Screening för funktionell icke-kodande genetiska varianter Använda Elektro Mobility Shift Assay (EMSA) och DNA-affinitet Nederbörd analys (DAPA)

* These authors contributed equally
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Miller, D. E., Patel, Z. H., Lu, X., Lynch, A. T., Weirauch, M. T., Kottyan, L. C. Screening for Functional Non-coding Genetic Variants Using Electrophoretic Mobility Shift Assay (EMSA) and DNA-affinity Precipitation Assay (DAPA). J. Vis. Exp. (114), e54093, doi:10.3791/54093 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Sekvensering och genotypning baserade studier, inklusive Genomvid associationsstudier (GWAS), kandidat locus studier och djupsekvense studier har identifierat många genetiska varianter som statistiskt är associerade med en sjukdom, drag eller fenotyp. I motsats till tidigare prognoser, de flesta av dessa varianter (85-93%) är belägna i icke-kodande regioner och ändrar inte aminosyrasekvensen av proteiner 1,2. Tolka funktion av dessa icke-kodande varianter och bestämma de biologiska mekanismerna som förbinder dem till associerad sjukdom, har drag, eller fenotyp visat utmanande 3-6. Vi har utvecklat en övergripande strategi för att identifiera de molekylära mekanismer som länkar varianter till en viktig mellan fenotyp - genuttryck. Denna pipeline är särskilt utformade för att identifiera moduleringen av TF bindning av genetiska varianter. Denna strategi kombinerar beräkningsmetoder och molekylärbiologiska tekniker som syftar till att förutsägabiologiska effekter av kandidat varianter i silico och verifiera dessa förutsägelser empiriskt (Figur 1).

Figur 1
Figur 1:.. Strategi för analys av icke-kodande genetiska varianter Steg som inte ingår i den detaljerade protokoll i samband med detta manuskript är skuggade i grått Klicka här för att se en större version av denna siffra.

I många fall är det viktigt att börja med att utöka listan över varianter att omfatta alla de i hög linkage-ojämvikt (LD) med varje statistiskt samband variant. LD är ett mått på icke-slumpmässigt association av alleler vid två olika kromosomala positioner, som kan mätas av r 2 statistik 7. r 2 är ett mått på linKage obalans mellan två varianter, med en r 2 = 1 betecknar perfekt koppling mellan två varianter. Alleler i hög LD befinns samtidigt segregera på kromosomen över släkt- befolkningar. Nuvarande genotypning arrayer inkluderar inte alla kända varianter i det mänskliga genomet. Istället utnyttjar LD inom det mänskliga genomet och inkludera en delmängd av de kända varianter som fungerar som ombud för andra varianter inom en viss region i LD 8. Således kan en variant utan någon biologisk konsekvens vara associerad med en särskild sjukdom eftersom det är i LD med orsaks variant-varianten med en meningsfull biologisk effekt. Procedurmässigt är det rekommenderat att konvertera den senaste versionen av 1000 genomen projektet 9 variant samtals filer (VCF) till binära filer som är kompatibla med Plink 10,11, ett open-source verktyg för hela genomet associationsanalys. Därefter alla andra genetiska varianter med LD r 2> 0,8 med varje ingång genetisk variant kan identifieras som kandidater. Det är viktigt att använda den tillämpliga referenspopulationen för denna steg t ex om en variant identifierades i frågor av europeisk härkomst, data från patienter med liknande härkomst ska användas för LD expansion.

LD expansionen resulterar ofta i dussintals kandidat varianter, och det är troligt att endast en liten del av dessa bidrar till sjukdomsmekanismen. Ofta är det omöjligt att experimentellt undersöka var och en av dessa varianter individuellt. Det är därför lämpligt att utnyttja de tusentals offentligt tillgängliga funktionsgenomiska datamängder som ett filter för att prioritera varianter. Till exempel har ENCODE konsortiet 12 utfört tusentals Chip-punkter experiment som beskriver bindningen av TF och co-faktorer, och histon märken i en rad olika sammanhang, tillsammans med kromatin tillgänglighetsdata från teknik såsom DNas-punkter 13, ATAC -seq 14, och FAIRE-seq 15. DatabALL och webbservrar som UCSC Genome Browser 16, färdplan Epigenomics 17, Blueprint Epigenome 18, Cistrome 19, och mappa 20 ger fri tillgång till data som produceras av dessa och andra experimentella metoder inom ett brett spektrum av celltyper och villkor. När det finns för många varianter att undersöka experimentellt, kan dessa data användas för att prioritera de som ligger inom troliga reglerande regioner inom relevanta cell- och vävnadstyper. Vidare, i de fall där en variant inom en chip-punkter topp för ett specifikt protein, kan dessa uppgifter ger potentiella kunder som den specifika TF (s) eller co-faktorer vars bindning kan påverka.

Därefter de resulterande prioriterade varianter screenas experimentellt att validera förutspått genotyp beroende proteinbindning med hjälp av EMSA 21,22. EMSA mäter förändringar i migreringen av oligo på en icke-reducerande TBE-gel. Fluorescensmärkt oligo inkuberas mednukleära lysat, och bindning av nukleära faktorer kommer att fördröja rörelsen av oligo på gelén. På detta sätt, oligo som har bunden fler nukleära faktorer kommer att presentera som en starkare fluorescerande signal vid scanning. Noterbart är inte EMSA inte kräva förutsägelser om de specifika proteiner vars bindning kommer att påverkas.

När varianter identifieras som är belägna inom förutsedda regulatoriska regioner och är i stånd att differentiellt bindande kärn faktorer, är beräkningsmetoder som används för att förutsäga specifika TF (s) vars bindande de kan påverka. Vi föredrar att använda CIS-BP 23,24, RegulomeDB 25 UniProbe 26, och Jaspar 27. När kandidat TF har identifierats, kan dessa förutsägelser specifikt testas med hjälp av antikroppar mot dessa TF (EMSA-supershifts och DAPA-Westerns). En EMSA-supershift innebär tillsättning av en TF-specifik antikropp mot den nukleära lysat och oligo. Ett positivt resultat i en EMSA-supershift är represented som en ytterligare förskjutning i EMSA-bandet, eller en förlust av bandet (översikt i referens 28). I den komplementära DAPA är en 5'-biotinylerad oligo duplex innehållande varianten och 20 baspar som flankerar nukleotider inkuberas med kärn lysat från relevant celltyp (s) för att fånga några nukleära faktorer som specifikt binder oligos. Oligo duplex-nukleär faktor komplexet immobiliseras genom streptavidin mikropärlor i en magnetisk kolonn. De bundna nukleära faktorer samlas direkt genom eluering 29,48. Bindande prognoser kan sedan bedömas av en Western blöt med användning av antikroppar som är specifika för proteinet. I de fall där det inte finns några uppenbara förutsägelser, eller alltför många förutsägelser, de elueringar från variantrullgardinsmenyerna av DAPA experiment kan skickas till en proteomik kärna för att identifiera kandidat TF använder masspektrometri, som därefter kan valideras med hjälp av dessa tidigare beskrivna metoder.

I återstoden av article är den detaljerade protokoll för EMSA och DAPA analys av genetiska varianter tillhandahålls.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Beredning av lösningar och reagenser

  1. Beställa anpassade DNA oligonukleotidsonder för användning i EMSA och DAPA.
    1. För att minska icke-specifik proteinbindning, designa korta oligonukleotider (mellan 35-45 baspar (bp) i längd) 30, och placera variant av intresse direkt i mitten flankerad av sin 17 bp endogena genomsekvensen. För EMSA oligos, lägga till en 5 'fluorofor. För DAPA oligos, lägga till en 5 "biotin tag.
    2. Beställ både senssträngen och dess omvända komplementet sträng. Alternativt, för duplex (pre-glödgade) oligos. När du namnger oligos, basera nomenklatur på en etablerad referens genomet.
      Obs: "Risk" och "icke-risk" beteckning kan vara sjukdom och projektspecifika, medan "referens" och "icke-referens" är mer allmänt relevanta.
    3. Vid ankomsten av oligos, kortfattat spinn ner innehåll och återsuspendera i nukleasfritt vatten till en slutlig koncentration av 100 μ; M. Store suspenderades lager vid -20 ° C. Skydda oligos märkta med en fluorofor från ljus genom att linda med aluminiumfolie.
namn Sekvens
rs76562819_REF_FOR GTAATGCCTTAATGAGAGAG A GTTAGTCATCTTCTCACTTC
rs76562819_REF_REV GAAGTGAGAAGATGACTAAC T CTCTCTCATTAAGGCATTAC
rs76562819_NONREF_FOR GTAATGCCTTAATGAGAGAG G GTTAGTCATCTTCTCACTTC
rs76562819_NONREF_REV GAAGTGAGAAGATGACTAAC C CTCTCTCATTAAGGCATTAC

Tabell 1: Exempel EMSA / DAPA oligonukleotid design för att testa en SNP för differentiell binding. "REF" står för referens allelen, medan "NONREF" står för den icke-referens allelen. "FOR" står för den framåtriktade strängen, medan "REV" indikerar dess komplement. SNP ses i rött.

  1. Förbereda cytoplasmisk extraktion (CE) buffert med en slutkoncentration av 10 mM HEPES (pH 7,9), 10 mM KCl och 0,1 mM EDTA i avjoniserat vatten.
  2. Förbereda nukleär extraktion (NE) buffert med en slutkoncentration av 20 mM HEPES (pH 7,9), 0,4 M NaCl och 1 mM EDTA i avjoniserat vatten.
  3. Förbereda glödgning buffert med en slutkoncentration av 10 mM Tris (pH 7,5 till 8,0), 50 mM NaCl och 1 mM EDTA i avjoniserat vatten.

2. Beredning av Nuclear Lysate från odlade celler

Obs: Denna experimentella protokoll har optimerats med hjälp av B-lymfoblastoida cellinjer, men har testats i flera andra obesläktade vidhäftande / upphängnings cellinjer och fungerar överallt.

  1. Culture B-lymfoblastoid-celler i Roswell Park Memorial Institute (RPMI) 1640 med 2 mM L-glutamin, 10% fetalt bovint serum och 1x antibiotikum-antimykotikum innehållande 100 enheter / ml av penicillin, 100 | ig / ml streptomycin och 250 ng / ml av amfotericin B.
    1. Utsäde vid ett intervall av 200,000-500,000 viabla celler / ml och inkubera-kolvar vid 37 ° C med 5% koldioxid i en upprätt position med ventilerade eller lösa lock.
      Obs: Tillväxten av B-lymfoblastoidceller saktar när de når över en miljon celler / ml. Bryta upp cellblaster genom att pipettera upp och ned flera gånger och returnera celler att 200,000-500,000 celler / ml för att upprätthålla en snabb tillväxttakt.
  2. Tvätta odlade celler två gånger med 10 ml iskall fosfatbuffrad saltlösning (PBS), spinn ner vid 4 ° C, 300 x g under 5 min och avlägsnande av PBS via aspiration.
  3. Räkna celler med användning av en hemocytometer och återsuspendera pelleten som en ml iskall PBS per 10 7-celler.
    Obs: Om exempelvis lyse 2 x 10 7 </ Sup> celler, återsuspendera i 2 ml PBS.
  4. Alikvotera 1 ml till 1,5 ml mikrocentrifugrör, så att varje rör innehåller 10 7 celler i PBS. Centrifugera vid 3300 xg under 2 min 4 ° C och aspirera bort PBS.
  5. Före användning, tillsätt 1 mM ditiotreitol (DTT), 1x fosfatas-inhibitor, och 1x-proteasinhibitor till en fungerande lager av CE-buffert. Resuspendera cellpelleten med 400 | il av CE buffert och inkubera på is under 15 minuter.
  6. Tillsätt 25 pl av 10% Nonidet P-40 och blanda genom pipettering. Centrifugera vid 4 ° C, max hastighet under 3 min. Dekantera och kassera supernatanten.
  7. Före användning, tillsätt 1 mM DTT, 1x fosfatas-inhibitor, och 1x-proteasinhibitor till en fungerande lager av NE buffert. Resuspendera cellpelleten med 30 pl NE buffert och blanda genom att vortexa.
  8. Inkubera vid 4 ° C i ett rör rotator eller på is under 10 min. Centrifugera 3300 xg under 2 min 4 ° C.
  9. Samla upp det klara supernatanten (kärn lysat) och delprov före lagring vid -806, C för att undvika flera frys-tö cykler som kan försämra proteinet. Lämna en 10 pl alikvot för att mäta proteinkoncentration med hjälp av bichoninic syraanalys (BCA) 31.

3. Elektro Mobility Shift Assay (EMSA)

  1. Förbered Oligo Working Stock och EMSA Gel.
    1. Om oligos beställdes i duplex, tina 100 iM lager och späd 1: 2000 i glödgning buffert för att uppnå en 50 nM arbets lager.
    2. Om oligos beställdes enkelsträngat, tina 100 iM lager och späd 1:10 i glödgning buffert för att uppnå 100 Nm arbets lager. Kombinera 100 | il av 100 nM komplementsträng lösning med varandra i ett mikrocentrifugrör.
      1. Placera i ett värmeblock vid 95 ° C under 5 min. Stäng av värmeblocket och låt oligos att långsamt svalna till rumstemperatur under åtminstone en timme före användning.
    3. Pre-kör EMSA Gel.
      1. Ta bort bild från en pre-cast 6% TBE gel och skölj under avjoniserat vatten flera gånger för att avlägsna eventuella buffert från brunnarna. Förbereda ett L av 0,5x TBE-buffert genom att tillsätta 50 ml av 10x TBE till 950 ml avjoniserat vatten.
      2. Montera gelelektrofores apparaten och kontrollera tätheten genom att fylla den inre kammaren med 0,5x TBE-buffert. Om ingen buffert läcker in i den yttre kammaren, fylla den yttre kammaren ungefär två tredjedelar av vägen.
      3. Pre-run gelén vid 100 V under 60 min.
      4. Spola varje brunn med 200 pl av 0,5 x TBE-buffert.
  2. Förbered Binding Buffer Master Mix.
    1. Förbereda 10x bindningsbuffert med en slutkoncentration av 100 mM Tris, 500 mM KCl, 10 mM DTT; pH 7,5 i avjoniserat vatten.
    2. I ett mikrocentrifugrör, skapa en masterblandning bestående av de reagens som är gemensamma för alla reaktioner (10 | j, l 10 x bindningsbuffert, 10 | il DTT / polysorbat, 5 | il Poly d (IC), och 2,5 pl laxspermie-DNA; Tabell 2). Förbered en ytterligare 10%att ta hänsyn till volymförlust på grund av pipettering.
Reagens Slutlig konc. Rxn # 1 Rxn # 2 Rxn # 3 Rxn # 4
ultrarent vatten till 20 | j, l vol. 13,5 | il 11,98 ^ il 13.5μl 11,98 ^ il
10x Binding Buffer 1x 2 ^ 2 ^ 2 ^ 2 ^
DTT / TW-20 1x 2 ^ 2 ^ 2 ^ 2 ^
Laxsperma-DNA 500 ng / | il 0,5 ^ 0,5 ^ 0,5 ^ 0,5 ^
1 ng / l Poly d (IC) 1 ^ g 1 pl 1 pl 1 pl 1 pl
Nukleärt extrakt (5,26 ug / ul) 8 ^ g - 1,52 | j, l - 1,52 | j, l
NE buffert 1,52 | j, l - 1,52 | j, l -
Referens allel oligo 50 fmol 1 pl 1 pl - -
Icke-Referens allelen oligo 50 fmol - - 1 pl 1 pl

Tabell 2: Exempel EMSA reaktions setus. Tabellen visar ett exempel EMSA att testa hypotesen att det finns genotyp beroende bindning av TF till en specifik SNP.

  1. Lägga nukleasfritt vatten till varje mikrocentrifugrör så att den slutliga volymen efter tillsats av alla reagens kommer att vara 20 ^.
  2. Tillsätt lämplig mängd (5,5 pl) av Master Mix till varje mikrocentrifugrör.
  3. Tillsätt 8 mikrogram av kärn lysat till lämpliga mikrocentrifugrör. Inkludera rör innehållande oligo utan kärnextrakt som negativa kontroller (t.ex. tabell 2 Rxn # 1 och Rxn 3 #).
    Obs: Den optimala mängden av lysat per reaktion måste bestämmas experimentellt genom titrering. Allmänhet, titrering ett intervall av 2-10 | ig av lysat är tillräcklig.
  4. Tillsätt 50 fmol av oligo till lämpliga mikrocentrifugrör. Flick att blanda och kortfattat snurra innehållet till botten av röret. Inkubera i 20 min vid rumstemperatur.
    Obs: Om attempting en supershift, inkubera lysatet blandning med antikropp under 20 minuter vid rumstemperatur före tillsatsen av oligos. Det rekommenderas att använda ett mikrogram av en chip-grade antikropp för bästa resultat.
  5. Tillsätt 2 pl 10x Orange laddningsfärg till varje mikrocentrifugrör. Pipettera upp och ned för att blanda.
  6. Ladda proverna i den pre-run 6% TBE-gel genom att pipettera upp och ned för att blanda och sedan driva ut varje prov i en separat brunn. Kör gelen vid 80 V tills den orange färgen har migrerat 2/3 till 3/4 av vägen ner gelen. Detta bör ta ca 60-75 minuter.
  7. Avlägsna gelén från plast kassetten genom att bända upp den med en gel kniv och placera gelén i en behållare med 0,5% TBE-buffert för att hålla den från att torka ut.
  8. Placera gelén på ytan av en infraröd och kemiluminescens avbildningssystem, att se till att eliminera eventuella bubblor eller föroreningar som kommer att störa bilden.
  9. Använda skanningssystemprogramvaran, klicka på "Acquire" -flikenoch välj sedan "Rita Nytt" att rita en ruta runt det område som motsvarar där gelén ligger på ytan av skannern.
  10. I avsnittet "kanaler" i "Acquire", välj den kanal som motsvarar våglängden för fluoroforen tagg på oligo. I avsnittet "Scanner", klicka på "preview" för att få en låg kvalitet förhandsskanning. Justera skanningsområdet genom att dra den blå rutan omger den förvärvade förhandsgranskningen ner till den del av gelén som skall avbildas.
    Obs: Till exempel, om du använder oligos märkta med en 700 nm fluorofor, se till att "700 nm" kanal väljs före scanning.
  11. I avsnittet "Scan Controls", välj "84 iM" upplösning alternativ och "Medium" kvalitetsalternativ. Ställa in fokus för att kompensera för att hälften av tjockleken av gelén. Obs: Till exempel skulle en 1 mm gel använda en 0,5 mm fokus offset.
  12. I avsnittet "Scanner", klicka på "Start" för att bEgin skanningen.
    Obs: Under avsökningen kan ljusstyrka, kontrast och färgschema ofta justeras manuellt beroende på tillverkaren av skanningssystemet.
  13. När genomsökningen är klar, välj "Bild" fliken och klicka på "Rotera eller Flip" i avsnittet "Skapa" för att rätta orienteringen. Spara bildfilen genom att klicka på "Export" i huvudmenyn och välj sedan "Single bild i."

4. DNA Affinity Purification Assay (DAPA)

  1. Framställning av 5 iM Oligo Working Stock.
    1. Om oligos beställdes i duplex, tina 100 iM lager och späd 1:20 i glödgning buffert för att uppnå en 5 iM arbets lager.
    2. Om oligos beställdes enkelsträngat, tina 100 iM lager och späd 1:10 i glödgning buffert för att uppnå 10 iM arbets lager. Kombinera 10 pl av de 10 ^ M komplementära strängar med varandra. Placera i ett värmeblock vid 95 ° C för5 min. Stäng av värmeblocket och låt oligos att långsamt svalna till rumstemperatur före användning.
  2. Före start, värma bindningsbufferten, låg tvättbuffert stringens och hög stringens tvättbuffert, och elueringsbuffert till rumstemperatur.
    Notera: En slutlig koncentration av 50 ng / ml Poly d (IC) kan tillsättas till bindningsbufferten, låg tvättbuffert stringens och hög stringens tvättbuffert för att reducera potentiell icke-specifik bindning av proteiner till oligos.
  3. Förbered bindande blandningar för varje variant.
    1. Blanda en volym av kärn lysat med 2 volymer bindningsbuffert.
      Obs: Den erforderliga mängden lysat måste bestämmas experimentellt på grund av varierande överflöd av TF. Använda mellan 100-250 mikrogram av kärn lysat per kolumn är tillräcklig i de flesta fall.
    2. Lägg 1x fosfatasinhibitor, 1x proteashämmare, och 1x bindande förstärkare (tillval) och blanda genom att ställa röret flera gånger.
      Obs: 100X bindandeförstärkare består av 750 mM MgCl2 och 300 mM ZnCl2. Lägga bindningsförstärkare, om bindningen av TF till DNA är beroende av kofaktorer och reduktionsmedel. Om denna information inte är känd, tillsätt bindande förstärkare.
    3. Tillsätt 10 pl av 5 iM biotinylerad fånga DNA (50 pmol) till respektive bindningsblandningen. Inkubera i 20 min vid rumstemperatur.
      Notera: Inkubationstiden och temperaturen kan variera beroende på TF. De optimala värdena måste bestämmas experimentellt.
  4. Tillsätt 100 pl streptavidin mikropärlor. Inkubera i 10 min vid rumstemperatur.
  5. För varje oligo sond som testas, placera en bindande kolumn i den magnetiska separatorn. Placera en mikrocentrifugrör direkt under varje bindnings kolumn och applicera 100 il bindningsbuffert för att skölja kolonnen.
  6. Pipettera innehållet i varje bindande blandningen i separata kolumner och tillåta vätskan att strömma helt genom kolonnen in i mikrocentrifugröret innan du fortsätter. Se till att märka kolumnerna med varianten oligo som användes i bindningsblandningen. Märk genomflödesprov och ersätt med nya mikrocentrifugrör att samla låg stringens tvättar.
  7. Tillsätt 100 | il av låg stringens tvättbuffert till kolonnen; vänta tills kolumnen behållaren är tom. Upprepa tvätta 4x. Märk låg stringens tvätt prover och ersätt med nya mikrocentrifugrör att samla hög stringens tvättar.
  8. Tillsätt 100 pl av hög stringens tvättbuffert till kolonnen; vänta tills kolumnen behållaren är tom. Upprepa tvätta 4x. Märk hög stringens tvätt prover och ersätt med nya mikrocentrifugrör att samla före elueringen.
  9. Tillsätt 30 | il av nativt elueringsbuffert till kolonnen och låt stå i 5 min. Märk pre-eluerings prover och ersätt med nya mikrocentrifugrör att samla elueringen.
    Notera: Detta är inte eluera det bundna proteinet; den tvättar den återstående hög stringensbuffert ut ur kolonnen och ersätter den med elueringsbuffert för att maximera effektiviteten av elueringen.
  10. Tillsätt ytterligare 50 pl nativt elueringsbuffert för att eluera de bundna TF. För ett högre utbyte, men mindre koncentrerade eluatet, tillsätt ytterligare 50 | il av nativt elueringsbuffert och samla genomströmning.
    Obs: Analysera eluerings-prover genom masspektrometri för att bestämma identiteten av den bundna TF: er 32. Efteråt, kontrollera proteomik resultat genom natriumdodecyl sulfit polyakrylamidgelelektrofores (SDS-PAGE) följt av en Western blöt 33. Om masspektrometri inte är tillgänglig, kör en silverfärg med användning av standardteknik i stället för en Western blöt för att bestämma storleken av det protein (er) som visar genotyp beroende bindande. Använd denna information för att begränsa listan över förväntade TF från beräkningsmetoder som beskrivs i inledningen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

I detta avsnitt är representativa resultat av vad som väntar under förutsättning när man utför en EMSA eller DAPA, och variationen när det gäller kvaliteten på lysatet karaktäriseras. Exempelvis har det föreslagits att frysning och upptining proteinprover flera gånger kan resultera i denaturering. För att undersöka reproducerbarheten av EMSA-analys i samband med dessa "frys-tö" cykler, var två 35 bp oligos skiljer sig på en genetisk variant inkuberas med ett enda parti av kärn lysat som tinades och frysas för den angivna mängden . gånger Figur 2 visar att frysning och upptining detta särskilt B-lymfocyt nukleärt extrakt upp till 5 gånger har till synes ingen effekt på integriteten hos de proteiner; Men stabiliteten i nukleärt protein varierar beroende på prov och bör därför prövas vid varje enskild cellinje som användes. Det är också möjligt att ha variation från olika sats preparheten av kärn lysat. Huruvida denna variation beror på stadiet av cellcykeln före lys, cellpassage nummer eller andra faktorer, är det viktigt att replikera EMSA resultat med användning av olika satser av lysat för att säkerställa verkliga resultat.

Dessutom är det viktigt att optimera signal-till-brusförhållandet för EMSA. En viktig variabel i detta är den oligo-koncentrationen. Mängden oligo (5-300 fmol) titrerades för att utvärdera hur olika mängder av oligos påverka signalen (Figur 3). En ökning i intensiteten av bandet upp till 100 fmol av oligo observerades. Efter denna punkt, är signalen platåer tyder 100 fmol optimal oligo beloppet för EMSA reaktion.

Slutligen är ett representativt värde från en av våra publicerade studier med en del av den strategi som beskrivs i detta manuskript tillhandahålls (Figur 4). i thär studie 34, visade vi att lupus Riskerna allelen av rs6590330 ökar bindning av STAT1, en ​​transkriptionsfaktor som deltar i både synergistisk aktivering och hämning av genuttryck nedströms av typ 1 IFN-receptorkomplexet 35. I detta exempel framställdes STAT1 först identifierats av DAPA följt av proteomik analys med användning av högupplösande vätskekromatografi kopplat till tandem-masspektroskopi (DAPA-MS). En DAPA-Western blot användes för att bekräfta TF identifieras från proteomik analys (STAT1) och bekräfta att den fosforylerade formen av STAT1 var bindning till icke-referens (lupus-risk) oligo. Denna figur illustrerar hur de olika analyserna i denna strategi kan användas för att identifiera differentiell bindning av transkriptionsfaktorn till en icke-kodande varianten.

figur 2
Figur 2: Analys av reproducerbarhetoch konsekvenserna av frysning-upptiningscykler på EMSA resultat. Oligos innehåller referensen (R) eller icke-referens (NR) allel av en genetisk variant användes för att sondera samma framställning av lysat efter multipla cykler av frysning och upptining. (Lys: Lysate). Varje bana innehåller den fria sonden vid botten av gelén (blå pil). Bindningen av TF: er till oligo kan ses som ett band i den övre halvan av gelén (röd pil). Band som finns i den nedre halvan av gelén (se konsol) är ospecifika. Klicka här för att se en större version av denna siffra.

Figur 3
Figur 3:. Bedömning av effekten av olika oligo koncentrationer Olika koncentrationer av oligos användes för sondering av en enda beredning av kärn lysatet. Fluorescent signal ökar med ökande mängder oligo, vilket indikerar att oligo är det begränsande reagenset. Signal platåer vid 100-300 fmol körfält, där mängden protein blir det begränsande reagenset. Klicka här för att se en större version av denna siffra.

figur 4
Figur 4: lupus risk allelen av rs6590330 ökar STAT1 bindande, enligt bedömning av DAPA-MS STAT1 och pSTAT1 uppvisar högre bindning till oligos innehållande rs6590330 risk allelen jämfört med den icke-risk-allelen.. Biotinmärkta oligos inkuberades med Epstein-Barr-virus-transformerade B-cellkärnextrakt. Proteiner bundna till oligo fångades med hjälp av DAPA. Proteiner separerades sedan genom SDS-polyakrylamid-gelelektrofores och detekterades med användning av anti-pSTAT1(A) eller anti-STAT1 (B). M: markör. NR: oligo innehållande den icke-risk-allelen av rs6590330; R: oligo hålla risken allelen av rs6590330; Mutant: oligo innehåller en störd förmodad STAT1 bindningsställe nedströms rs6590330; Cellysatet: nukleärt extrakt från B-celler. De relativa intensiteterna för banden anges nedan varje band. Resultaten är representativa för fyra experiment; medan alla experiment visade en ökad STAT1 bindning till proberna med risk-allelen, i 2/4 experiment ingen STAT1 eller pSTAT1 detekterades i immunfällningen från den icke-risk oligo, medan båda detekterades i immunfällningen från risken oligo. Denna siffra har ändrats från referens 34. Klicka här för att se en större version av denna siffra.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Även framsteg inom sekvensering och genotypning teknik har förbättrats avsevärt vår förmåga att identifiera genetiska varianter i samband med sjukdom, är vår förmåga att förstå de funktionella mekanismer påverkas av dessa varianter släpar. En viktig källa till problemet är att många sjukdomsassocierade varianter finns i n på-kodande regioner av genomet, vilket sannolikt påverkar hårdare mot förutse mekanismer som styr genuttryck. Här presenterar vi ett protokoll baserat på EMSA och DAPA tekniker, värdefulla molekylära verktyg för att identifiera genotyp beroende TF bindande händelser som sannolikt bidrar till funktionen av många icke-kodande varianter. Även om dessa två tekniker har använts i stor utsträckning i det förflutna, de har först nyligen anpassats för genetisk variant analys av TF bindande. Bortom TF, kan EMSA också användas för att analysera effekten av genetiska varianter på RNA-bindande proteiner med endast smärre justeringar av protokoll 36.

ove_content "> Protokollet presenteras här är enkel och lätt att utföra,. dock vissa delar kräva ytterligare överväganden innan experiment För det första är det viktigt att skapa en första förteckning över varianter för behandling genom att utföra rigorösa statistiska analyser Ett fel i det här steget. kan spåra ur alla efterföljande analyser, eftersom många varianter kan binda kärn lysat differentiellt utan att bidra till sjukdomsrisk. Dessutom är avgörande att använda funktionell genomik uppgifter som utförs i relevanta celltyper, kan lika irrelevanta celltyper leder till uppkomsten av falska positiva TF bindande förutsägelser. för närvarande är de mest använda funktionella genomiska resurser inkluderar KODA 12 och färdplanen Epigenomics 17. Ytterligare information om genuttryck nivåer i celltyper som är relevanta för en sjukdom av intresse kan erhållas från andra källor såsom ImmGen 37, BioGPS 38, 39, och SNPsea 20. Till exempel, en sådan resurces kan användas för att filtrera TF bindande förutsägelser endast omfatta de TF som uttrycks i relevanta celltyper.

Det är också viktigt att beakta de varningar av experiment in vitro som EMSA och DAPA. I synnerhet är det nödvändigt att upprepa experimenten med separata kärn lysat preparat för att minska falska negativa. Dessutom kan en framgångsrik EMSA-supershift närvarande som en ytterligare förskjutning i EMSA-bandet, i vilket antikroppen binder till TF, eller en förlust av bandet, i vilka block antikropps TF: s DNA-bindande domän. I båda fallen, inklusive en isotyp kontrollantikropp och / eller en antikropp mot en annan TF är användbar för att bekräfta specificiteten hos supershift. En annan faktor att utföra en supershift är om att inkludera DTT / polysorbat i reaktionen. DTT / polysorbat stabiliserar last färgämnet möjliggör mer noggrann kvantifiering av obundet DNA; emellertid kan det också minska disulfidbindningar av antikroppar resulteraing i ett misslyckande av EMSA-supershift. Det rekommenderas att prova reaktioner med och utan DTT / polysorbat när du försöker supershift ett komplex. Den optimala mängden av Poly d (IC) och lax-sperma-DNA per reaktion måste bestämmas experimentellt genom titrering. Generellt titrering en rad 1-6 ug Poly d (IC) och 50-500 ng laxspermie är tillräcklig. En användbar positiv kontroll för DAPA innebär att man använder en konsensussekvens för en TF med en väl karakteriserade bindande motivet (erhållen från databaser såsom CIS-BP 23 eller Factorbook 40) och driva ett Western med en antikropp specifik för den TF. För båda analyserna, kan en kodad oligo användas för att visa att eventuella observerade bindningen är specifik för oligos av intresse.

Både EMSA och DAPA tekniker har experimentella begränsningar. Till exempel, är bindningsaffinitet mellan ett TF och DNA påverkas till stor del av de villkor buffert. Helst bör buffertbetingelser härma den endogena conditions av kärnan för att medge optimal bindning. För EMSA, kan felaktiga buffertförhållanden resultera i en svag band eller förlusten av ett band helt. För DAPA, kan icke-ideala förhållanden ge TF (er) som skall elueras under tvättstegen. Därför är varje analys endast effektiv i att identifiera TF-oligo bindande enligt vissa buffertbetingelser. De mest allmänt användbara buffertbetingelser presenteras i protokollet ovan. En andra begränsning är att de experimentella resultaten från EMSA och DAPA metoder ger lite information om de mekanismer genom vilka TF binder till oligos. TF kunde binda till oligonukleotider direkt eller rekryteras av andra faktorer. Följaktligen är det viktigt att analysera oligo sekvenser beräknings att förutsäga hur TF kan binda till oligos och verifiera dessa förutsägelser experimentellt. Till exempel kan en specifik bindningssekvens skall muteras eller en bindningspartner kan experimentellt utarmas. Slutligen, den mängd extrakt som används måste titreras för varje experiment to skaffa optimala resultat. För mycket lysat kan mätta TF-oligo bindande och skymma någon differentiell bindning mellan risk och icke-riskalleler. För ytterligare felsökning, kan läsaren hänvisa till flera utmärkta omdöme och metod manuskript 30,41,42.

Förutom de analyser som beskrivits här, finns det en mängd olika in vivo-tester som finns tillgängliga för ytterligare studera rollen av varianter i levande celler (figur 1, botten). Kromatin immunoprecipitation följt av allelspecifika kvantitativa polymeras kedjereaktioner (chip-qPCR) studier kan göras för att identifiera om differentiell bindning observerats inom de in vitro-analyser replikeras i levande celler 34. Till exempel, om celler heterozygota för en variant av intresse används kan qPCR experiment detektera skillnaden i anrikning mellan de två allelerna i TF immunutfälldes kromatin. ChIP kräver särskilda Chip-grade antikroppar; however, om Chip-klass TF-antikroppar är tillgängliga, transfektera celler med en flagga-märkta TF är ett effektivt alternativ 43. Dessutom kan effekten av differential bindande mål genuttryck undersökas genom uttryck kvantitativ drag loci (eQTL) analys på relevanta celltyper med lokalt insamlade expressionsdata från genotypade celler eller offentligt tillgängliga resurser, såsom de sammanställts av Genevar 44. Luciferas reporter analyser kan också användas för att undersöka i vilken grad differentiell bindning av proteinet påverkar genexpression. Sådana analyser kan modifieras för att arbeta oavsett om varianterna finns i en promotor, förstärkare, eller repressor området 45-47. Slutligen, genom redigerings teknik, såsom crispr / Cas9 48, kan användas för att generera cellinjer som skiljer sig endast på en enda variant, som är avgörande för att bekräfta orsakssamband. Sådan teknik kan avsevärt minska den experimentella variansen observerade between cellinjer härledda från genetiskt skilda ämnen, eftersom funktionella avläsning analysera genuttryck eller annan sjukdom mellan fenotyp kan utföras på den redigerade cell-line, och jämfört med icke-redigerade cellinjer.

Den största fördelen med den strategi som är att det möjliggör enkel och snabb upptäckt av genotyp-beroende TF bindande. Genom att prioritera de viktigaste genetiska varianter, kan ytterligare experiment utformas för att identifiera deras biologiska effekt och visa sin kausalitet. Noterbart kan detta protokoll användas för att undersöka någon sjukdom eller fenotyp associerad variant identifierats från GWAS eller fin-kartläggning. En stor och växande gruva av genetisk information och förteckningar över statistiskt associerade genetiska varianter redan finns. I de flesta fall är inte klart de biologiska mekanismer som driver statistiskt samband av dessa varianter. Den strategi som beskrivs i detta förslag gör det möjligt att exakt funktionella tolkningen av de många icke-kodande diseaSE-associerade varianter. Sådan kunskap är viktig för hela klarlägga de molekylära mekanismer som driver någon genetisk baserad sjukdom.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har ingenting att lämna ut.

Materials

Name Company Catalog Number Comments
Custom DNA Oligonucleotides Integrated DNA Technologies http://www.idtdna.com/site/order/oligoentry
Potassium Chloride Fisher Scientific BP366-500 KCl, for CE buffer
HEPES (1 M) Fisher Scientific 15630-080 For CE and NE buffer
EDTA (0.5M), pH 8.0 Life Technologies R1021 For CE, NE, and annealing buffer
Sodium Chloride Fisher Scientific BP358-1 NaCl, for NE buffer
Tris-HCl (1M), pH 8.0 Invitrogen BP1756-100 For annealing buffer
Phosphate Buffered Saline (1x) Fisher Scientific MT21040CM PBS, for cell wash
DL-Dithiothreitol solution (1 M) Sigma 646563 Reducing agent
Protease Inhibitor Cocktail Thermo Scientific 87786 Prevents catabolism of TFs
Phosphatase Inhibitor Cocktail  Thermo Scientific 78420 Prevents dephosphorylation of TFs
Nonidet P-40 Substitute IBI Scientific IB01140 NP-40, for nuclear extraction
BCA Protein Assay Kit Thermo Scientific 23225 For measuring protein concentration
Odyssey EMSA Buffer Kit Licor 829-07910 Contains all necessary EMSA buffers
TBE Gels, 6%, 12 Wells Invitrogen EC6265BOX For EMSA
TBE Buffer (10x) Thermo Scientific B52 For EMSA
FactorFinder Starting Kit Miltenyi Biotec 130-092-318 Contains all necessary DAPA buffers
Licor Odyssey CLx Licor Recommended scanner for DAPA/EMSA
Antibiotic-Antimycotic Gibco 15240-062 Contains 10,000 units/ml of penicillin, 10,000 µg/ml of streptomycin, and 25 µg/ml of Fungizone® Antimycotic
Fetal Bovine Serum Gibco 26140-079 FBS, for culture media
RPMI 1640 Medium Gibco 22400-071 Contains L-glutamine and 25 mM HEPES

DOWNLOAD MATERIALS LIST

References

  1. Hindorff, L. A., et al. Potential etiologic and functional implications of genome-wide association loci for human diseases and traits. Proc Natl Acad Sci U S A. 106, (23), 9362-9367 (2009).
  2. Maurano, M. T., et al. Systematic localization of common disease-associated variation in regulatory DNA. Science. 337, (6099), 1190-1195 (2012).
  3. Ward, L. D., Kellis, M. Interpreting noncoding genetic variation in complex traits and human disease. Nat Biotechnol. 30, (11), 1095-1106 (2012).
  4. Paul, D. S., Soranzo, N., Beck, S. Functional interpretation of non-coding sequence variation: concepts and challenges. Bioessays. 36, (2), 191-199 (2014).
  5. Zhang, F., Lupski, J. R. Non-coding genetic variants in human disease. Hum Mol Genet. (2015).
  6. Lee, T. I., Young, R. A. Transcriptional regulation and its misregulation in disease. Cell. 152, (6), 1237-1251 (2013).
  7. Slatkin, M. Linkage disequilibrium--understanding the evolutionary past and mapping the medical future. Nat Rev Genet. 9, (6), 477-485 (2008).
  8. Bush, W. S., Moore, J. H. Chapter 11: Genome-wide association studies. PLoS Comput Biol. 8, (12), e1002822 (2012).
  9. 1000 Genomes Project Consortium. An integrated map of genetic variation from 1,092 human genomes. Nature. 491, (7422), 56-65 (2012).
  10. Chang, C. C., et al. Second-generation PLINK: rising to the challenge of larger and richer datasets. Gigascience. 4, 7 (2015).
  11. Purcell, S., et al. PLINK: a tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet. 81, (3), 559-575 (2007).
  12. ENCODE Project Consortium. An integrated encyclopedia of DNA elements in the human genome. Nature. 489, (7414), 57-74 (2012).
  13. Crawford, G. E., et al. Genome-wide mapping of DNase hypersensitive sites using massively parallel signature sequencing (MPSS). Genome Res. 16, (1), 123-131 (2006).
  14. Buenrostro, J. D., Giresi, P. G., Zaba, L. C., Chang, H. Y., Greenleaf, W. J. Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nat Methods. 10, (12), 1213-1218 (2013).
  15. Giresi, P. G., Kim, J., McDaniell, R. M., Iyer, V. R., Lieb, J. D. FAIRE Formaldehyde-Assisted Isolation of Regulatory Elements) isolates active regulatory elements from human chromatin. Genome Res. 17, (6), 877-885 (2007).
  16. Kent, W. J., et al. The human genome browser at UCSC. Genome Res. 12, (6), 996-1006 (2002).
  17. Roadmap Epigenomics Consortium. Integrative analysis of 111 reference human epigenomes. Nature. 518, (7539), 317-330 (2015).
  18. Martens, J. H., Stunnenberg, H. G. BLUEPRINT: mapping human blood cell epigenomes. Haematologica. 98, (10), 1487-1489 (2013).
  19. Liu, T., et al. Cistrome: an integrative platform for transcriptional regulation studies. Genome Biol. 12, (8), R83 (2011).
  20. Griffon, A., et al. Integrative analysis of public ChIP-seq experiments reveals a complex multi-cell regulatory landscape. Nucleic Acids Res. 43, (4), e27 (2015).
  21. Staudt, L. M., et al. A lymphoid-specific protein binding to the octamer motif of immunoglobulin genes. Nature. 323, (6089), 640-643 (1986).
  22. Singh, H., Sen, R., Baltimore, D., Sharp, P. A. A nuclear factor that binds to a conserved sequence motif in transcriptional control elements of immunoglobulin genes. Nature. 319, (6049), 154-158 (1986).
  23. Weirauch, M. T., et al. Determination and inference of eukaryotic transcription factor sequence specificity. Cell. 158, (6), 1431-1443 (2014).
  24. Ward, L. D., Kellis, M. HaploReg: a resource for exploring chromatin states, conservation, and regulatory motif alterations within sets of genetically linked variants. Nucleic Acids Res. 40, (Database issue), D930-D934 (2012).
  25. Boyle, A. P., et al. Annotation of functional variation in personal genomes using RegulomeDB. Genome Res. 22, (9), 1790-1797 (2012).
  26. Hume, M. A., Barrera, L. A., Gisselbrecht, S. S., Bulyk, M. L. UniPROBE, update 2015: new tools and content for the online database of protein-binding microarray data on protein-DNA interactions. Nucleic Acids Res. 43, (Database issue), D117-D122 (2015).
  27. Mathelier, A., et al. JASPAR 2014: an extensively expanded and updated open-access database of transcription factor binding profiles. Nucleic Acids Res. 42, (Database issue), 142-147 (2014).
  28. Smith, M. F. Jr, Delbary-Gossart, S. Electrophoretic Mobility Shift Assay (EMSA). Methods Mol Med. 50, 249-257 (2001).
  29. Franza, B. R., Josephs, S. F., Gilman, M. Z., Ryan, W., Clarkson, B. Characterization of cellular proteins recognizing the HIV enhancer using a microscale DNA-affinity precipitation assay. Nature. 330, (6146), 391-395 (1987).
  30. LI-COR. Odyssey Infrared EMSA Kit: Instruction Manual. Available from: http://www.licor.com/bio/pack_inserts/?pi=829-07910 (2014).
  31. Thermo Fisher Scientific, Inc. BCA Protein Assay Kit: User Guide. Available from: https://tools.thermofisher.com/content/sfs/manuals/MAN0011430_Pierce_BCA_Protein_Asy_UG.pdf (2014).
  32. Wijeratne, A. B., et al. Phosphopeptide separation using radially aligned titania nanotubes on titanium wire. ACS Appl Mater Interfaces. 7, (21), 11155-11164 (2015).
  33. Silva, J. M., McMahon, M. The Fastest Western in Town: A Contemporary Twist on the Classic Western Blot Analysis. J. Vis. Exp. (84), (2014).
  34. Lu, X., et al. Lupus Risk Variant Increases pSTAT1 Binding and Decreases ETS1 Expression. Am J Hum Genet. 96, (5), 731-739 (2015).
  35. Ramana, C. V., Chatterjee-Kishore, M., Nguyen, H., Stark, G. R. Complex roles of Stat1 in regulating gene expression. Oncogene. 19, (21), 2619-2627 (2000).
  36. Fillebeen, C., Wilkinson, N., Pantopoulos, K. Electrophoretic Mobility Shift Assay (EMSA) for the Study of RNA-Protein Interactions: The IRE/IRP Example. J. Vis. Exp. (94), e52230 (2014).
  37. Heng, T. S., Painter, M. W. Immunological Genome Project, C. The Immunological Genome Project: networks of gene expression in immune cells. Nat Immunol. 9, (10), 1091-1094 (2008).
  38. Wu, C., et al. BioGPS: an extensible and customizable portal for querying and organizing gene annotation resources. Genome Biol. 10, (11), R130 (2009).
  39. Wu, C., Macleod, I., Su, A. I. BioGPS and MyGene.info: organizing online, gene-centric information. Nucleic Acids Res. 41, (Database issue), D561-D565 (2013).
  40. Wang, J., et al. Sequence features and chromatin structure around the genomic regions bound by 119 human transcription factors. Genome Res. 22, (9), 1798-1812 (2012).
  41. Holden, N. S., Tacon, C. E. Principles and problems of the electrophoretic mobility shift assay. J Pharmacol Toxicol Methods. 63, (1), 7-14 (2011).
  42. Miltenyi Biotec, Inc. µMACS FactorFinder Kit: Data sheet. Available from: http://www.miltenyibiotec.com/en/products-and-services/macsmolecular/protein-research/biotinylated-molecule-isolation/macs-factorfinder-kit.aspx (2014).
  43. Xu, J., Liu, H., Park, J. S., Lan, Y., Jiang, R. Osr1 acts downstream of and interacts synergistically with Six2 to maintain nephron progenitor cells during kidney organogenesis. Development. 141, (7), 1442-1452 (2014).
  44. Yang, T. -P., et al. Genevar: a database and Java application for the analysis and visualization of SNP-gene associations in eQTL studies. Bioinformatics. 26, (19), 2474-2476 (2010).
  45. Fort, A., et al. A liver enhancer in the fibrinogen gene cluster. Blood. 117, (1), 276-282 (2011).
  46. Solberg, N., Krauss, S. Luciferase assay to study the activity of a cloned promoter DNA fragment. Methods Mol Biol. 977, 65-78 (2013).
  47. Rahman, M., et al. A repressor element in the 5'-untranslated region of human Pax5 exon 1A. Gene. 263, (1-2), 59-66 (2001).
  48. Mali, P., et al. RNA-Guided Human Genome Engineering via Cas9. Science. 339, (6121), 823-826 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics