltimore, D., Sharp, P. A. A nuclear factor that binds to a conserved sequence motif in transcriptional control elements of immunoglobulin genes. Nature. 319, (6049), 154-158 (1986).
  23. Weirauch, M. T., et al. Determination and inference of eukaryotic transcription factor sequence specificity. Cell. 158, (6), 1431-1443 (2014).
  24. Ward, L. D., Kellis, M. HaploReg: a resource for exploring chromatin states, conservation, and regulatory motif alterations within sets of genetically linked variants. Nucleic Acids Res. 40, (Database issue), D930-D934 (2012).
  25. Boyle, A. P., et al. Annotation of functional variation in personal genomes using RegulomeDB. Genome Res. 22, (9), 1790-1797 (2012).
  26. Hume, M. A., Barrera, L. A., Gisselbrecht, S. S., Bulyk, M. L. UniPROBE, update 2015: new tools and content for the online database of protein-binding microarray data on protein-DNA interactions. Nucleic Acids Res. 43, (Database issue), D117-D122 (2015).
  27. Mathelier, A., et al. JASPAR 2014: an extensively expanded and updated open-access database of transcription factor binding profiles. Nucleic Acids Res. 42, (Database issue), 142-147 (2014).
  28. Smith, M. F. Jr, Delbary-Gossart, S. Electrophoretic Mobility Shift Assay (EMSA). Methods Mol Med. 50, 249-257 (2001).
  29. Franza, B. R., Josephs, S. F., Gilman, M. Z., Ryan, W., Clarkson, B. Characterization of cellular proteins recognizing the HIV enhancer using a microscale DNA-affinity precipitation assay. Nature. 330, (6146), 391-395 (1987).
  30. LI-COR. Odyssey Infrared EMSA Kit: Instruction Manual. Available from: http://www.licor.com/bio/pack_inserts/?pi=829-07910 (2014).
  31. Thermo Fisher Scientific, Inc. BCA Protein Assay Kit: User Guide. Available from: https://tools.thermofisher.com/content/sfs/manuals/MAN0011430_Pierce_BCA_Protein_Asy_UG.pdf (2014).
  32. Wijeratne, A. B., et al. Phosphopeptide separation using radially aligned titania nanotubes on titanium wire. ACS Appl Mater Interfaces. 7, (21), 11155-11164 (2015).
  33. Silva, J. M., McMahon, M. The Fastest Western in Town: A Contemporary Twist on the Classic Western Blot Analysis. J. Vis. Exp. (84), (2014).
  34. Lu, X., et al. Lupus Risk Variant Increases pSTAT1 Binding and Decreases ETS1 Expression. Am J Hum Genet. 96, (5), 731-739 (2015).
  35. Ramana, C. V., Chatterjee-Kishore, M., Nguyen, H., Stark, G. R. Complex roles of Stat1 in regulating gene expression. Oncogene. 19, (21), 2619-2627 (2000).
  36. Fillebeen, C., Wilkinson, N., Pantopoulos, K. Electrophoretic Mobility Shift Assay (EMSA) for the Study of RNA-Protein Interactions: The IRE/IRP Example. J. Vis. Exp. (94), e52230 (2014).
  37. Heng, T. S., Painter, M. W. Immunological Genome Project, C. The Immunological Genome Project: networks of gene expression in immune cells. Nat Immunol. 9, (10), 1091-1094 (2008).
  38. Wu, C., et al. BioGPS: an extensible and customizable portal for querying and organizing gene annotation resources. Genome Biol. 10, (11), R130 (2009).
  39. Wu, C., Macleod, I., Su, A. I. BioGPS and MyGene.info: organizing online, gene-centric information. Nucleic Acids Res. 41, (Database issue), D561-D565 (2013).
  40. Wang, J., et al. Sequence features and chromatin structure around the genomic regions bound by 119 human transcription factors. Genome Res. 22, (9), 1798-1812 (2012).
  41. Holden, N. S., Tacon, C. E. Principles and problems of the electrophoretic mobility shift assay. J Pharmacol Toxicol Methods. 63, (1), 7-14 (2011).
  42. Miltenyi Biotec, Inc. µMACS FactorFinder Kit: Data sheet. Available from: http://www.miltenyibiotec.com/en/products-and-services/macsmolecular/protein-research/biotinylated-molecule-isolation/macs-factorfinder-kit.aspx (2014).
  43. Xu, J., Liu, H., Park, J. S., Lan, Y., Jiang, R. Osr1 acts downstream of and interacts synergistically with Six2 to maintain nephron progenitor cells during kidney organogenesis. Development. 141, (7), 1442-1452 (2014).
  44. Yang, T. -P., et al. Genevar: a database and Java application for the analysis and visualization of SNP-gene associations in eQTL studies. Bioinformatics. 26, (19), 2474-2476 (2010).
  45. Fort, A., et al. A liver enhancer in the fibrinogen gene cluster. Blood. 117, (1), 276-282 (2011).
  46. Solberg, N., Krauss, S. Luciferase assay to study the activity of a cloned promoter DNA fragment. Methods Mol Biol. 977, 65-78 (2013).
  47. Rahman, M., et al. A repressor element in the 5'-untranslated region of human Pax5 exon 1A. Gene. 263, (1-2), 59-66 (2001).
  48. Mali, P., et al. RNA-Guided Human Genome Engineering via Cas9. Science. 339, (6121), 823-826 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics