Screening for funktionelle ikke-kodende genetiske varianter Brug af elektroforetisk mobilitet (EMSA) og DNA-affinitet Precipitation Assay (DAPA)

* These authors contributed equally
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Miller, D. E., Patel, Z. H., Lu, X., Lynch, A. T., Weirauch, M. T., Kottyan, L. C. Screening for Functional Non-coding Genetic Variants Using Electrophoretic Mobility Shift Assay (EMSA) and DNA-affinity Precipitation Assay (DAPA). J. Vis. Exp. (114), e54093, doi:10.3791/54093 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Sekventering og genotypebestemmelse baserede undersøgelser, herunder genom-Wide Association Studies (GWAS), kandidat locus undersøgelser, og dyb-sekventering studier har identificeret mange genetiske varianter, der er statistisk forbundet med en sygdom, træk, eller fænotype. I modsætning til tidlige forudsigelser, de fleste af disse varianter (85-93%) er placeret i ikke-kodende regioner og ikke ændrer aminosyresekvensen af proteiner 1,2. Fortolkning af funktionen af disse ikke-kodende varianter og bestemme de biologiske mekanismer, der forbinder dem til den associerede sygdom, er træk, eller fænotype bevist udfordrende 3-6. Vi har udviklet en generel strategi til at identificere de molekylære mekanismer, der knytter varianter til et vigtigt mellemprodukt fænotype - genekspression. Denne rørledning er specielt designet til at identificere modulation af TF binding af genetiske varianter. Denne strategi kombinerer beregningsmæssige metoder og molekylærbiologiske teknikker med henblik at forudsigebiologiske effekter af kandidat varianter i silico og kontrollere disse forudsigelser empirisk (Figur 1).

figur 1
Figur 1:.. Strategisk tilgang til analyse af ikke-kodende genetiske varianter Steps, der ikke er medtaget i detaljeret protokol i forbindelse med dette manuskript er skraveret med gråt Klik her for at se en større version af dette tal.

I mange tilfælde er det vigtigt at begynde med at udvide listen over varianter at omfatte alle dem i high kobling-uligevægt (LD) med hver statistisk associeret variant. LD er et mål for ikke-tilfældige association af alleler ved to forskellige kromosomale positioner, hvilket kan måles ved R2 statistik 7. R2 er et mål for linKage uligevægt mellem to varianter, med en r 2 = 1 angiver perfekt kobling mellem to varianter. Alleler i høj LD viser sig at co-segregerer på kromosomet tværs ancestral populationer. Aktuelle genotype arrays inkluderer ikke alle kendte varianter i det humane genom. I stedet er de udnytte LD inden det humane genom og omfatte en delmængde af de kendte varianter, der fungerer som stedfortrædere for andre varianter inden for en bestemt region i LD 8. Således kan en variant uden biologisk konsekvens være associeret med en bestemt sygdom, fordi det er i LD med den kausale variant-varianten med en meningsfuld biologisk virkning. Proceduremæssigt, anbefales det at konvertere den nyeste version af de 1.000 genomer projekt 9 variant opkald filer (VCF) i binære filer er kompatible med Plink 10,11, et open source-værktøj til hele genomet association analyse. Efterfølgende alle andre genetiske varianter med LD r 2> 0,8 med hver indgang genetiske vaRiant kan identificeres som kandidater. Det er vigtigt at bruge den relevante Referencepopulationen for dette trin for fx hvis en variant blev identificeret i emner af europæisk afstamning, data fra emner af lignende afstamning skal bruges til LD ekspansion.

LD ekspansion resulterer ofte i snesevis af kandidat-varianter, og det er sandsynligt, at kun en lille brøkdel af disse bidrager til sygdom mekanisme. Ofte er det umuligt at eksperimentelt undersøge hver af disse varianter individuelt. Det er derfor nyttigt at udnytte de tusindvis af offentligt tilgængelige funktionelle genomiske datasæt som et filter til at prioritere de varianter. For eksempel har KODE konsortium 12 udført tusindvis af chip-seq eksperimenter beskriver bindingen af TF'er og co-faktorer og histon-mærker i en lang række sammenhænge, ​​sammen med data chromatin accessibility fra teknologier såsom DNase-seq 13, ATAC -seq 14, og FAIRE-seq 15. Databasernes og webservere såsom UCSC Genome Browser 16, køreplanen Epigenomics 17, Blueprint epigenome 18, Cistrome 19, og restere 20 giver fri adgang til data fra disse og andre eksperimentelle teknikker på tværs af en bred vifte af celletyper og betingelser. Når der er for mange varianter at undersøge eksperimentelt, kan disse data anvendes til at prioritere dem, der findes inden for sandsynlige regulatoriske regioner i relevante celle- og vævstyper. I tilfælde, hvor en variant er inden for en chip-seq top for et specifikt protein, kan disse data give potentielle kundeemner som til den specifikke TF (er) eller co-faktorer, hvis binding kan påvirke.

Dernæst resulterende prioriteres varianter screenes eksperimentelt at validere forudsagte genotype-afhængigt protein binding under anvendelse EMSA 21,22. EMSA måler ændringer i vandringen af ​​oligo på et ikke-reducerende TBE gel. Fluorescensmærket oligo inkuberes mednuklear lysat, og binding af nukleare faktorer vil forsinke bevægelsen af ​​oligo på gelen. På denne måde oligo der har bundet flere nukleare faktorer vil præsentere som et stærkere fluorescerende signal ved scanning. Især betyder EMSA ikke kræver forudsigelser om de specifikke proteiner, hvis binding vil blive påvirket.

Når varianter er identificeret som er placeret inden for forudsagte regulatoriske regioner og er i stand til forskelligt bindende nukleare faktorer, der beregningsmetoder ansat til at forudsige den specifikke TF (er), hvis bindende de kan påvirke. Vi foretrækker at bruge CIS-BP 23,24, RegulomeDB 25, UniProbe 26 og Jaspar 27. Når kandidat TF'er er identificeret, kan disse forudsigelser specifikt testet ved hjælp af antistoffer mod disse TF'er (EMSA-supershifts og DAPA-Westerns). En EMSA-supershift indebærer tilsætning af en TF-specifikt antistof til den nukleare lysat og oligo. Et positivt resultat i en EMSA-supershift er Represented som en yderligere forskydning i EMSA band, eller et tab af bandet (revideret i henvisning 28). I den komplementære DAPA, er en 5'-biotinyleret oligo duplex indeholder varianten og 20 basepar flankerende nukleotider inkuberet med nukleare lysat fra relevante celletype (r) til at fange eventuelle nukleare faktorer specifikt binder oligoer. Oligo duplex-nuklear faktor-kompleks immobiliseres ved streptavidin mikroperler i en magnetisk søjle. De bundne nukleare faktorer indsamles direkte gennem eluering 29,48. Bindende forudsigelser kan derefter vurderes ved en Western blot under anvendelse af antistoffer specifikke for proteinet. I tilfælde, hvor der ikke er oplagte forudsigelser, eller for mange forudsigelser, de elueringer fra variant pull-downs af DAPA eksperimenter kan sendes til en proteomics kerne for at identificere kandidat TF'er hjælp massespektrometri, som efterfølgende kan valideres bruge disse tidligere beskrevet metoder.

I den resterende del af article, er den detaljerede protokol for EMSA og DAPA analyse af genetiske varianter forudsat.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Udarbejdelse af løsninger og reagenser

  1. Bestil brugerdefinerede DNA oligonucleotidprober til brug i EMSA og DAPA.
    1. For at reducere ikke-specifik proteinbinding, designe korte oligoer (mellem 35-45 basepar (bp) i længden) 30, og placere variant af interesse direkte i centrum flankeret af sin 17 bp endogene genomiske sekvens. For EMSA oligoer, tilføje en 5 'fluorophor. For DAPA oligoer, tilføje en 5 'biotin tag.
    2. Bestille både sense streng og dens omvendte komplement streng. Alternativt ordre duplex (pre-udglødet) oligoer. Når navngive oligoer, basere nomenklatur på en etableret henvisning genom.
      Bemærk: "Risiko" og "ikke-risiko" betegnelse kan være sygdom og projekt specifik, mens "reference" og "ikke-reference" er mere universelt relevant.
    3. Ved ankomsten af ​​oligoerne kortvarigt vågeblus indhold og resuspender i nuklease-frit vand til en slutkoncentration på 100 μ; M. Opbevares resuspenderet lager ved -20 ° C. Beskyt oligoer tagget med en fluorofor fra lys ved indpakning med aluminiumsfolie.
Navn sekvens
rs76562819_REF_FOR GTAATGCCTTAATGAGAGAG A GTTAGTCATCTTCTCACTTC
rs76562819_REF_REV GAAGTGAGAAGATGACTAAC T CTCTCTCATTAAGGCATTAC
rs76562819_NONREF_FOR GTAATGCCTTAATGAGAGAG G GTTAGTCATCTTCTCACTTC
rs76562819_NONREF_REV GAAGTGAGAAGATGACTAAC C CTCTCTCATTAAGGCATTAC

Tabel 1: Eksempel EMSA / DAPA oligonukleotid design til at teste en SNP for differentiel binding. "REF" står for referencen allel, mens "NONREF" står for den ikke-henvisningen allel. "FOR" står for den fremadrettede streng, mens "REV" angiver dens komplement. SNP'en ses i rødt.

  1. Forbered cytoplasmatisk ekstraktion (CE) buffer med en slutkoncentration på 10 mM HEPES (pH 7,9), 10 mM KCI og 0,1 mM EDTA i deioniseret vand.
  2. Forbered nuklear ekstraktion (NE) buffer med en slutkoncentration på 20 mM HEPES (pH 7,9), 0,4 M NaCl og 1 mM EDTA i deioniseret vand.
  3. Forbered annealing buffer med en slutkoncentration på 10 mM Tris (pH 7,5-8,0), 50 mM NaCl og 1 mM EDTA i deioniseret vand.

2. Udarbejdelse af Nuclear Lysat fra dyrkede celler

Bemærk: Denne forsøgsprotokol blev optimeret ved hjælp B-lymfoblastoide cellelinjer, men er blevet testet i flere andre ubeslægtede tilhænger / suspension cellelinjer og arbejder universelt.

  1. cultuAd b-lymfoblastoide celler i Roswell Park Memorial Institute (RPMI) 1640 med 2 mM L-glutamin, 10% kalvefosterserum og 1 x antibiotikum-antimykotikum indeholdende 100 enheder / ml penicillin, 100 ug / ml streptomycin og 250 ng / ml amphotericin B.
    1. Frø ved en række 200.000-500.000 levedygtige celler / ml og inkuberes kolberne ved 37 ° C med 5% carbondioxid i en oprejst stilling med ventilerede eller løse hætter.
      Bemærk: Væksten i B-lymfoblastoide celler bremser, når de når over 1.000.000 celler / ml. Bryde op celleblaster ved pipettering op og ned flere gange og returnere celler til 200.000-500.000 celler / ml for at opretholde en hurtig vækst.
  2. Vask dyrkede celler to gange med 10 ml iskold phosphatbufret saltvand (PBS), spin ned ved 4 ° C, 300 xg i 5 minutter og fjern PBS via aspiration.
  3. Tæl celler under anvendelse af et hæmocytometer og resuspender pellet som 1 ml iskold PBS per 10 7 celler.
    Bemærk: Hvis f.eks lysering 2 x 10 7 </ Sup> celler, resuspender i 2 ml PBS.
  4. Alikvot 1 ml til 1,5 ml mikrocentrifugerør, således at hvert rør indeholder 10 7 celler i PBS. Centrifuger ved 3.300 xg i 2 min 4 ° C og aspirat fra PBS.
  5. Før anvendelse tilsættes 1 mM dithiothreitol (DTT), 1x phosphatase inhibitor, og 1x protease inhibitor til en fungerende bestand af CE-buffer. Resuspender cellepelleten med 400 pi CE puffer og inkuberes på is i 15 minutter.
  6. Tilsæt 25 pi 10% Nonidet P-40 og blandes ved pipettering. Der centrifugeres ved 4 ° C, max hastighed i 3 minutter. Dekanteres og kassér supernatanten.
  7. Før anvendelse tilsættes 1 mM DTT, 1x phosphatase inhibitor, og 1x protease inhibitor til en fungerende bestand af NE-buffer. Resuspender cellepelleten med 30 pi NE buffer og vortexes.
  8. Der inkuberes ved 4 ° C i en tube rotator eller på is i 10 min. Centrifuger 3.300 xg i 2 min 4 ° C.
  9. Saml den klare supernatant (nuklear lysat) og alikvot før opbevaring ved -806; C for at undgå flere fryse-tø-cykler, der kan nedbryde proteinet. Efterlade en 10 pi alikvot at måle proteinkoncentrationen ved hjælp af bichoninic syre assay (BCA) 31.

3. Elektroforetisk mobilitet (EMSA)

  1. Forbered Oligo Working Stock og EMSA Gel.
    1. Hvis oligoer blev bestilt i duplex, tø 100 uM lager og fortyndes 1: 2000 i annealingpuffer at opnå en 50 nM arbejder lager.
    2. Hvis oligoer blev bestilt enkeltstrenget, optø de 100 uM bestande og fortyndes 1:10 i annealing-puffer til opnåelse af 100 nm arbejdsstamopløsninger. Kombiner 100 pi af 100 nM komplement streng opløsning med hinanden i et mikrocentrifugerør.
      1. Placer i en varmeblok ved 95 ° C i 5 min. Sluk for varmen blok og tillade oligoerne langsomt afkøle til stuetemperatur i mindst en time før anvendelse.
    3. Pre-run EMSA Gel.
      1. Fjern dias fra en præ-cast 6% TBE gel og skyl under deioniseret vand adskillige gange for at fjerne eventuel buffer fra brøndene. Forbered 1 L 0,5x TBE puffer ved tilsætning af 50 ml 10 x TBE til 950 ml deioniseret vand.
      2. Saml gelelektroforese apparat og tjekke for utætheder ved at fylde indre kammer med 0,5x TBE-buffer. Hvis der ikke buffer siver ind i det ydre kammer, fylde det ydre kammer omkring to tredjedele af vejen.
      3. Pre-run gelen ved 100 V i 60 minutter.
      4. Skyl hver brønd med 200 pi 0,5x TBE puffer.
  2. Forbered Binding Buffer Master Mix.
    1. Forbered 10x bindingsbuffer med en slutkoncentration på 100 mM Tris, 500 mM KCI, 10 mM DTT; pH 7,5 i deioniseret vand.
    2. I et mikrocentrifugerør, skabe en master mix bestående af reagenserne er fælles for alle reaktioner (10 pi 10x bindingsbuffer, 10 pi DTT / polysorbat, 5 pi poly-d (IC), og 2,5 pi laksesperm-DNA; tabel 2). Forbered yderligere 10%at tage højde for volumen tab på grund af pipettering.
Reagens Final Conc. Rxn # 1 Rxn # 2 Rxn # 3 Rxn # 4
ultrarent vand til 20 pi vol. 13,5 pi 11.98 pi 13.5μl 11.98 pi
10x Binding Buffer 1x 2 pi 2 pi 2 pi 2 pi
DTT / TW-20 1x 2 pi 2 pi 2 pi 2 pi
Laksesperm DNA 500 ng / pl 0,5 pi 0,5 pi 0,5 pi 0,5 pi
1 pg / pl Poly d (IC) 1 ug 1 pi 1 pi 1 pi 1 pi
Kerneekstrakt (5,26 ug / ul) 8 ug - 1,52 pi - 1,52 pi
NE Buffer 1,52 pi - 1,52 pi -
Henvisning allel oligo 50 fmol 1 pi 1 pi - -
Ikke-reference allel oligo 50 fmol - - 1 pi 1 pi

Tabel 2: Eksempel EMSA reaktion indstilling es. Tabellen illustrerer et eksempel EMSA at teste hypotesen, at der er genotype-afhængig binding af TF'er til en bestemt SNP.

  1. Tilføj nuklease-frit vand til hver mikrocentrifugerør, således at det endelige volumen efter tilsætning af alle reagenser vil være 20 pi.
  2. Tilsæt passende mængde (5,5 pi) master mix til hver mikrocentrifugerør.
  3. Tilføj 8 ug af nukleare lysat til de relevante mikrocentrifugerør. Indbefatter rør indeholdende oligo uden kerneekstrakt som negative kontroller (f.eks tabel 2, Rxn # 1 og Rxn # 3).
    Bemærk: Den optimale mængde lysat pr reaktion skal eksperimentelt bestemmes ved titrering. Generelt titrering en række 2-10 ug lysat er tilstrækkelig.
  4. Tilsæt 50 fmol af oligo til de relevante mikrocentrifugerør. Flick at blande og kortvarigt dreje indholdet til bunden af ​​røret. Inkuber i 20 minutter ved stuetemperatur.
    Bemærk: Hvis attempting et supershift, inkuber lysatet blanding med antistof i 20 minutter ved stuetemperatur før tilsætning af oligoer. Det anbefales at bruge 1 ug en chip-grade antistof for de bedste resultater.
  5. Tilsæt 2 pi 10x Orange Loading Dye til hvert mikrocentrifugerør. Pipettere op og ned for at blande.
  6. Indlæse prøverne ind i præ-run 6% TBE-gel ved pipettering op og ned for at blande og derefter udstøde hver prøve i en separat brønd. Kør gel ved 80 V, indtil den orange farve har migreret 2/3 til 3/4 af vejen ned gelen. Dette bør tage ca 60-75 min.
  7. Fjern gelen fra plasten kassetten ved at lirke den åben med en gel kniv og placere gelen i en beholder med 0,5% TBE buffer at holde det fra udtørring.
  8. Gelen anbringes på overfladen af ​​en infrarød og kemiluminescens imaging system, være sikker på at eliminere eventuelle bobler eller kontaminanter, som vil forstyrre billedet.
  9. Brug af scanning systemsoftware, skal du klikke på fanen "Acquire"og derefter vælge "Draw Ny" for at tegne en boks omkring det område, der svarer til, hvor gelen er placeret på overfladen af ​​scanneren.
  10. I afsnittet "Kanaler" under fanen "Acquire", vælge den kanal, der svarer til bølgelængden af ​​fluoroforen tag på oligo. I afsnittet "Scanner", klik på "Preview" for at få en lav kvalitet forhåndsvisning scanning. Juster scanningsområdet ved at trække den blå boks omkring erhvervede eksempelbilledet ned til den del af gelen, der skal afbildes.
    Bemærk: For eksempel, hvis du bruger oligoer mærket med en 700 nm fluorophor, skal du sørge for "700 nm" kanal er valgt før scanning.
  11. I afsnittet "Scan Controls", skal du vælge "84 uM" opløsning option og "Medium" kvalitet mulighed. Indstil fokus til offset til halvdelen af ​​tykkelsen af ​​gelen. Bemærk: For eksempel ville en 1 mm gel bruge en 0,5 mm fokus offset.
  12. I afsnittet "Scanner", klik på "Start" til beGIN scanningen.
    Bemærk: Under scanningen kan lysstyrke, kontrast og farve ordningen ofte justeres manuelt afhængigt af producenten af ​​scanning system.
  13. Når scanningen er færdig, skal du vælge fanen "Image" og klik på "Roter eller Spejlvend" i afsnittet "Opret" for at korrigere retningen. Gem billedfilen ved at klikke på "Export" i hovedmenuen og derefter vælge "Enkelt billede View."

4. DNA Affinity Purification assay (DAPA)

  1. Udarbejdelse af 5 uM Oligo Working Stock.
    1. Hvis oligoer blev bestilt i duplex, tø 100 uM lager og fortyndes 1:20 i annealingpuffer at opnå en 5 uM arbejder lager.
    2. Hvis oligoer blev beordret enkeltstrenget, tø de 100 uM lagre og fortyndes 1:10 i annealingpuffer at opnå 10 uM arbejder bestande. Kombiner 10 pi af de 10 uM komplementære strenge med hinanden. Sted i en varmeblok ved 95 ° C i5 min. Sluk for varmen blok og tillade oligoerne langsomt afkøle til stuetemperatur før brug.
  2. Før start, varme bindingsbuffer, lav stringens vaskebuffer, høj stringens vaskebuffer, og elueringspufferen til stuetemperatur.
    Bemærk: En slutkoncentration på 50 ng / mL Poly d (IC) kan sættes til den bindende buffer, lav stringens vaskebuffer, og høj stringens vaskebuffer for at reducere potentielle ikke-specifik binding af proteiner til oligoerne.
  3. Forbered bindingsblandingerne for hver variant.
    1. 1 rumfang nuklear lysat med 2 volumener bindingsbuffer.
      Bemærk: Den nødvendige mængde lysat skal eksperimentelt bestemmes på grund af skiftende overflod af TF'er. Brug mellem 100-250 ug nukleare lysat pr kolonne er tilstrækkelig i de fleste tilfælde.
    2. Tilføj 1x phosphataseinhibitor, 1x proteasehæmmer, og 1x bindende forstærker (ekstraudstyr) og bland ved at stille røret flere gange.
      Bemærk: 100X bindendeenhancer består af 750 mM MgCl2 og 300 mM ZnCI2. Tilføj bindende enhancer hvis bindingen af ​​TF til DNA afhænger af cofaktorer eller reduktionsmidler. Hvis denne information ikke er kendt, tilsæt bindende forstærker.
    3. Tilsæt 10 pi af 5 uM biotinyleret capture DNA (50 pmol) til hver respektiv bindingsblanding. Inkuber i 20 minutter ved stuetemperatur.
      Bemærk: Inkubationstid og temperatur kan variere afhængigt af TF. De optimale værdier skal bestemmes eksperimentelt.
  4. Tilsæt 100 pi streptavidin mikroperler. Inkuber i 10 minutter ved stuetemperatur.
  5. For hver oligo-probe, der testes, anbringes et bindende søjle i den magnetiske separator. Placer et mikrocentrifugerør direkte under hver bindende søjle og anvende 100 pi bindingsbuffer for at skylle kolonnen.
  6. Pipette indholdet af hver bindende blanding i separate kolonner og tillade væske at strømme fuldstændigt gennem søjlen ind i mikrocentrifugerør, før du fortsætter. Sørg for at mærke kolonnerne med varianten oligo, der blev brugt i den bindende blanding. Mærk gennemstrømning prøver og erstatte med nye mikrocentrifugerør at indsamle de lave stringente vaske.
  7. Påfør 100 pi lav stringens vaskebuffer til søjlen; vente, indtil kolonnen reservoir er tom. Gentag vask 4x. Mærke de lave stringens vask prøver og erstatte med nye mikrocentrifugerør at indsamle de høje stringens vaske.
  8. Påfør 100 pi høj stringens vaskebuffer til søjlen; vente, indtil kolonnen reservoir er tom. Gentag vask 4x. Mærke de højstringensvask prøver og erstatte med nye mikrocentrifugerør at indsamle de præ-eluering.
  9. Tilsæt 30 pi nativt elueringspuffer til kolonnen og lad stå i 5 min. Mærk de præ-eluering prøver og erstatte med nye mikrocentrifugerør at indsamle eluering.
    Bemærk: Det er ikke elueres det bundne protein; det vasker den resterende høj stringensbuffer ud af søjlen og erstatter den med elueringsbuffer at maksimere effektiviteten af ​​elueringen.
  10. Tilføj yderligere 50 pi indfødte elueringsbuffer til eluering de bundne TF'er. For et højere udbytte, men mindre koncentreret eluat, tilføje yderligere 50 pi nativt elueringsbuffer og indsamle gennemløbet.
    Bemærk: Analyser elueringsbetingelser prøver gennem massespektrometri til bestemmelse af identiteten af den bundne TF'er 32. Bagefter kontrollere proteomik resultater gennem natrium dodecyl sulfit polyacrylamidgelelektroforese (SDS-PAGE) efterfulgt af et Western blot 33. Hvis massespektrometri ikke er tilgængelig, køre en sølvfarve hjælp af standard teknik i stedet for et Western blot for at bestemme størrelsen af ​​protein (er), der viser genotype-afhængig binding. Brug disse oplysninger til at indsnævre listen med forudsagte TF'er fra de beregningsmæssige metoder beskrevet i indledningen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

I dette afsnit er repræsentative resultater af hvad forventer leveres, når der udføres en EMSA eller DAPA, og variabilitet med hensyn til kvaliteten af ​​lysatet er karakteriseret. For eksempel er det blevet foreslået, at nedfrysning og optøning proteinprøver flere gange kan resultere i denaturering. For at undersøge reproducerbarheden af ​​EMSA analyse i forbindelse med disse "fryse-tø" cykler blev to 35 bp oligoer afviger på en genetisk variant inkuberes med et enkelt parti af nukleart lysat der blev optøet og re-frosset for det angivne beløb . gange Figur 2 viser, at nedfrysning og optøning denne særlige B-lymfocyt kerneekstrakt op til 5 gange har tilsyneladende ingen effekt på integriteten af proteinerne; dog stabilitet kerneprotein varierer efter prøverne og bør derfor testet på hver enkelt cellelinie anvendes. Det er også muligt at have variation fra forskellige batch prepartioner af nukleare lysater. Hvorvidt denne variation skyldes den fase af cellecyklussen inden lyse, celle passage nummer, eller andre faktorer, er det vigtigt at replikere EMSA resultater under anvendelse af forskellige batches af lysat at sikre reelle resultater.

Desuden er det vigtigt at optimere signal-støj-forholdet for EMSA. En vigtig variabel i dette er oligo koncentration. Mængden af oligo (5-300 fmol) blev titreret til at vurdere, hvordan forskellige mængder oligoer påvirke signalet (figur 3). En stigning i intensiteten af ​​båndet på op til 100 fmol af oligo blev observeret. Efter dette tidspunkt signalet plateauer tyder 100 fmol er den optimale oligo beløb for denne EMSA reaktion.

Endelig en repræsentativt tal fra en af vores offentliggjorte undersøgelser bruger en del af den er beskrevet i dette manuskript strategi forudsat (figur 4). I ther undersøgelse 34 viste vi, at lupus-associerede risiko allel af rs6590330 øger binding af STAT1, en ​​transkriptionsfaktor, der deltager i både synergistisk aktivering og inhibering af genekspression nedstrøms for type 1 IFN-receptorkomplekset 35. I dette eksempel blev STAT1 først identificeret ved DAPA efterfulgt af proteomisk analyse under anvendelse højtryksvæskekromatografi koblet til tandem massespektroskopi (DAPA-MS). En DAPA-Western blot blev anvendt til at bekræfte TF identificeret fra proteomanalyse (STAT1) og bekræfte, at den phosphorylerede form af STAT1 blev binding til den ikke-reference (lupus-risiko) oligo. Denne figur illustrerer, hvordan de forskellige assays i denne strategi kan anvendes til at identificere forskellen binding af transkriptionsfaktor til en ikke-kodende variant.

Figur 2
Figur 2: Analyse af reproducerbarhedog konsekvenserne af fryse-tø cyklusser på EMSA resultater. oliqoer indeholder henvisningen (R) eller ikke-reference (NR) allel af et genetisk variant blev anvendt til at probe det samme præparat af lysat efter multiple cyklusser af nedfrysning og optøning. (Lys: Lysate). Hver bane indeholder den frie probe ved bunden af ​​gelen (blå pil). Binding af TFS til oligo kan ses som et bånd i den øverste halvdel af gelen (rød pil). Bands indeholdt i den nederste halvdel af gelen (se beslag) er ikke-specifikke. Klik her for at se en større version af dette tal.

Figur 3
Figur 3:. Vurdering af virkningen af forskellige oligo koncentrationer Forskellige koncentrationer af oligo'er blev anvendt til at probe et enkelt præparat af nuklear lysat. Fluorescent signal stiger med forøgede mængder oligo, hvilket indikerer, at oligo er den begrænsende reagens. De signal plateauer ved de 100-300 fmol baner, hvor mængden af protein bliver den begrænsende reagens. Klik her for at se en større version af dette tal.

Figur 4
Figur 4: Den lupus-risiko allel af rs6590330 øger STAT1 binding, som vurderet af DAPA-MS STAT1 og pSTAT1 udviser højere binding til oligoer der indeholder rs6590330 risikoen allel forhold til de ikke-risiko allelen.. Biotinmærkede oligoer blev inkuberet med Epstein-Barr-virus-transformerede B-celle kerneekstrakt. Proteiner bundet til oligo blev taget med DAPA. Proteiner blev derefter separeret ved SDS-polyacrylamidgelelektroforese og detekteret ved anvendelse af anti-pSTAT1(A) eller anti-STAT1 (B). M: Marker. NR: oligo indeholdende det ikke-risiko allel af rs6590330; R: oligo indeholdende risikoen allel af rs6590330; Mutant: oligo indeholdende et afbrudt formodet STAT1 bindingssted nedstrøms for rs6590330; Cellelysat: nuklear ekstrakt fra B-celler. De relative intensiteter af båndene er angivet nedenfor hvert bånd. Resultaterne er repræsentative for fire eksperimenter; mens alle eksperimenter påviste øget STAT1 binding til proberne med risiko allelen, i 2/4 eksperimenter ingen STAT1 eller pSTAT1 blev påvist i immunopræcipitatet fra den ikke-risiko oligo, mens begge blev påvist i immunopræcipitatet mod risikoen oligo. Dette tal har været ændret siden henvisning 34. Klik her for at se en større version af dette tal.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Selvom fremskridt inden sekventering og genotypebestemmelse teknologier i høj grad har forbedret vores evne til at identificere genetiske varianter associeret med sygdom, er vores evne til at forstå de funktionelle mekanismer påvirket af disse varianter halter. En vigtig kilde til problemet er, at mange sygdomsassocierede varianter er beliggende i n on-kodende områder af genomet, som sandsynligvis påvirker vanskelige at forudsige mekanismer, der styrer genekspression. Her præsenteres en protokol baseret på EMSA og DAPA teknikker, værdifulde molekylære værktøjer til identifikation genotype-afhængig TF bindende begivenheder, der sandsynligvis bidrager til funktionen af ​​mange ikke-kodende varianter. Selv om disse to teknikker er blevet anvendt i vid udstrækning i fortiden, de har først for nylig blevet tilpasset til genetisk variant analyse af TF binding. Beyond TFS kan EMSA også bruges til at analysere effekten af genetiske varianter på RNA-bindende proteiner med kun mindre justeringer af protokol 36.

ove_content "> Protokollen præsenteret heri er enkel og let at udføre,. alligevel, visse dele kræve yderligere overvejelser forud for eksperimenteren det første er det vigtigt at generere en første liste over varianter til behandling ved at udføre strenge statistiske analyser En fejl i dette trin. kan afspore alle downstream analyser, som mange varianter kan binde nukleare lysat differentielt uden at bidrage til sygdomsrisiko. Derudover anvendelsen af ​​funktionelle genomics data udføres i relevante celletyper er afgørende, kan som irrelevante celletyper føre til dannelse af falsk positive TF binding kan fås forudsigelser. i øjeblikket er de mest udbredte funktionelle genomiske ressourcer omfatter KODE 12 og køreplanen Epigenomics 17. Yderligere oplysninger om genekspression niveauer i celletyper er relevante for en sygdom af interesse fra andre ressourcer såsom ImmGen 37, BioGPS 38, 39, og SNPsea 20. For eksempel sådan ressources kan anvendes til at filtrere TF bindende forudsigelser til kun indbefatter de TF'er, der udtrykkes i relevante celletyper.

Det er også vigtigt at overveje forbehold af in vitro forsøg som EMSA og DAPA. Især er det nødvendigt at gentage forsøgene med separate nuklear lysat præparater færre falske negativer. Endvidere kan en succesfuld EMSA-supershift stede som en yderligere forskydning i EMSA-båndet, i hvilket antistof binder til TF, eller et tab af bånd, hvori antistoffet blokerer TF DNA bindende domæne. I begge scenario, herunder en isotypekontrolantistof og / eller et antistof mod en anden TF er nyttig til bekræftelse af specificiteten af ​​supershift. En anden overvejelse i at udføre en supershift er, om at inkludere DTT / polysorbat i reaktionen. DTT / polysorbat stabiliserer lastning farvestof giver mulighed for mere præcis kvantificering af ubundet DNA; det kan imidlertid også reducere disulfidbindinger af antistoffer resultereing i svigt af EMSA-supershift. Det anbefales at prøve reaktioner med og uden DTT / polysorbat når de forsøger at supershift et kompleks. Den optimale mængde Poly d (IC) og laksesperm DNA pr reaktionen skal bestemmes eksperimentelt ved titrering. Generelt titrering en række 1-6 ug poly d (IC) og 50-500 ng laksesperm er tilstrækkelig. En anvendelig positiv kontrol for DAPA indebærer anvendelse af en konsensussekvens for et TF med en velkarakteriseret bindende motiv (opnået fra databaser, såsom CIS-BP 23 eller Factorbook 40) og løber en Western med et antistof specifikt for den pågældende TF. For begge assays, kan en kodet oligo anvendes til at vise, at enhver observeret binding er specifik for oligoerne af interesse.

Både EMSA og DAPA teknikker har eksperimentelle begrænsninger. For eksempel er bindingsaffiniteten mellem en TF og DNA påvirkes i stor del af bufferbetingelserne. Ideelt set bør pufferbetingelser efterligne det endogene conditions af kernen for at tillade optimal binding. For EMSA, ved uhensigtsmæssig pufferbetingelser resultere i et svagt bånd eller tab af et bånd helt. For DAPA kan ikke-ideelle betingelser forårsage TF (er), der skal elueres under vasketrinene. Derfor hver analyse er kun effektiv i at identificere TF-oligo binding under visse pufferbetingelser. De mest universelt anvendelige pufferbetingelser er vist i protokollen ovenfor. En anden begrænsning er, at de eksperimentelle resultater fra EMSA og DAPA metoder giver ringe information om de mekanismer, hvorigennem TF'er binder til oligoerne. TF'er kunne binde til oligoer direkte eller blive ansat af andre faktorer. Det er derfor vigtigt at analysere oligo sekvenser beregningsmæssigt at forudsige, hvordan TF'er kan binde til oligoer og verificere disse forudsigelser eksperimentelt. For eksempel kan en specifik bindingssekvens være muteret eller en bindingspartner kan eksperimentelt udtømt. Endelig mængden af ​​ekstrakt anvendte behov, som skal titreres for hvert forsøg to erhverve optimale resultater. For meget lysat kan mætte TF-oligo binding og sløre forskellen binding mellem risiko- og ikke-risiko alleler. For yderligere fejlfinding, kan læseren henvises til flere gode anmeldelse og metode manuskripter 30,41,42.

Udover analyserne beskrevet her, er der en række forskellige in vivo-assays tilgængelige for yderligere at undersøge den rolle, varianter i levende celler (figur 1, nederst). Kromatin immunofældning efterfulgt af allel-specifikke kvantitative polymerase kædereaktioner (chip-qPCR) kan foretages undersøgelser for at identificere, hvis den differentierede binding observeret inden for de in vitro assays replikeres i levende celler 34. For eksempel, hvis der anvendes celler heterozygote for en variant af interesse, kan qPCR eksperimenter registrere forskellen i berigelse mellem de to alleler i TF immunpræcipiteret kromatin. Chip kræver specifikke chip-grade antistoffer; However, hvis chip-grade TF antistoffer er tilgængelige, transfektion af celler med et flag-mærket TF er et effektivt alternativ 43. Derudover kan effekten af forskellen bindende for target genekspression undersøges gennem udtryk kvantitativ trait loci (eQTL) analyser på relevante celletyper ved hjælp af lokalt indsamlede udtryk data fra genotypede celler eller offentligt tilgængelige ressourcer som dem udarbejdet af Genevar 44. Luciferase reporter assays kan også anvendes til at undersøge, i hvilket omfang differentiel binding af proteinet påvirker genekspression. Sådanne assays kan modificeres til at arbejde, uanset om varianterne er placeret i en promotor, enhancer eller repressor region 45-47. Endelig genom-redigering teknologier, såsom CRISPR / Cas9 48, kan bruges til at generere cellelinjer, som kun afviger ved en enkelt variant, som er afgørende for bekræftelse årsagssammenhæng. Sådanne teknologier kan væsentligt reducere den eksperimentelle varians observeret between cellelinier afledt fra genetisk forskellige individer, eftersom funktionelle udlæsninger analysere genekspression eller en anden sygdom mellemliggende fænotype kan udføres på den redigerede celle-linie, og sammenlignet med ikke-redigerede cellelinjer.

Den største fordel ved den strategi, er, at den muliggør let og hurtig påvisning af genotype-afhængig TF binding. Ved at prioritere de vigtigste genetiske varianter, kan yderligere eksperimenter være designet til at identificere deres biologiske effekt og demonstrere deres kausalitet. Især kan denne protokol anvendes til at undersøge enhver sygdom eller fænotype associeret variant identificeret fra GWAS eller fine-mapping. En stor, voksende guldgrube af genetiske data og lister over statistisk tilknyttede genetiske varianter er allerede tilgængelige. I de fleste tilfælde er de biologiske mekanismer køre statistisk sammenslutning af disse varianter er ikke klart. Strategien i dette forslag giver mulighed for præcis funktionel fortolkning af de mange ikke-kodende diseaSE-associerede varianter. En sådan viden er afgørende for den fulde belysning af de molekylære mekanismer der driver enhver genetisk-baseret sygdom.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre.

Materials

Name Company Catalog Number Comments
Custom DNA Oligonucleotides Integrated DNA Technologies http://www.idtdna.com/site/order/oligoentry
Potassium Chloride Fisher Scientific BP366-500 KCl, for CE buffer
HEPES (1 M) Fisher Scientific 15630-080 For CE and NE buffer
EDTA (0.5M), pH 8.0 Life Technologies R1021 For CE, NE, and annealing buffer
Sodium Chloride Fisher Scientific BP358-1 NaCl, for NE buffer
Tris-HCl (1M), pH 8.0 Invitrogen BP1756-100 For annealing buffer
Phosphate Buffered Saline (1x) Fisher Scientific MT21040CM PBS, for cell wash
DL-Dithiothreitol solution (1 M) Sigma 646563 Reducing agent
Protease Inhibitor Cocktail Thermo Scientific 87786 Prevents catabolism of TFs
Phosphatase Inhibitor Cocktail  Thermo Scientific 78420 Prevents dephosphorylation of TFs
Nonidet P-40 Substitute IBI Scientific IB01140 NP-40, for nuclear extraction
BCA Protein Assay Kit Thermo Scientific 23225 For measuring protein concentration
Odyssey EMSA Buffer Kit Licor 829-07910 Contains all necessary EMSA buffers
TBE Gels, 6%, 12 Wells Invitrogen EC6265BOX For EMSA
TBE Buffer (10x) Thermo Scientific B52 For EMSA
FactorFinder Starting Kit Miltenyi Biotec 130-092-318 Contains all necessary DAPA buffers
Licor Odyssey CLx Licor Recommended scanner for DAPA/EMSA
Antibiotic-Antimycotic Gibco 15240-062 Contains 10,000 units/ml of penicillin, 10,000 µg/ml of streptomycin, and 25 µg/ml of Fungizone® Antimycotic
Fetal Bovine Serum Gibco 26140-079 FBS, for culture media
RPMI 1640 Medium Gibco 22400-071 Contains L-glutamine and 25 mM HEPES

DOWNLOAD MATERIALS LIST

References

  1. Hindorff, L. A., et al. Potential etiologic and functional implications of genome-wide association loci for human diseases and traits. Proc Natl Acad Sci U S A. 106, (23), 9362-9367 (2009).
  2. Maurano, M. T., et al. Systematic localization of common disease-associated variation in regulatory DNA. Science. 337, (6099), 1190-1195 (2012).
  3. Ward, L. D., Kellis, M. Interpreting noncoding genetic variation in complex traits and human disease. Nat Biotechnol. 30, (11), 1095-1106 (2012).
  4. Paul, D. S., Soranzo, N., Beck, S. Functional interpretation of non-coding sequence variation: concepts and challenges. Bioessays. 36, (2), 191-199 (2014).
  5. Zhang, F., Lupski, J. R. Non-coding genetic variants in human disease. Hum Mol Genet. (2015).
  6. Lee, T. I., Young, R. A. Transcriptional regulation and its misregulation in disease. Cell. 152, (6), 1237-1251 (2013).
  7. Slatkin, M. Linkage disequilibrium--understanding the evolutionary past and mapping the medical future. Nat Rev Genet. 9, (6), 477-485 (2008).
  8. Bush, W. S., Moore, J. H. Chapter 11: Genome-wide association studies. PLoS Comput Biol. 8, (12), e1002822 (2012).
  9. 1000 Genomes Project Consortium. An integrated map of genetic variation from 1,092 human genomes. Nature. 491, (7422), 56-65 (2012).
  10. Chang, C. C., et al. Second-generation PLINK: rising to the challenge of larger and richer datasets. Gigascience. 4, 7 (2015).
  11. Purcell, S., et al. PLINK: a tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet. 81, (3), 559-575 (2007).
  12. ENCODE Project Consortium. An integrated encyclopedia of DNA elements in the human genome. Nature. 489, (7414), 57-74 (2012).
  13. Crawford, G. E., et al. Genome-wide mapping of DNase hypersensitive sites using massively parallel signature sequencing (MPSS). Genome Res. 16, (1), 123-131 (2006).
  14. Buenrostro, J. D., Giresi, P. G., Zaba, L. C., Chang, H. Y., Greenleaf, W. J. Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nat Methods. 10, (12), 1213-1218 (2013).
  15. Giresi, P. G., Kim, J., McDaniell, R. M., Iyer, V. R., Lieb, J. D. FAIRE Formaldehyde-Assisted Isolation of Regulatory Elements) isolates active regulatory elements from human chromatin. Genome Res. 17, (6), 877-885 (2007).
  16. Kent, W. J., et al. The human genome browser at UCSC. Genome Res. 12, (6), 996-1006 (2002).
  17. Roadmap Epigenomics Consortium. Integrative analysis of 111 reference human epigenomes. Nature. 518, (7539), 317-330 (2015).
  18. Martens, J. H., Stunnenberg, H. G. BLUEPRINT: mapping human blood cell epigenomes. Haematologica. 98, (10), 1487-1489 (2013).
  19. Liu, T., et al. Cistrome: an integrative platform for transcriptional regulation studies. Genome Biol. 12, (8), R83 (2011).
  20. Griffon, A., et al. Integrative analysis of public ChIP-seq experiments reveals a complex multi-cell regulatory landscape. Nucleic Acids Res. 43, (4), e27 (2015).
  21. Staudt, L. M., et al. A lymphoid-specific protein binding to the octamer motif of immunoglobulin genes. Nature. 323, (6089), 640-643 (1986).
  22. Singh, H., Sen, R., Baltimore, D., Sharp, P. A. A nuclear factor that binds to a conserved sequence motif in transcriptional control elements of immunoglobulin genes. Nature. 319, (6049), 154-158 (1986).
  23. Weirauch, M. T., et al. Determination and inference of eukaryotic transcription factor sequence specificity. Cell. 158, (6), 1431-1443 (2014).
  24. Ward, L. D., Kellis, M. HaploReg: a resource for exploring chromatin states, conservation, and regulatory motif alterations within sets of genetically linked variants. Nucleic Acids Res. 40, (Database issue), D930-D934 (2012).
  25. Boyle, A. P., et al. Annotation of functional variation in personal genomes using RegulomeDB. Genome Res. 22, (9), 1790-1797 (2012).
  26. Hume, M. A., Barrera, L. A., Gisselbrecht, S. S., Bulyk, M. L. UniPROBE, update 2015: new tools and content for the online database of protein-binding microarray data on protein-DNA interactions. Nucleic Acids Res. 43, (Database issue), D117-D122 (2015).
  27. Mathelier, A., et al. JASPAR 2014: an extensively expanded and updated open-access database of transcription factor binding profiles. Nucleic Acids Res. 42, (Database issue), 142-147 (2014).
  28. Smith, M. F. Jr, Delbary-Gossart, S. Electrophoretic Mobility Shift Assay (EMSA). Methods Mol Med. 50, 249-257 (2001).
  29. Franza, B. R., Josephs, S. F., Gilman, M. Z., Ryan, W., Clarkson, B. Characterization of cellular proteins recognizing the HIV enhancer using a microscale DNA-affinity precipitation assay. Nature. 330, (6146), 391-395 (1987).
  30. LI-COR. Odyssey Infrared EMSA Kit: Instruction Manual. Available from: http://www.licor.com/bio/pack_inserts/?pi=829-07910 (2014).
  31. Thermo Fisher Scientific, Inc. BCA Protein Assay Kit: User Guide. Available from: https://tools.thermofisher.com/content/sfs/manuals/MAN0011430_Pierce_BCA_Protein_Asy_UG.pdf (2014).
  32. Wijeratne, A. B., et al. Phosphopeptide separation using radially aligned titania nanotubes on titanium wire. ACS Appl Mater Interfaces. 7, (21), 11155-11164 (2015).
  33. Silva, J. M., McMahon, M. The Fastest Western in Town: A Contemporary Twist on the Classic Western Blot Analysis. J. Vis. Exp. (84), (2014).
  34. Lu, X., et al. Lupus Risk Variant Increases pSTAT1 Binding and Decreases ETS1 Expression. Am J Hum Genet. 96, (5), 731-739 (2015).
  35. Ramana, C. V., Chatterjee-Kishore, M., Nguyen, H., Stark, G. R. Complex roles of Stat1 in regulating gene expression. Oncogene. 19, (21), 2619-2627 (2000).
  36. Fillebeen, C., Wilkinson, N., Pantopoulos, K. Electrophoretic Mobility Shift Assay (EMSA) for the Study of RNA-Protein Interactions: The IRE/IRP Example. J. Vis. Exp. (94), e52230 (2014).
  37. Heng, T. S., Painter, M. W. Immunological Genome Project, C. The Immunological Genome Project: networks of gene expression in immune cells. Nat Immunol. 9, (10), 1091-1094 (2008).
  38. Wu, C., et al. BioGPS: an extensible and customizable portal for querying and organizing gene annotation resources. Genome Biol. 10, (11), R130 (2009).
  39. Wu, C., Macleod, I., Su, A. I. BioGPS and MyGene.info: organizing online, gene-centric information. Nucleic Acids Res. 41, (Database issue), D561-D565 (2013).
  40. Wang, J., et al. Sequence features and chromatin structure around the genomic regions bound by 119 human transcription factors. Genome Res. 22, (9), 1798-1812 (2012).
  41. Holden, N. S., Tacon, C. E. Principles and problems of the electrophoretic mobility shift assay. J Pharmacol Toxicol Methods. 63, (1), 7-14 (2011).
  42. Miltenyi Biotec, Inc. µMACS FactorFinder Kit: Data sheet. Available from: http://www.miltenyibiotec.com/en/products-and-services/macsmolecular/protein-research/biotinylated-molecule-isolation/macs-factorfinder-kit.aspx (2014).
  43. Xu, J., Liu, H., Park, J. S., Lan, Y., Jiang, R. Osr1 acts downstream of and interacts synergistically with Six2 to maintain nephron progenitor cells during kidney organogenesis. Development. 141, (7), 1442-1452 (2014).
  44. Yang, T. -P., et al. Genevar: a database and Java application for the analysis and visualization of SNP-gene associations in eQTL studies. Bioinformatics. 26, (19), 2474-2476 (2010).
  45. Fort, A., et al. A liver enhancer in the fibrinogen gene cluster. Blood. 117, (1), 276-282 (2011).
  46. Solberg, N., Krauss, S. Luciferase assay to study the activity of a cloned promoter DNA fragment. Methods Mol Biol. 977, 65-78 (2013).
  47. Rahman, M., et al. A repressor element in the 5'-untranslated region of human Pax5 exon 1A. Gene. 263, (1-2), 59-66 (2001).
  48. Mali, P., et al. RNA-Guided Human Genome Engineering via Cas9. Science. 339, (6121), 823-826 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics