Screening per Funzionale non codificante Varianti genetiche Utilizzando Electrophoretic Mobility Shift Assay (EMSA) e DNA-affinità precipitazioni Assay (DAPA)

* These authors contributed equally
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Miller, D. E., Patel, Z. H., Lu, X., Lynch, A. T., Weirauch, M. T., Kottyan, L. C. Screening for Functional Non-coding Genetic Variants Using Electrophoretic Mobility Shift Assay (EMSA) and DNA-affinity Precipitation Assay (DAPA). J. Vis. Exp. (114), e54093, doi:10.3791/54093 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Sequencing e studi di genotipizzazione basato, compresi gli studi Genome-Wide Association (GWAS), studi locus candidato, e profondo-sequenziamento studi, hanno identificato molte varianti genetiche che sono statisticamente associati con una malattia, caratteristica, o fenotipo. Contrariamente alle previsioni iniziali, la maggior parte di queste varianti (85-93%) si trovano in regioni non codificanti e non cambiano la sequenza di amminoacidi delle proteine ​​1,2. Interpretando la funzione di queste varianti non codificanti e determinare i meccanismi biologici che li collegano alla malattia associata, tratto, o fenotipo è dimostrato impegnativo 3-6. Abbiamo sviluppato una strategia generale di identificare i meccanismi molecolari che collegano le varianti di un importante fenotipo intermedio - l'espressione genica. Questo gasdotto è specificamente progettato per identificare la modulazione di legare da varianti genetiche TF. Questa strategia combina approcci computazionali e tecniche di biologia molecolare finalizzate a prevedereeffetti biologici delle varianti candidati in silico e verificare empiricamente queste previsioni (Figura 1).

Figura 1
Figura 1:.. Approccio strategico per l'analisi dei passaggi non codificanti varianti genetiche che non sono inclusi nel protocollo dettagliato associato a questo manoscritto sono di colore grigio Clicca qui per vedere una versione più grande di questa figura.

In molti casi, è importante iniziare ampliare l'elenco delle varianti di includere tutti quelli in alta linkage disequilibrium (LD) con ciascuna variante statisticamente associato. LD è una misura di associazione non casuale di alleli in due differenti posizioni cromosomiche, che può essere misurata dal r 2 statistica 7. r 2 è una misura del linKage squilibrio fra due varianti, con una R 2 = 1 denota perfetto collegamento tra due varianti. Alleli in alta LD si trovano a co-separare sul cromosoma attraverso popolazioni ancestrali. array di genotipizzazione attuali non includono tutte le varianti conosciute nel genoma umano. Invece, sfruttano il LD all'interno del genoma umano e comprendono un sottoinsieme delle varianti note che agiscono come proxy per altre varianti di una particolare regione del LD 8. Così, una variante senza alcuna conseguenza biologica può essere associato ad una particolare malattia perché è in LD con causale variant-variante con un effetto biologico significativo. Procedurale, si consiglia di convertire l'ultima versione dei 1.000 genomi Project 9 file di chiamata variante (VCF) in file binari compatibili con PLINK 10,11, uno strumento open-source per l'intera analisi di associazione genoma. In seguito, tutte le altre varianti genetiche con LD r 2> 0.8 con ogni ingresso va geneticariant può essere identificato come candidati. E 'importante usare la popolazione di riferimento appropriato per questo passo- esempio, se una variante è stato identificato nei soggetti di origine europea, i dati provenienti da soggetti di origini simili dovrebbero essere utilizzati per l'espansione LD.

espansione LD si traduce spesso in decine di varianti candidati, ed è probabile che solo una piccola frazione di queste contribuiscono alla malattia meccanismo. Spesso, è praticamente impossibile esaminare sperimentalmente ciascuna di queste varianti singolarmente. E 'quindi utile per sfruttare le migliaia di pubblicamente disponibili i set di dati di genomica funzionale come filtro per dare priorità alle varianti. Ad esempio, il consorzio ENCODE 12 ha eseguito migliaia di esperimenti di ChIP-Seq che descrivono il legame del TF e co-fattori, e segni istoni in una vasta gamma di contesti, insieme ai dati della cromatina di accessibilità da tecnologie come DNasi-ss 13, ATAC -seq 14, e FAIRE-ss 15. databAsi e server web, come il browser UCSC Genome 16, tabella di marcia Epigenomics 17, Blueprint Epigenome 18, Cistrome 19, e Remap 20 fornire libero accesso ai dati prodotti da questi e altre tecniche sperimentali in una vasta gamma di tipi e condizioni di cellule. Quando ci sono troppe varianti per esaminare sperimentalmente, questi dati possono essere utilizzati per dare la priorità quelli situati all'interno probabili regioni regolatorie in materia tipi di cellule e tessuti. Inoltre, nei casi in cui una variante è all'interno di un picco ChIP-seq per una proteina specifica, questi dati possono fornire cavi potenziali per il TF specifico (s) o cofattori cui legame potrebbe essere che interessano.

Successivamente, le varianti risultanti priorità sono proiettati sperimentale per validare proteina genotipo-dipendente predetto legame con EMSA 21,22. EMSA misura la variazione della migrazione del oligo su un gel TBE non riducente. oligo fluorescente è incubato con illisato nucleare e legame di fattori nucleari ritardare il movimento del oligo sul gel. In questo modo, oligo che ha legato più fattori nucleari presenterà come un segnale fluorescente forte alla scansione. In particolare, l'EMSA non richiede previsioni circa le proteine ​​specifiche il cui legame saranno interessati.

Una volta che le varianti sono identificati che si trovano all'interno di regioni regolatorie previsti e sono in grado di fattori nucleari differenziale vincolanti, metodi computazionali sono impiegati per predire il TF specifico (s), il cui legame che potrebbero influenzare. Noi preferiamo usare CIS-BP 23,24, RegulomeDB 25, UNIProbe 26, e JASPAR 27. Una volta che il candidato TF sono identificate, queste previsioni possono essere specificamente testati utilizzando anticorpi contro questi TF (EMSA-supershifts e DAPA-western). Un EMSA-supershift comporta l'aggiunta di un anticorpo specifico TF al lisato nucleare e oligo. Un risultato positivo in un EMSA-supershift è represented come un ulteriore spostamento nella banda EMSA, o una perdita di banda (valutata in riferimento 28). Nel DAPA complementare, un duplex oligo 5'-biotinilato contenente la variante e il 20 paia di basi di accompagnamento nucleotidi sono incubati con lisato nucleare dal tipo di cellula in questione (s) per catturare eventuali fattori nucleari legame specifico gli oligonucleotidi. Il complesso fattore duplex-nucleare oligo è immobilizzato dalla streptavidina microsfere in una colonna magnetica. I fattori nucleari legati vengono raccolti direttamente tramite eluizione 29,48. previsioni vincolanti possono poi essere valutati da un Western blot utilizzando anticorpi specifici per la proteina. Nei casi in cui non ci sono previsioni evidenti, o anche molte previsioni, i eluizioni dalla variante di pull-down degli esperimenti DAPA possono essere inviati a un nucleo di proteomica per identificare TF candidati mediante spettrometria di massa, che possono in seguito essere convalidati utilizzando questi precedentemente descritte metodi.

Nel resto della articlE, viene fornito il protocollo dettagliato per EMSA e DAPA analisi delle varianti genetiche.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. preparazione di soluzioni e reagenti

  1. Ordinare sonde oligonucleotidiche DNA personalizzati per l'utilizzo in EMSA e DAPA.
    1. Per ridurre la proteina non specifica vincolante, progettare oligos brevi (tra i 35-45 coppie di basi (bp) di lunghezza) 30, e inserire la variante di interesse direttamente al centro affiancato da suo 17 bp endogena sequenza genomica. Per oligo EMSA, aggiungere un 'fluoroforo 5. Per oligo DAPA, aggiungere un tag 5 'biotina.
    2. Ordinare sia il filamento senso e il suo filone complemento inverso. In alternativa, l'ordine duplex (pre-ricotto) oligonucleotidi. Quando si nomina la oligo, basare la nomenclatura su un genoma di riferimento stabilito.
      Nota: "Rischio" e la designazione "non a rischio" può essere la malattia e specifico progetto, mentre "di riferimento" e "non-reference" sono più universalmente rilevanti.
    3. All'arrivo degli oligonucleotidi, far girare brevemente verso il basso i contenuti e risospendere in acqua priva di nucleasi ad una concentrazione finale di 100 μ; M. Conservare risospeso magazzino a -20 ° C. Proteggere oligo contrassegnati con un fluoroforo dalla luce avvolgendo con un foglio di alluminio.
Nome Sequenza
rs76562819_REF_FOR GTAATGCCTTAATGAGAGAG A GTTAGTCATCTTCTCACTTC
rs76562819_REF_REV GAAGTGAGAAGATGACTAAC T CTCTCTCATTAAGGCATTAC
rs76562819_NONREF_FOR GTAATGCCTTAATGAGAGAG G GTTAGTCATCTTCTCACTTC
rs76562819_NONREF_REV GAAGTGAGAAGATGACTAAC C CTCTCTCATTAAGGCATTAC

Tabella 1: disegno oligonucleotide Esempio EMSA / DAPA per testare un SNP per bin differenzialeding. "REF" sta per l'allele di riferimento, mentre "nonref" sta per l'allele non di riferimento. "PER" sta per il filo in avanti, mentre "REV" indica il suo complemento. Il SNP è visto in rosso.

  1. Preparare estrazione citoplasmatica (CE) tampone con una concentrazione finale di 10 mM HEPES (pH 7,9), 10 mM KCl, e 0,1 mM EDTA in acqua deionizzata.
  2. Preparare estrazione nucleare (NE) tampone con una concentrazione finale di 20 mM HEPES (pH 7,9), 0,4 M NaCl, e 1 mM EDTA in acqua deionizzata.
  3. Preparare tampone di ricottura con una concentrazione finale di 10 mM Tris (pH 7.5-8.0), 50 mM NaCl, e 1 mM EDTA in acqua deionizzata.

2. Preparazione di lisato nucleare da cellule in coltura

Nota: Questo protocollo sperimentale è stato ottimizzato utilizzando linee cellulari B-linfoblastoidi, ma è stato testato in diverse altre linee di cellule aderenti / sospensioni indipendenti e lavora universalmente.

  1. culturi cellule B-linfoblastoidi a Roswell Park Memorial Institute (RPMI) 1640 con 2 mM L-glutammina, siero fetale bovino 10%, e 1x antibiotico-antimicotico contenente 100 unità / ml di penicillina, 100 ug / ml di streptomicina e 250 ng / ml di amfotericina B.
    1. Seed ad una gamma di 200,000-500,000 vitali cellule / ml e incubare beute a 37 ° C con 5% di anidride carbonica in posizione verticale con tappi ventilati o allentati.
      Nota: La crescita delle cellule B-linfoblastoidi rallenta quando raggiungono oltre 1.000.000 cellule / ml. Break up esplosioni delle cellule pipettando su e giù parecchie volte e tornare alle cellule di 200,000-500,000 cellule / ml a mantenere un rapido tasso di crescita.
  2. Lavare le cellule in coltura due volte con 10 ml di ghiaccio freddo fosfato salina tamponata (PBS), centrifugare a 4 ° C, 300 xg per 5 min e rimuovere PBS tramite aspirazione.
  3. Contare le cellule utilizzando un emocitometro e risospendere pellet in 1 ml di PBS freddo ghiaccio per 10 7 cellule.
    Nota: Ad esempio, se lisi 2 x 10 7 </ Sup> celle, risospendere in 2 ml di PBS.
  4. Aliquota 1 ml a 1,5 ml provette da microcentrifuga in modo tale che ogni tubo contiene 10 7 cellule in PBS. Centrifugare a 3.300 xg per 2 minuti a 4 ° C e aspirare fuori PBS.
  5. Prima dell'uso, aggiungere 1 mM ditiotreitolo (DTT), inibitore della fosfatasi 1x, e l'inibitore della proteasi 1x a un ceppo di lavoro di tampone CE. Risospendere pellet con 400 microlitri di tampone CE e incubare su ghiaccio per 15 minuti.
  6. Aggiungere 25 ml di 10% Nonidet P-40 e mescolare pipettando. Centrifugare a 4 ° C, velocità massima per 3 min. Decantare e scartare il surnatante.
  7. Prima dell'uso, aggiungere 1 mM DTT, inibitore della fosfatasi 1x e 1x inibitore della proteasi per uno stock di lavoro di tampone NE. Risospendere pellet con 30 ml di buffer di NE e mescolare nel vortex.
  8. Incubare a 4 ° C in un rotore tubo o in ghiaccio per 10 min. Centrifuga 3.300 xg per 2 minuti a 4 ° C.
  9. Raccogliere il surnatante chiaro (lisato nucleare) e un'aliquota prima di riporlo a -806; C per evitare più cicli di gelo-disgelo che possono degradare la proteina. Lascia un aliquota di 10 microlitri per misurare la concentrazione di proteine ​​usando il saggio di acido bichoninic (BCA) 31.

3. elettroforetica Mobility Shift Assay (EMSA)

  1. Preparare lavoro Oligo & Stock EMSA Gel.
    1. Se oligo sono state ordinate in duplex, scongelare il magazzino 100 micron e diluire 1: 2.000 in tampone ricottura per ottenere un titolo di lavoro 50 nm.
    2. Se oligonucleotidi sono state ordinate a singolo filamento, scongelare le scorte 100 micron e diluire 1:10 in tampone di ricottura per ottenere 100 titoli di lavoro nm. Combinare 100 microlitri della soluzione di complemento strand 100 nM con l'altro in una provetta.
      1. Mettere in un blocco di calore a 95 ° C per 5 min. Spegnere il blocco di calore e permettono oligonucleotidi raffreddare lentamente fino a temperatura ambiente per almeno un'ora prima dell'uso.
    3. Pre-eseguire il Gel EMSA.
      1. Rimuovere il vetrino da un pre-fusione 6% TBE gel e sciacquati con acqua deionizzata parecchie volte per rimuovere qualsiasi tampone dai pozzetti. Preparare 1 L di tampone 0,5x TBE con l'aggiunta di 50 ml di 10x TBE a 950 ml di acqua deionizzata.
      2. Montare l'apparecchiatura elettroforesi su gel e verificare eventuali perdite riempiendo la camera interna con tampone TBE 0.5x. Se il tampone non fuoriesce nella camera esterna, riempire la camera esterna circa due terzi della strada.
      3. Pre-eseguire il gel a 100 V per 60 min.
      4. Lavare ogni pozzetto con 200 ml di tampone 0,5x TBE.
  2. Preparare Binding Buffer Master Mix.
    1. Preparare 10x tampone di legame con una concentrazione finale di 100 mM Tris, 500 mM KCl, 10 mM DTT; pH 7,5 in acqua deionizzata.
    2. In una provetta, creare un master mix costituito dai reagenti comuni a tutte le reazioni (10 microlitri 10x tampone legante, 10 microlitri DTT / polisorbato, 5 microlitri Poly d (IC), e 2,5 ml di DNA di sperma di salmone; Tabella 2). Preparare un ulteriore 10%per tenere conto di perdita di volume a causa di pipettaggio.
Reagente Conc finale. RXN 1 # RXN 2 # RXN 3 # RXN 4 #
acqua ultrapura a 20 microlitri vol. 13,5 ml 11.98 ml 13.5μl 11.98 ml
10x Binding Buffer 1x 2 ml 2 ml 2 ml 2 ml
DTT / TW-20 1x 2 ml 2 ml 2 ml 2 ml
DNA sperma di salmone 500 ng / ml 0,5 ml 0,5 ml 0,5 ml 0,5 ml
1 ug / ml poli d (IC) 1 mcg 1 ml 1 ml 1 ml 1 ml
Estratto nucleare (5,26 ug / ml) 8 mcg - 1,52 ml - 1,52 ml
NE Buffer 1,52 ml - 1,52 ml -
Riferimento allele oligo 50 fmol 1 ml 1 ml - -
Non Riferimento allele oligo 50 fmol - - 1 ml 1 ml

Tabella 2: Esempio EMSA reazione Setup. La tabella illustra un esempio EMSA per verificare l'ipotesi che non ci sia il genotipo-dipendente legame di TFS a uno specifico SNP.

  1. Aggiungere acqua priva di nucleasi a ciascuna provetta tale che il volume finale seguente aggiunta di tutti i reagenti sarà di 20 microlitri.
  2. Aggiungere la quantità appropriata (5.5 ml) di master mix per ogni provetta.
  3. Aggiungere 8 mg di lisato nucleare per le provette da microcentrifuga appropriate. Includere provette contenenti il oligo senza estratto nucleare come controlli negativi (ad esempio, tabella 2, Rxn # 1 e # Rxn 3).
    Nota: La quantità ottimale di lisato per reazione deve essere determinato sperimentalmente mediante titolazione. Generalmente, titolando un intervallo di 2-10 mg di lisato è sufficiente.
  4. Aggiungere 50 fmol di oligo ai tubi microcentrifuga appropriate. Flick per mescolare e brevemente girare il contenuto sul fondo della provetta. Incubare per 20 minuti a temperatura ambiente.
    Nota: Se attempting un supershift, incubare la miscela lisato con l'anticorpo per 20 minuti a temperatura ambiente prima dell'aggiunta di oligo. Si consiglia di utilizzare 1 mg di un anticorpo ChIP-grade per i migliori risultati.
  5. Aggiungere 2 ml di 10x Arancione colorante di caricamento per ogni provetta. Pipetta su e giù per mescolare.
  6. Caricare i campioni nella pre-run gel TBE 6% pipettando su e giù per mescolare e poi espellendo ogni campione in un pozzo separato. Attivare il gel a 80 V fino a quando il colorante arancione è migrata 2/3 a 3/4 fino in fondo il gel. Questo dovrebbe prendere circa 60-75 min.
  7. Rimuovere il gel dalla cassetta di plastica facendo leva con un coltello gel e posizionare il gel in un contenitore con tampone TBE 0,5% per evitare che si secchi.
  8. Porre il gel sulla superficie di un sistema di imaging a infrarossi e chemiluminescenza, avendo cura di eliminare eventuali bolle o contaminanti che disturbare l'immagine.
  9. Utilizzando il software di sistema di scansione, fare clic sulla scheda "Acquisisci"quindi selezionare "Draw Nuovo" per disegnare una casella intorno all'area corrispondente in cui il gel si trova sulla superficie dello scanner.
  10. Nella sezione "canali" della scheda "Acquisisci", selezionare il canale che corrisponde alla lunghezza d'onda del tag fluoroforo sul oligo. Nella sezione "Scanner", fai clic su "Anteprima" per avere un'anteprima di scansione di bassa qualità. Regolare l'area di scansione trascinando il riquadro blu che circonda l'anteprima immagine acquisita verso la porzione del gel da acquisire.
    Nota: Per esempio, se si utilizza oligonucleotidi marcati con un fluoroforo nm 700, assicurarsi che il canale "700 nm" è selezionato prima della scansione.
  11. Nella sezione "Controlli di scansione", selezionare l'opzione di risoluzione "84 micron" e l'opzione di qualità "Medium". Impostare l'attivo a compensare alla metà dello spessore del gel. Nota: Ad esempio, un gel 1 millimetro userebbe un offset fuoco 0,5 mm.
  12. Nella sezione "Scanner", cliccare su "Start" per bEgin la scansione.
    Nota: Durante la scansione, il regime di luminosità, contrasto e colore può essere spesso regolata manualmente a seconda del produttore del sistema di scansione.
  13. Dopo la scansione è terminata, selezionare la scheda "Immagine" e fare clic su "ruotare o capovolgere" nella sezione "Crea" per correggere l'orientamento. Salvare il file immagine facendo clic su "Esporta" nel menu principale, quindi selezionare "Visualizzazione immagine singola".

4. DNA Affinity Purification Assay (DAPA)

  1. Preparazione di 5 micron Oligo funzionamento Stock.
    1. Se oligo sono state ordinate in duplex, scongelare il magazzino 100 micron e diluire 1:20 buffer di ricottura per ottenere un titolo di lavoro 5 micron.
    2. Se oligonucleotidi sono state ordinate a singolo filamento, scongelare le scorte 100 micron e diluire 1:10 in tampone di ricottura per ottenere 10 micron scorte di lavoro. Unire 10 ml di 10 mM filamenti complementari tra loro. Mettere in un blocco di calore a 95 ° C per5 minuti. Spegnere il blocco termico e permettere ai oligonucleotidi raffreddare lentamente fino a temperatura ambiente prima dell'uso.
  2. Prima di iniziare, riscaldare il tampone di legame, basso tampone di lavaggio rigore, tampone di lavaggio ad alta rigore, e tampone di eluizione a temperatura ambiente.
    Nota: Una concentrazione finale di 50 ng / mL Poly d (IC) può essere aggiunto al buffer vincolante, bassa stringenza tampone di lavaggio e tampone di lavaggio di alta stringenza per ridurre il potenziale di legame non specifico di proteine ​​agli oligo.
  3. Preparare le miscele vincolanti per ogni variante.
    1. Mescolare 1 volume di lisato nucleare con 2 volumi di tampone di legame.
      Nota: la quantità necessaria di lisato deve essere determinato in via sperimentale a causa di variazione abbondanza di TF. Usando tra 100-250 ug di lisato nucleare per colonna è sufficiente nella maggior parte dei casi.
    2. Aggiungere inibitore 1x fosfatasi, inibitore della proteasi 1x e 1x enhancer binding (opzionale) e mescolare muovendo il tubo più volte.
      Nota: 100x vincolanteenhancer è costituito da 750 mm MgCl 2 e 300mm ZnCl 2. Aggiungere enhancer binding se il legame di TF di DNA dipende cofattori o agenti riducenti. Se questa informazione non è nota, aggiungere il enhancer binding.
    3. Aggiungere 10 ml di 5 micron DNA cattura biotinilato (50 pmol) per ciascuna rispettiva miscela vincolante. Incubare per 20 minuti a temperatura ambiente.
      Nota: il tempo di incubazione e la temperatura possono variare a seconda del TF. I valori ottimali devono essere determinati sperimentalmente.
  4. Aggiungere 100 ml di microsfere streptavidina. Incubare per 10 minuti a temperatura ambiente.
  5. Per ogni sonda oligo in fase di test, inserire una colonna vincolante nel separatore magnetico. Mettere una provetta direttamente sotto ogni colonna vincolante e applicare 100 ml di tampone di legame per lavare la colonna.
  6. Pipettare il contenuto di ciascuna miscela vincolante in colonne separate e consentire al liquido di fluire completamente attraverso la colonna in microcentrifugatubo prima di procedere. Assicurarsi di etichettare le colonne con l'oligo variante che è stato utilizzato nella miscela vincolante. Etichettare i campioni a flusso continuo e sostituirli con nuovi tubi microcentrifuga per raccogliere i lavaggi a bassa stringenza.
  7. Applicare 100 ml di bassa severità tampone di lavaggio alla colonna; attendere il serbatoio colonna è vuota. Ripetere il lavaggio 4x. Etichettare i campioni di lavaggio a bassa stringenza e sostituirli con nuovi tubi microcentrifuga per raccogliere i lavaggi ad alta stringenza.
  8. Applicare 100 ml di alta rigore tampone di lavaggio alla colonna; attendere il serbatoio colonna è vuota. Ripetere il lavaggio 4x. Etichettare i campioni di lavaggio ad alta stringenza e sostituirli con nuovi tubi microcentrifuga per raccogliere il pre-eluizione.
  9. Aggiungere 30 ml di tampone di eluizione nativo alla colonna e lasciar riposare per 5 minuti. Etichettare i campioni pre-eluizione e sostituirli con nuovi tubi microcentrifuga per raccogliere l'eluizione.
    Nota: Questo non eluire le proteine; lava il restante alta rigoretampone della colonna e lo sostituisce con tampone di eluizione per massimizzare l'efficienza del eluizione.
  10. Aggiungere un 50 microlitri di buffer aggiuntivo di eluizione nativo per eluire le TF legati. Per un rendimento superiore, ma eluato meno concentrata, aggiungere altri 50 ml di tampone di eluizione nativo e raccogliere il flusso continuo.
    Nota: Analizzare i campioni di eluizione attraverso la spettrometria di massa per determinare l'identità del legato TF 32. In seguito, verificare i risultati di proteomica attraverso sodio dodecil solfito di gel di poliacrilammide (SDS-PAGE) seguita da una macchia occidentale 33. Se spettrometria di massa non è disponibile, eseguire una macchia d'argento con la tecnica standard invece di un Western blot per determinare le dimensioni della proteina (s) che mostra genotipo-dipendente vincolante. Utilizzare queste informazioni per ridurre l'elenco dei TF previsti dagli approcci computazionali dettagliati nell'introduzione.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

In questa sezione, i risultati rappresentativi di cosa aspettarsi sono forniti durante l'esecuzione di un EMSA o DAPA, e la variabilità per quanto riguarda la qualità del lisato è caratterizzata. Ad esempio, è stato suggerito che il congelamento e scongelamento campioni proteici più volte può causare denaturazione. Al fine di esplorare la riproducibilità delle analisi EMSA nel contesto di questi cicli "gelo-disgelo", due 35 oligo bp diverse in una sola variante genetica sono stati incubati con una singola partita di lisato nucleare che è stato scongelato e ri-congelato per l'importo indicato . di volte Figura 2 dimostra che il congelamento e scongelamento questo estratto nucleare particolare B-linfociti fino a 5 volte apparentemente ha alcun effetto sulla integrità delle proteine; tuttavia, la stabilità della proteina nucleare varia da campioni e dovrebbe quindi essere testato su ogni riga singola cella utilizzata. E 'anche possibile avere variazione da lotto differente preparzioni di lisati nucleari. Se tale variazione è dovuta alla fase del ciclo cellulare prima della lisi, numero di cellulare di passaggio, o di altri fattori, è importante replicare risultati EMSA utilizzando diversi lotti di lisato per garantire risultati reali.

Inoltre, è importante per ottimizzare il rapporto segnale-rumore per il EMSA. Una variabile importante in questo è la concentrazione oligo. La quantità di oligo (5-300 fmol) è stato titolato per valutare come differenti quantità di oligo influenzano il segnale (Figura 3). È stato osservato un aumento dell'intensità della banda fino a 100 fmol di oligo. Dopo questo punto, il segnale di plateau suggerendo 100 fmol è la quantità oligo ottimale per questa reazione EMSA.

Infine, una figura rappresentativa di uno dei nostri studi pubblicati, utilizzando parte della strategia descritta in questo manoscritto è disponibile (Figura 4). in thè lo studio 34, abbiamo dimostrato che il lupus associato rischio allele di aumenti rs6590330 vincolanti di STAT1, un fattore di trascrizione che partecipa sia l'attivazione sinergica e l'inibizione dell'espressione genica a valle del tipo 1 IFN recettore complesso 35. In questo esempio, STAT1 è stato identificato da DAPA seguita da analisi proteomica mediante cromatografia liquida ad alte prestazioni accoppiata a spettrometria di massa tandem (DAPA-MS). Una macchia DAPA-occidentale è stata utilizzata per confermare la TF identificato da analisi proteomica (STAT1) e confermare che la forma fosforilata di STAT1 era vincolante per la non-di riferimento (lupus-rischio) oligo. Questa figura illustra come i vari metodi di questa strategia possono essere utilizzati per identificare differenziale legame del fattore di trascrizione una variante non codificante.

figura 2
Figura 2: Analisi della riproducibilitàe le conseguenze di cicli di gelo-disgelo sui risultati EMSA. Oligos contenente il riferimento (R) o non di riferimento (NR) allele di una variante genetica sono stati usati per sondare la stessa preparazione di lisato dopo vari cicli di gelo e disgelo. (Lys: lisato). Ciascuna corsia contiene la sonda libera sul fondo del gel (freccia blu). Il legame di TFS alla oligo può essere vista come una banda nella metà superiore del gel (freccia rossa). Bande contenuti all'interno della metà inferiore del gel (vedi staffa) sono non-specifici. Cliccate qui per vedere una versione più grande di questa figura.

Figura 3
Figura 3:. Valutazione dell'effetto di diverse concentrazioni oligo varie concentrazioni di oligonucleotidi sono stati usati per sondare una singola preparazione di lisato nucleare. FSegnale luorescent aumenta con quantità maggiore oligo, indicando che l'oligo è il reagente limitante. Gli altipiani di segnale ai 100-300 corsie fmol, in cui la quantità di proteine ​​diventa il reagente limitante. Cliccate qui per vedere una versione più grande di questa figura.

Figura 4
Figura 4: L'allele lupus-rischio di rs6590330 aumenta vincolante STAT1, come valutato dal DAPA-MS STAT1 e pSTAT1 mostra maggiore legame con oligo contenenti l'allele rischio rs6590330 rispetto al allele non-rischio.. oligonucleotidi marcati con biotina sono state incubate con Epstein-Barr estratto nucleare delle cellule B virus-trasformati. Le proteine ​​legate alla oligo sono stati catturati utilizzando DAPA. Le proteine ​​sono state poi separate mediante SDS-SDS-PAGE e rilevati utilizzando anti-pSTAT1(A) o anti-STAT1 (B). M: Marker. NR: oligo contenente l'allele non rischio di rs6590330; R: oligo contenente l'allele rischio di rs6590330; Mutante: oligo contenente un STAT1 putativo perturbato sito a valle del rs6590330 vincolante; Lisato: estratto nucleare da cellule B. Le intensità relative delle bande sono indicati sotto ciascuna banda. I risultati sono rappresentativi di quattro esperimenti; mentre tutti gli esperimenti hanno dimostrato un aumento STAT1 legame con le sonde con l'allele di rischio, in 2/4 esperimenti non STAT1 o pSTAT1 è stato rilevato nel immunoprecipitato dal oligo non a rischio, mentre entrambi sono stati rilevati nel immunoprecipitato dal oligo rischio. Questa cifra è stata modificata dal riferimento 34. Si prega di cliccare qui per vedere una versione più grande di questa figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Nonostante i progressi nelle tecnologie di sequenziamento e genotipizzazione hanno notevolmente migliorato la nostra capacità di individuare le varianti genetiche associate alla malattia, la nostra capacità di comprendere i meccanismi funzionali colpite da queste varianti è in ritardo. Una fonte importante del problema è che molte varianti associate alla malattia sono situati in n on-regioni codificanti del genoma, che probabilmente incidere più difficile da prevedere meccanismi che controllano l'espressione genica. Qui, vi presentiamo un protocollo basato sulle tecniche dell'EMSA e DAPA, strumenti molecolari preziosi per l'identificazione di eventi che probabilmente contribuiscono alla funzione di molte varianti non codificanti vincolante TF genotipo-dipendente. Sebbene queste due tecniche sono stati ampiamente utilizzati in passato, sono solo recentemente stati adattati per l'analisi variante genetica di TF vincolante. Al di là di TF, EMSA può essere utilizzato anche per analizzare l'effetto delle varianti genetiche su RNA proteine ​​leganti con solo piccole modifiche al protocollo 36.

ove_content "> Il protocollo presentato qui è semplice e facile da eseguire,., tuttavia, alcune parti richiedono ulteriori considerazioni prima sperimentazione In primo luogo, è importante per generare una lista iniziale di varianti per l'esame effettuando analisi statistiche rigorose un errore in questa fase. può far deragliare tutte le analisi a valle, come molte varianti possono vincolare lisato nucleare differenziale senza contribuire al rischio di malattia. Inoltre, l'uso dei dati di genomica funzionale eseguita in tipi di cellule pertinenti è fondamentale, tipi di cellule come irrilevanti possono portare alla generazione di falsi TF positivo vincolante previsioni. Attualmente, le risorse di genomica funzionale più utilizzati includono ENCODE 12 e tabella di marcia Epigenomics 17. Ulteriori informazioni relative ai livelli di espressione genica in cellule tipi rilevanti per una malattia di interesse possono essere ottenuti da altre risorse come ImmGen 37, BioGPS 38, 39 e 20 SNPsea. Ad esempio, tali mezzi inces possono essere utilizzati per filtrare TF previsioni vincolanti per includere solo quei TF che si esprimono in tipi di cellule in questione.

E 'anche importante considerare le riserve di esperimenti in vitro, come EMSA e DAPA. In particolare, è necessario ripetere esperimenti con preparazioni lisato nucleare separati per ridurre i falsi negativi. Inoltre, un successo EMSA-supershift può presentarsi come un ulteriore spostamento nella banda EMSA, in cui l'anticorpo si lega al TF, o una perdita di banda, in cui il DNA isolati anticorpi del TF dominio di legame. In entrambi i casi, compreso un anticorpo di controllo isotipo e / o di un anticorpo verso un TF diversa è utile nel confermare la specificità del supershift. Un'altra considerazione in esecuzione di un supershift è se includere DTT / polisorbato nella reazione. DTT / polisorbato stabilizza il colorante di caricamento consentendo un più precisa quantificazione del DNA non legato; tuttavia, può anche ridurre ponti disolfuro di anticorpi risultanozione in un fallimento di EMSA-supershift. Si consiglia di provare reazioni con e senza DTT / polisorbato quando tenta di supershift un complesso. La quantità ottimale di poli d (IC) e salmone spermatozoi DNA per reazione deve essere determinato sperimentalmente mediante titolazione. Generalmente, titolando un intervallo di 1-6 mg Poly d (IC) e 50-500 ng sperma di salmone è sufficiente. Un utile controllo positivo per DAPA comporta l'uso di una sequenza di consenso per una TF con un motivo di legame ben caratterizzato (ottenute da database come CSI-BP 23 o Factorbook 40) e l'esecuzione di un occidentale con un anticorpo specifico per quella TF. Per entrambi i test, un oligo criptato può essere usato per mostrare che qualsiasi osservato vincolante è specifico per il oligo di interesse.

Entrambe le tecniche dell'EMSA e DAPA hanno dei limiti sperimentali. Ad esempio, affinità di legame tra un TF e DNA è influenzato in gran parte dalle condizioni di buffer. Idealmente, le condizioni di rispetto dovrebbero imitare la conditio endogenans del nucleo per eseguire la rilegatura ottimale. Per EMSA, le condizioni di buffer improprio può provocare una fascia debole o la perdita di una band del tutto. Per DAPA, condizioni non ideali possono causare il TF (s) da eluito durante le fasi di lavaggio. Pertanto, ogni dosaggio è efficace solo nell'identificare vincolante in determinate condizioni di buffer TF-oligo. Le condizioni di buffer più universalmente utili sono presentati nel protocollo di cui sopra. Una seconda limitazione è che i risultati sperimentali ottenuti con metodi EMSA e DAPA forniscono poche informazioni sui meccanismi attraverso i quali TF legano al oligonucleotidi. TF potrebbe legarsi a oligonucleotidi direttamente o essere reclutati da altri fattori. Di conseguenza, è importante analizzare le sequenze di oligo computazionalmente di prevedere come TF potrebbero legarsi a oligo e verificare queste previsioni sperimentalmente. Ad esempio, una sequenza di legame specifico può essere mutato o un partner legante può essere sperimentalmente esaurita. Infine, la quantità di estratto utilizzato deve essere titolata per ciascun esperimento to acquisire risultati ottimali. Troppo lisato può saturare il legame TF-oligo e oscurare l'eventuale differenziale legame tra rischio e non a rischio alleli. Per la risoluzione dei problemi, il lettore può fare riferimento a diversi ottimi revisione e il metodo manoscritti 30,41,42.

Oltre ai saggi descritti qui, ci sono una varietà di saggi in vivo disponibili per studiare ulteriormente il ruolo di varianti all'interno delle cellule viventi (Figura 1, in basso). Immunoprecipitazione della cromatina seguita da reazioni a catena della polimerasi quantitativa allele-specifici (ChIP-qPCR) studi può essere intrapresa per identificare se il differenziale legame osservato nei test in vitro si replica nelle cellule viventi 34. Ad esempio, se si utilizzano cellule eterozigoti per una variante di interesse, esperimenti qPCR grado di rilevare la differenza di arricchimento tra le due alleli nella cromatina TF immunoprecipitato. ChIP richiede specifici anticorpi ChIP-grade; HoweveR, se gli anticorpi ChIP-grade TF non sono disponibili, trasfezione le cellule con una bandierina TF-tag è un'alternativa efficace 43. Inoltre, l'effetto di vincolante per l'espressione del gene bersaglio differenziale può essere indagata attraverso l'espressione quantitativa analisi tratto loci (eQTL) in tipi di cellule competenti sulla base dei dati raccolti a livello locale di espressione da cellule di genotipi o risorse pubblicamente disponibili, come quelli compilati da Genevar 44. saggi luciferasi possono anche essere usati per esplorare il grado in cui differenziale legame della proteina influisce espressione genica. Tali dosaggi possono essere modificati per funzionare indipendentemente dal fatto che le varianti sono situati in un promoter, enhancer, o regione repressore 45-47. Infine, le tecnologie del genoma di modifica, come CRISPR / Cas9 48, possono essere utilizzati per generare linee di cellule che si differenziano solo in una singola variante, che è vitale per la conferma causalità. Tali tecnologie possono ridurre sostanzialmente la varianza sperimentale osservato betwlinee cellulari derivate da een soggetti geneticamente diversi, dal momento che l'espressione del gene letture funzionali analisi o un'altra malattia fenotipo intermedio possono essere eseguite sul cell-riga modificata, e rispetto alle linee non modificato cellulari.

Il vantaggio principale della strategia presentata è che consente la rilevazione facile e rapida vincolante TF genotipo-dipendente. Dando la priorità alle varianti genetiche chiave, ulteriori esperimenti possono essere progettati per identificare il loro effetto biologico e dimostrare la loro causalità. In particolare, questo protocollo può essere applicato a indagare su qualsiasi malattia o fenotipo associata variante identificata da GWAS o fine-mapping. Un grande, crescente tesoro di dati genetici e gli elenchi delle varianti genetiche statisticamente associati è già disponibile. Nella maggior parte dei casi, i meccanismi biologici mappa un'associazione statistica di queste varianti non è chiaro. La strategia delineata in questa proposta permette di accurata interpretazione funzionale dei tanti Disea non codificantevarianti SE-associato. Tale conoscenza è di vitale importanza per il pieno chiarimento dei meccanismi molecolari alla guida di qualsiasi malattia genetica-based.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla da rivelare.

Materials

Name Company Catalog Number Comments
Custom DNA Oligonucleotides Integrated DNA Technologies http://www.idtdna.com/site/order/oligoentry
Potassium Chloride Fisher Scientific BP366-500 KCl, for CE buffer
HEPES (1 M) Fisher Scientific 15630-080 For CE and NE buffer
EDTA (0.5M), pH 8.0 Life Technologies R1021 For CE, NE, and annealing buffer
Sodium Chloride Fisher Scientific BP358-1 NaCl, for NE buffer
Tris-HCl (1M), pH 8.0 Invitrogen BP1756-100 For annealing buffer
Phosphate Buffered Saline (1x) Fisher Scientific MT21040CM PBS, for cell wash
DL-Dithiothreitol solution (1 M) Sigma 646563 Reducing agent
Protease Inhibitor Cocktail Thermo Scientific 87786 Prevents catabolism of TFs
Phosphatase Inhibitor Cocktail  Thermo Scientific 78420 Prevents dephosphorylation of TFs
Nonidet P-40 Substitute IBI Scientific IB01140 NP-40, for nuclear extraction
BCA Protein Assay Kit Thermo Scientific 23225 For measuring protein concentration
Odyssey EMSA Buffer Kit Licor 829-07910 Contains all necessary EMSA buffers
TBE Gels, 6%, 12 Wells Invitrogen EC6265BOX For EMSA
TBE Buffer (10x) Thermo Scientific B52 For EMSA
FactorFinder Starting Kit Miltenyi Biotec 130-092-318 Contains all necessary DAPA buffers
Licor Odyssey CLx Licor Recommended scanner for DAPA/EMSA
Antibiotic-Antimycotic Gibco 15240-062 Contains 10,000 units/ml of penicillin, 10,000 µg/ml of streptomycin, and 25 µg/ml of Fungizone® Antimycotic
Fetal Bovine Serum Gibco 26140-079 FBS, for culture media
RPMI 1640 Medium Gibco 22400-071 Contains L-glutamine and 25 mM HEPES

DOWNLOAD MATERIALS LIST

References

  1. Hindorff, L. A., et al. Potential etiologic and functional implications of genome-wide association loci for human diseases and traits. Proc Natl Acad Sci U S A. 106, (23), 9362-9367 (2009).
  2. Maurano, M. T., et al. Systematic localization of common disease-associated variation in regulatory DNA. Science. 337, (6099), 1190-1195 (2012).
  3. Ward, L. D., Kellis, M. Interpreting noncoding genetic variation in complex traits and human disease. Nat Biotechnol. 30, (11), 1095-1106 (2012).
  4. Paul, D. S., Soranzo, N., Beck, S. Functional interpretation of non-coding sequence variation: concepts and challenges. Bioessays. 36, (2), 191-199 (2014).
  5. Zhang, F., Lupski, J. R. Non-coding genetic variants in human disease. Hum Mol Genet. (2015).
  6. Lee, T. I., Young, R. A. Transcriptional regulation and its misregulation in disease. Cell. 152, (6), 1237-1251 (2013).
  7. Slatkin, M. Linkage disequilibrium--understanding the evolutionary past and mapping the medical future. Nat Rev Genet. 9, (6), 477-485 (2008).
  8. Bush, W. S., Moore, J. H. Chapter 11: Genome-wide association studies. PLoS Comput Biol. 8, (12), e1002822 (2012).
  9. 1000 Genomes Project Consortium. An integrated map of genetic variation from 1,092 human genomes. Nature. 491, (7422), 56-65 (2012).
  10. Chang, C. C., et al. Second-generation PLINK: rising to the challenge of larger and richer datasets. Gigascience. 4, 7 (2015).
  11. Purcell, S., et al. PLINK: a tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet. 81, (3), 559-575 (2007).
  12. ENCODE Project Consortium. An integrated encyclopedia of DNA elements in the human genome. Nature. 489, (7414), 57-74 (2012).
  13. Crawford, G. E., et al. Genome-wide mapping of DNase hypersensitive sites using massively parallel signature sequencing (MPSS). Genome Res. 16, (1), 123-131 (2006).
  14. Buenrostro, J. D., Giresi, P. G., Zaba, L. C., Chang, H. Y., Greenleaf, W. J. Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nat Methods. 10, (12), 1213-1218 (2013).
  15. Giresi, P. G., Kim, J., McDaniell, R. M., Iyer, V. R., Lieb, J. D. FAIRE Formaldehyde-Assisted Isolation of Regulatory Elements) isolates active regulatory elements from human chromatin. Genome Res. 17, (6), 877-885 (2007).
  16. Kent, W. J., et al. The human genome browser at UCSC. Genome Res. 12, (6), 996-1006 (2002).
  17. Roadmap Epigenomics Consortium. Integrative analysis of 111 reference human epigenomes. Nature. 518, (7539), 317-330 (2015).
  18. Martens, J. H., Stunnenberg, H. G. BLUEPRINT: mapping human blood cell epigenomes. Haematologica. 98, (10), 1487-1489 (2013).
  19. Liu, T., et al. Cistrome: an integrative platform for transcriptional regulation studies. Genome Biol. 12, (8), R83 (2011).
  20. Griffon, A., et al. Integrative analysis of public ChIP-seq experiments reveals a complex multi-cell regulatory landscape. Nucleic Acids Res. 43, (4), e27 (2015).
  21. Staudt, L. M., et al. A lymphoid-specific protein binding to the octamer motif of immunoglobulin genes. Nature. 323, (6089), 640-643 (1986).
  22. Singh, H., Sen, R., Baltimore, D., Sharp, P. A. A nuclear factor that binds to a conserved sequence motif in transcriptional control elements of immunoglobulin genes. Nature. 319, (6049), 154-158 (1986).
  23. Weirauch, M. T., et al. Determination and inference of eukaryotic transcription factor sequence specificity. Cell. 158, (6), 1431-1443 (2014).
  24. Ward, L. D., Kellis, M. HaploReg: a resource for exploring chromatin states, conservation, and regulatory motif alterations within sets of genetically linked variants. Nucleic Acids Res. 40, (Database issue), D930-D934 (2012).
  25. Boyle, A. P., et al. Annotation of functional variation in personal genomes using RegulomeDB. Genome Res. 22, (9), 1790-1797 (2012).
  26. Hume, M. A., Barrera, L. A., Gisselbrecht, S. S., Bulyk, M. L. UniPROBE, update 2015: new tools and content for the online database of protein-binding microarray data on protein-DNA interactions. Nucleic Acids Res. 43, (Database issue), D117-D122 (2015).
  27. Mathelier, A., et al. JASPAR 2014: an extensively expanded and updated open-access database of transcription factor binding profiles. Nucleic Acids Res. 42, (Database issue), 142-147 (2014).
  28. Smith, M. F. Jr, Delbary-Gossart, S. Electrophoretic Mobility Shift Assay (EMSA). Methods Mol Med. 50, 249-257 (2001).
  29. Franza, B. R., Josephs, S. F., Gilman, M. Z., Ryan, W., Clarkson, B. Characterization of cellular proteins recognizing the HIV enhancer using a microscale DNA-affinity precipitation assay. Nature. 330, (6146), 391-395 (1987).
  30. LI-COR. Odyssey Infrared EMSA Kit: Instruction Manual. Available from: http://www.licor.com/bio/pack_inserts/?pi=829-07910 (2014).
  31. Thermo Fisher Scientific, Inc. BCA Protein Assay Kit: User Guide. Available from: https://tools.thermofisher.com/content/sfs/manuals/MAN0011430_Pierce_BCA_Protein_Asy_UG.pdf (2014).
  32. Wijeratne, A. B., et al. Phosphopeptide separation using radially aligned titania nanotubes on titanium wire. ACS Appl Mater Interfaces. 7, (21), 11155-11164 (2015).
  33. Silva, J. M., McMahon, M. The Fastest Western in Town: A Contemporary Twist on the Classic Western Blot Analysis. J. Vis. Exp. (84), (2014).
  34. Lu, X., et al. Lupus Risk Variant Increases pSTAT1 Binding and Decreases ETS1 Expression. Am J Hum Genet. 96, (5), 731-739 (2015).
  35. Ramana, C. V., Chatterjee-Kishore, M., Nguyen, H., Stark, G. R. Complex roles of Stat1 in regulating gene expression. Oncogene. 19, (21), 2619-2627 (2000).
  36. Fillebeen, C., Wilkinson, N., Pantopoulos, K. Electrophoretic Mobility Shift Assay (EMSA) for the Study of RNA-Protein Interactions: The IRE/IRP Example. J. Vis. Exp. (94), e52230 (2014).
  37. Heng, T. S., Painter, M. W. Immunological Genome Project, C. The Immunological Genome Project: networks of gene expression in immune cells. Nat Immunol. 9, (10), 1091-1094 (2008).
  38. Wu, C., et al. BioGPS: an extensible and customizable portal for querying and organizing gene annotation resources. Genome Biol. 10, (11), R130 (2009).
  39. Wu, C., Macleod, I., Su, A. I. BioGPS and MyGene.info: organizing online, gene-centric information. Nucleic Acids Res. 41, (Database issue), D561-D565 (2013).
  40. Wang, J., et al. Sequence features and chromatin structure around the genomic regions bound by 119 human transcription factors. Genome Res. 22, (9), 1798-1812 (2012).
  41. Holden, N. S., Tacon, C. E. Principles and problems of the electrophoretic mobility shift assay. J Pharmacol Toxicol Methods. 63, (1), 7-14 (2011).
  42. Miltenyi Biotec, Inc. µMACS FactorFinder Kit: Data sheet. Available from: http://www.miltenyibiotec.com/en/products-and-services/macsmolecular/protein-research/biotinylated-molecule-isolation/macs-factorfinder-kit.aspx (2014).
  43. Xu, J., Liu, H., Park, J. S., Lan, Y., Jiang, R. Osr1 acts downstream of and interacts synergistically with Six2 to maintain nephron progenitor cells during kidney organogenesis. Development. 141, (7), 1442-1452 (2014).
  44. Yang, T. -P., et al. Genevar: a database and Java application for the analysis and visualization of SNP-gene associations in eQTL studies. Bioinformatics. 26, (19), 2474-2476 (2010).
  45. Fort, A., et al. A liver enhancer in the fibrinogen gene cluster. Blood. 117, (1), 276-282 (2011).
  46. Solberg, N., Krauss, S. Luciferase assay to study the activity of a cloned promoter DNA fragment. Methods Mol Biol. 977, 65-78 (2013).
  47. Rahman, M., et al. A repressor element in the 5'-untranslated region of human Pax5 exon 1A. Gene. 263, (1-2), 59-66 (2001).
  48. Mali, P., et al. RNA-Guided Human Genome Engineering via Cas9. Science. 339, (6121), 823-826 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics