גני הכנת rAAV9 כדי overexpress או מציאת עכבר לבבות

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Ding, J., Lin, Z. Q., Jiang, J. M., Seidman, C. E., Seidman, J. G., Pu, W. T., Wang, D. Z. Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts. J. Vis. Exp. (118), e54787, doi:10.3791/54787 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

שליטה על הביטוי או פעילות של גנים ספציפיים באמצעות משלוח שריר הלב של חומרים גנטיים במודלי Murine מתירה חקירת פונקציות גן. הפוטנציאל הטיפולי שלהם בלב ניתן לקבוע גם. ישנן גישות מוגבלות להתערבות מולקולרית in vivo בלב העכבר. Adeno הקשורים וירוס רקומביננטי (rAAV) הנדסת הגנום מבוססת נוצלה ככלי חיוני מניפולצית גני in vivo לב. היתרונות הספציפיים של טכנולוגיה זו כוללים יעילות גבוהה, סגולי גבוהה, שיעור אינטגרציה הגנומי נמוך, מינימאלית immunogenicity, ו פתוגניות מינימלי. כאן, נוהל מפורט לבנות, חבילה, ולטהר את וקטורי rAAV9 מתואר. הזרקה תת עורית של rAAV9 לתוך גורים בילוד תוצאת ביטוי חזק או מציאה יעילה של הגן (ים) של עניין בלב העכבר, אך לא בכבד וברקמות אחרות. שימוש-ספציפי הלבאמרגן ג TnnT2, ביטוי גבוה של גן GFP בלב הושג. בנוסף, למקד mRNA היה עצור בלב כאשר rAAV9-U6-shRNA נוצל. עבודת ידע טכנולוגי rAAV9 עשויה להיות שימושית עבור חקירות לב וכלי דם.

Introduction

שליטת ביטוי או פעילות של גנים ספציפיים במערכות ביולוגיות שונות הפכה אסטרטגיה יקרה בחקר גן הפונקציה 1. אמצעי ישיר יותר לביצוע מטרה זו היא לתפעל רצפי נוקליאוטידים וליצור אללים מוטנטים. למרות ביצוע שינויים מדויקים, ממוקד הגנום של תא חי הוא עדיין זמן רב ותרגול עתיר עבודה, פיתוח כלי Talen ו Crispr / Cas9 עצמת פתחת עידן חדש של עריכת הגנום 2-5. שיטת מעבדה שיגרתית יותר למניפולציות גן התמקדה הנהגת חומרים הגנטי (DNAs ו RNAs המכיל רצפי קידוד או siRNAs / shRNAs) לתוך התאים לבטא או מציאת הגן (ים) של עניין 1,6.

במקרים רבים, צוואר הבקבוק העיקרי עבור מניפולצית גן הוא המשלוח של DNA, RNA, או חלבון לתוך התאים. בכל הקשור ללימודי חוץ גופית, transfecti ביותרעל מערכות הוקמו שורות תאים בתרבית רבות. עם זאת, במודל העכבר בפרט, למסירת גן vivo ב היא אתגר גדול יותר. יש סדרה של מחסומי חוּץ ו תאיים שצריכים לעקוף אותו כדי להשיג ספיגת הסלולר יעילה של חומרים כימיים אקסוגניים. מכשולים נוספים כוללים את האישור המהיר משך הקצרה של 7,8 חומרים הנמסרים. אסטרטגיה אחת לעקוף בעיות אלה היא להשתמש וקטורים ויראליים כמו "ספקים" או "כלי רכב" למסירת גן vivo. המאפיינים התמרה טבעי- התפתחו של וירוסים לאפשר אספקה יעילה של הגן של עניין לתאים 7,9,10. סוגים רבים של וקטורים ויראליים פותחו ולאפשר גמישות מניפולציה גן vivo בסוגי תאים שונים ואיברים בעכברים.

המערכות ויראלי הנפוץ ביותר בשימוש כוללים רטרו-וירוס, Lentivirus, Adenovirus, ו-associated virus Adeno (AAV) 12-14. עם זאת, סוגים רבים של רטרווירוסים רק להדביק חלוקת תאים, והיעילות שלהם בתאים שאינם מתחלקים מאוד נמוכה 15. זה מגביל השירות שלהם למסירת גן. Lentivirus הוא סוג של משפחה Retroviridae. שונה רטרווירוסים אחרים, Lentivirus יכול להדביק שני התאים המתחלקים ולא להתחלק כבר בשימוש נרחב עבור העברת גנים לתוך-mitotic פוסט ותאי-מובחנים מאוד 16. מחזור החיים של Lentivirus כרוך גם שילוב של DNA וקטור לתוך הגנום המארח. לפיכך, למסירה גן Lentivirus בתיווך מאפשרת ביטוי יציב וארוך משך אלמנטים גנטיים transduced 16-18. עם זאת, תכונה זו יכולה לייצג-e כפולחרב dged בשימוש וירוסים אלה כדי לתפעל ביטוי גנים, כמו שילוב של DNA וקטור עלול להוביל mutagenesis insertional בתאים הפונדקאי ויכול לגרום לתופעות artefactual. Adenovirus הוא בשימוש נרחב אחר מערכת למסירת הגן. בניגוד רטרווירוסים ו lentiviruses, adenoviruses הם שאינם משולבים ואינם מפריעים שלמות הגנומי של תאים לארח 8,10,11,19. בנוסף, adenoviruses יכול transfect DNA לתוך תאים מסוגים רבים, והזיהום אינו תלוי 19 חלוקת התא פעיל. מאפיין נוסף חשוב של adenoviruses היא הקלות של טיהור וקטור, כמו וקטורים ויראליים יש את היכולת להיות משוכפל 19,20. עם זאת, האזהרה העיקרית של מערכת זו היא כי זיהום Adenovirus יכול לעורר תגובות חיסוניות חזקות בתאי יעד ואיברים 19, הגבלת שימוש בחקירות רבות, במיוחד בלימודי ריפוי גנטי.

לעומת אלה מסוג אחרים של וקטורים ויראליים, רקומביננטי Adeno הקשורים וירוס (rAAV) נראה כי מערכת למסירה גן אידיאלי 21,22. הוא מציג immunogenicity מינימלי פתוגניות 23,24. בנוסף, rAAV מדביק מגוון רחב של סוגי תאים, כולל שני המפריד תאים שאינם מתחלקים. ברוב המקרים, rAAV לא להשתלב בגנום המארח; וכך, את הסיכון של שינויים גנטיים או הגנומי רצויים בתאי המטרה הוא 22 נמוך.

לאחרונה, מערכות rAAV שימשו בהצלחה עבור משלוח in vivo של חלבונים קידוד DNA, miRNAs, shRNAs, ו Crispr-gRNAs לעכבר הלב שרירים 23,25-29. מתודולוגיה זו יש להקל חקירות יסוד ולימודי ריפוי גנטי בתחום מחקר לב וכלי דם. כאן, הנוהל המפורט ליצור וקטורי rAAV9 ביעילות ביטוי יתר או מציאת הגנים של עניין לבבות עכבר תוארה. הפרוטוקול מספק שיטה פשוטה ויעילה שלמניפולציה ביטוי גנים הלב במודלים ניסיוניים בעכברים.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

כל השלבים המתוארים בוצעו תחת פרוטוקולים שאושרו על ידי ועדת הבטיחות הביולוגית ועדת הטיפול בבעלי החיים המוסדיים השתמש מבית החולים לילדים בבוסטון. החולים לילדים בבוסטון יש מתקני עכבר חינם לפתוגן עם אור מוסדרים / מחזורים כהים בקרת האקלים. כלובים שינוי הצוות הווטרינרי ובעלי חיים טיפול ולהבטיח את בריאותם של עכברים. השירותים נמצאים בחלל AAALAC מוסמך ויש לי הסמכה פעיל הבטחת צער בעלי חיים (להסמכת AAALAC אמנם על 1992/02/24 אבטחת צער בעלי חיים מספר:. A3303-01). עכברים היו מורדמים על ידי ה- CO 2 נמסר ממקור גז דחוס. דגימות רקמה נאספו לאחר המאשר כי קצב לב, תנועה, נשימה של חיות חדלו. מכרסמים ילודים עמידים ל- CO 2 המתת חסד היו מורדמים על ידי עריפת ראש באמצעות מספריים חדים. שיטות אלו עולות בקנה אחד עם המלצות פאנל בנושא המתת חסד של מדיקה וטרינרי האמריקאיl האגודה.

הדור 1. בין שני המושגים rAAV9 ידי שכפול cDNA או קלטת ביטוי shRNA לתוך עמוד השדרה פלסמיד

הערה: הפלסמיד rAAV9, המכילה חוזר המסוף ההפוך (ITRS) של AAV2, המשמש ביטוי יתר גן שונתה כדי נמל העוף TNNT2 האמרגן (rAAV9.cTNT), המאפשר ביטוי ספציפי-cardiomyocyte גנים transduced 25,26,29. אתרים ייחודיים NheI ו KpnI הוכנסו לתוך פלסמיד, במורד הזרם של האמרגן. שברי cDNA המקודד את הגנים של עניין ניתן לשכפל לתוך עמוד השדרה rAAV9 באמצעות אתרי הגבלה שני אלה 25,26,29. כאן, כדוגמה, וקטור rAAV9 עבור ביטוי יתר של הגן GFP בלבבות עכבר נוצר. הפלסמיד שהתקבל מכיל את קלטת GFP :: cTNT ולצדו שני ITR אתרים (איור 1). בונת rAAV9.U6 :: shRNA שמשה גן מציאת 25. עיצוב shRNAs באמצעותשרתי shRNA עיצוב באינטרנט. rAAV9.U6 :: shRNA יכול להיוצר גם על ידי חישול ligating oligos המכיל DNA רצפי shRNA לתוך וקטורי rAAV9 מתעכל אנזים הגבלת מחסה אמרגן U6, או על ידי ארוך טווח PCR וגיבסון תוך מולקולרי הרכבה מבוססת "ללא תפר" בניית 30. הפלסמיד וכתוצאה מכך אמור להכיל את הקלטת U6-shRNA ולצדו שני ITR אתרים (איור 2). כאן, כדוגמה, וקטור rAAV9.U6 :: shRNA נבנה מציאה mRNA Trbp (רצף shRNA Trbp: GCAGTGATGGATATGCATCTTCTCGAGAAGATGCATATCCATCACTCG). לטרוף shRNA שימש כביקורת שלילית (CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG).

  1. לשכפל את קלטת ביטוי cDNA או shRNA לתוך עמוד השדרה פלסמיד rAAV9. להפוך את ה- DNA לתוך תאים מוסמכים E. Coli 25.
    הערה: השתמש stbl2 או stbl3 E. coli תאים לטרנספורמציה rAAV9 DNA כדי למזער רקומבינציה ITR הרצויה.
  2. תרים אתשיבוט חיובי מתאי E. Coli טרנספורמציה. הגבר את התרבות 500 מ"ל של מדיום לילי-ברנט ולחלץ את הפלסמיד rAAV9 מתאי חיידקים 25-30.
    הערה: Midi / מקסי prep הפלסמיד rAAV9 להשיג כמות גבוהה של DNA (> 100 מיקרוגרם). לפני יצירת וירוס, תמיד לנתח את תקינות רצף של פלסמידים AAV ידי עיכול הגבלה ג'ל אלקטרופורזה agarose, כפי שתואר לעיל (http://www.vvf.uzh.ch/cloningservice/11bpdeletion/itrintegrity.html).

2. Transfection של תאים HEK293 עם פלסמידים rAAV9

  1. כן 1 מיקרוגרם / μl של polyethylenimine ליניארי (PEI) פתרון. ממיסים אבקת PEI ב רעלן פנימי ללא DH 2 O כי כבר מחומם 70-80 מעלות צלזיוס. Aftercooling עד RT, לנטרל הפתרון 7.0 pH עם 1 M HCl. סנן לעקר (0.22 מיקרומטר) הפתרון. Aliquot פתרון מניות 1 מיקרוגרם / μl PEI (1,400 μl / צינורית) ולאחסן את solutיון ב -20 ° C.
  2. תרבות תאי HEK293 ב בינוני הנשר השונה של Dulbecco (DMEM) עם 10% עובריים שור סרום (FBS) ו -1% פניצילין / סטרפטומיצין. התרבות התאים בתוך 37 ° C חממה עם פחמן דו חמצני 5 ± 0.5% (CO 2).
  3. ביום 0, צלחת HEK293 תאים בעוד עשר מנות 150 מ"מ 18-20 שעות לפני transfection ידי פיצול> תאים ומחוברים 90% ב דילול 1: 2.
    הערה: באותו יום 1, תאים צריכים להגיע ל -90% מפגש.
  4. באותו יום 1, transfect HEK293 תאים עם פלסמיד rAAV9 (למשל, rAAV9.cTNT :: GFP או rAAV6.U6 :: בונה shRNA), פלסמיד אד-Helper, ו AAV-נציג / כיפה פלסמיד באמצעות PEI 25,26,29.
    1. עבור 10 מנות של התאים ב 90 מפגש%, לערבב 70 מיקרוגרם של AAV-נציג / כיפה פלסמיד, 70 מיקרוגרם PF פלסמיד rAAV9, ו -200 מיקרוגרם של פלסמיד אד-Helper ב צינור צנטריפוגות 50 מ"ל.
    2. אם התאים הם פחות ומחוברים, להתאים את כמות ה- DNA באופן יחסי. לדוגמה, אם התאים נמצאים ומחוברות 75%, להפחית אתDNA הסכום באופן יחסי (75/90 מהסכום שמוצג צעד 2.4.1): לערבב 70 x 75/90 = 58.3 מיקרוגרם של פלסמיד AAV-נציג / כיפה, 70 x 75/90 = 58.3 מיקרוגרם של פלסמיד rAAV9, ו -200 x 75/90 = 166.7 מיקרוגרם של פלסמיד אד-Helper ב צינור צנטריפוגות 50 מ"ל.
    3. להוסיף 49 מ"ל של RT DMEM (ללא FBS) אל הצינור 50 מ"ל ומערבבים היטב.
    4. להוסיף 1,360 μl של פתרון PEI לעשות את PEI: יחס ה- DNA (נ / w) להיות 4: 1. לערבב היטב. לדגור על RT במשך 15 - 30 דקות.
    5. הוסף 5 מ"ל של תערובת מוכן בשלב 2.4.4 על כל מנה 150 מ"מ (50 מ"ל של התערובת במשך עשר מנות 150 מ"מ).
  5. התרבות התאים בתוך 37 ° C חממה עם 5 ± 0.5% CO 2 עבור 60-72 שעות.

קציר של טרנספקציה HEK293 3. תאים וטיהור של וקטורים rAAV9

  1. קציר התאים 60-72 שעות לאחר transfection. לסלק ו להשעות את התאים את הכלים על ידי pipetting למעלה ולמטה עם המדיום לתרבות. להעביר את כל מתלי התא כדי סטרילית50 מ"ל צינורות.
  2. צנטריפוגה התאים ב XG 500 במשך 5 דקות. Resuspend התא גלולה עם 5 מ"ל של PBS בצינור אחד ולשלב את כל המתלים תא לתוך צינור אחד 50 מ"ל.
  3. צנטריפוגה התאים ב XG 500 במשך 5 דקות. בטל supernatant. בשלב זה, לאחסן את התא גלולה ב -80 ° C או מיד לטהר את AAV מן גלולה, כמתואר בשלבים 3.4-3.15.
  4. הכן את החיץ תמוגה: 150 mM NaCl ו -20 mM Tris-HCl, pH 8.0. סנן לעקר (0.22 מיקרומטר). אחסן את החיץ על 4 מעלות צלזיוס.
  5. Resuspend גלולה עם 10 מ"ל של חיץ תמוגה.
  6. להקפיא את lysate ב -80 ° C או באמבטית קרח / אתנול היבשה, ואז להפשיר אותה על 37 מעלות צלזיוס. וורטקס דקות 1. להקפיא ולהפשיר את lysate 3 פעמים.
  7. הוסף פתרון MgCl 2 אל lysate מופשר (להפוך את הריכוז הסופי של MgCl 2 lysate להיות 1 מ"מ). מוסיפים את nuclease לריכוז סופי של 250 U / ml. לדגור על 37 מעלות צלזיוס למשך 15 דקות כדי לפזר את aggr DNA / חלבוןegation.
    הערה: אם צבירת DNA / החלבון לא מקבל מומס לאחר טיפול nuclease או endonuclease, dounce homogenize את lysates 20 פעמים.
  8. צנטריפוגה מדגם ב 4800 XG במשך 20 דקות ב 4 °. איסוף supernatant.
  9. בינתיים מכינים את שיפוע הפתרון iodixanol:
    1. הכן את 17% שיפוע הפתרון על ידי ערבוב 5 מ"ל של 10x PBS, 0.05 מ"ל של 1 M MgCl 2, 0.125 מ"ל של 1 KCl M, 10 מ"ל של 5 M NaCl, ו -12.5 מ"ל ofdensity בינוני שיפוע. התאם את הנפח הכולל עד 50 מ"ל באמצעות H 2 O.
    2. הכן את הפתרון של 25% על ידי ערבוב 5 מ"ל של 10x PBS, 0.05 מ"ל של 1 M MgCl 2, 0.125 מ"ל של 1 M KCl, 20 מ"ל של מדיום שיפוע צפיפות, ו 0.2 מ"ל של 0.5% (w / v) פנול אדום. התאם את הנפח הכולל עד 50 מ"ל באמצעות H 2 O.
    3. הכן את הפתרון 40% על ידי ערבוב 5 מ"ל של 10x PBS, 0.05 מ"ל של 1 M MgCl 2, 0.125 מ"ל של 1 KCl M, ו- 33.3 מ"ל של מדיום שיפוע צפיפות. התאם את הנפח הכולל עד 50 מ"ל באמצעותH 2 O.
    4. הכן את הפתרון 60% על ידי ערבוב 0.05 מ"ל של 1 M MgCl 2, 0.125 מ"ל של 1 M KCl, 50 מ"ל של מדיום שיפוע צפיפות, ו 0.1 מ"ל של 0.5% (w / v) פנול אדום.
  10. עם מחט ומזרק, לטעון שיפוע הפתרון iodixanol לתוך צינור פוליפרופילן לפי סדר 5 מ"ל של 17%, 5 מ"ל של 25%, 5 מ"ל של 40% ו 5 מ"ל של 60%, להתחיל מלמטה. לטעון את כל lysate המתקבל צעד 3.8 (14-16 מ"ל) על גבי שיפוע. השיפוע, המפורטים מלמטה למעלה, הוא 60%, 40%, 25%, 17%, ואת שכבת lysate. מלאו את הצינור עם חיץ תמוגה ולכסות אותו עם הפקק.
  11. צנטריפוגה ב 185,000 XG במשך 90 דקות ב 16 מעלות צלזיוס.
  12. קציר שבר ויראלי (שכבת 40%) עם מזרק. הכנס את המחט (21 מד) לתוך הצומת בין שברי 40% ו -60%, רק aspirating שכבת 40%.
    הערה: הימנע aspirating כל השכבה 25%.
  13. מערבבים את השבר ויראלי עם polyoxyethylene-polyoxypro מעוקרפתרון pylene לחסום קופולימר PBS (10% המניות קופולימר לחסום polyoxyethylene-polyoxypropylene 1: 10,000 מדולל PBS) עד נפח כולל של 15 מ"ל. טען את התערובת לתוך הצינור המסנן (חתוכי MW = 100 KD). צנטריפוגה XG ב 2000 למשך 30 דקות ב 4 ° C..
  14. מחק את הפתרון בתחתי. מלא את צינור מסנן עם פתרון PBS לחסום קופולימר polyoxyethylene-polyoxypropylene כדי בהיקף כולל של 15 מ"ל. צנטריפוגה XG ב 2000 במשך 20 דקות ב 4 °. חזור על פעולה זו עוד פעמיים. אסוף את וירוס rAAV9 המטוהר (השבר מעל המסנן).
  15. מעבירים את rAAV9 מטוהרים בצינור מסנן צינורות 1.7 מ"ל. Aliquot rAAV9 המטוהר (100 - 400 μl / צינור, תלוי נפח כייל של AAV) ולאחסן הווירוס ב -80 מעלות צלזיוס.
    הערה: הימנע להקפיא מפשיר חוזר ונשנה.

4. מדידה של כייל של rAAV9

  1. הכן דגימות DNA סטנדרטיות.
    1. עיצוב ספציפי ויעיל PCRפריימרים עבור וקטורים rAAV9 לייעל את מצב PCR.
      הערה: פריימרים המשמשים במחקר זה הם "קדימה: TCGGGATAAAAGCAGTCTGG; גב: TCGGACGGAGATACGTGAGT". תגובת PCR בוצעה עם התנאים הבאים: denaturing הראשונית ב 95 מעלות צלזיוס במשך 3 דקות; 35 מחזורים של 95 מעלות צלזיוס למשך 20 שניות, 60 מעלות צלזיוס למשך 15 שניות, ו -72 מעלות צלזיוס במשך 10 שניות; והסיומת הסופית על 72 מעלות צלזיוס למשך 10 דקות. עם זאת, פריימרים אופטימיזציה תנאי PCR הם פלסמיד ספציפיים, כמו רצף ההבלעה ב וקטור rAAV9 עשוי להשפיע על סגולי ויעילות של PCR 31.
    2. בצע את תגובת PCR עם התנאים שמוצגים צעד 4.1.1. לטהר את מוצר ה- PCR עם ערכת חילוץ ג'ל.
    3. למדוד את ריכוז של DNA מטוהרים באמצעות ספקטרופוטומטר. חשבתי את הריכוז במספרים מולקולריים דנ"א לפי המשקל / האורך המולקולרי של מוצר PCR.
      1. חשבתי את הריכוז המולקולרי באמצעות המשוואה הבאה: moריכוז lecular (מולקולות דנ"א או שברי / מ"ל) = 6.23 x 10 23 mol -1 x קון. x 10 -6 / MW. הערה: (6.23 x 10 23 mol -1 הוא מספר של Avagadro; Con .: ריכוז ה- DNA מיקרוגרם / מ"ל; MW .: משקל מולקולרי ב g / mol). לדוגמה, אם הריכוז המתקבל של המוצר PCR הוא 100 מיקרוגרם / מ"ל ​​ואורכו הוא 200 נ"ב, המשקל המולקולרי של הדנ"א הדו-גדילית הוא 2 x 200 x 310 = 124,000 (המשקל המולקולרי הממוצע של כל נוקלאוטיד דנ"א חד-גדילי הוא כ 310 ג '/ mol). ריכוז מולקולרי (מ"ל / מולקולות DNA) = 6.23 X 10 23 mol -1 x 100 מיקרוגרם / מ"ל x 10 -6 / 124,000 g / mol = 5.18 x 10 14 DNA מולקולות / מ"ל.
      2. בצע סדרה דילול של שבר דנ"א ולהכין את דגימות סטנדרטיות, עם ריכוזים של 10 מ"ל 13 / מולקולות, 10 12 מולקולות / מ"ל, 10 מ"ל 11 מולקולות /, 10 10 מולקולות / מ"ל, 10 9 מולקולות / מ"ל, 10 7 מולקולות / מ"ל. השתמש 1 μl של פתרון עבור כל דגימה סטנדרטי עבור PCR כמותי (qPCR, בשלב 4.6).
  2. מערבבים 5 μl של פתרון rAAV9 מטוהרים עם 5 μl של חיץ 10x DNAse, 1 μl של DNAse (10,000 יח '/ מ"ל), ו -39 μl של DDH 2 O. ההיקף הכולל צריך להיות 50 μl.
  3. דגירת הבקבוקון על 37 מעלות צלזיוס במשך 30 דקות כדי להסיר DNA פלסמיד unpackaged שיורית.
  4. להשבית את DNAse ב 95 מעלות צלזיוס למשך 10 דקות. להתקרר הפתרון, להוסיף 44 μl של H 2 O, 5 μl של 10x חיץ DNAse, ו 1 μl של המניה proteinase K (10 מ"ג / מ"ל).
  5. דגירת הפתרון על 50 מעלות צלזיוס למשך 2 שעות. עצור את התגובה ו להשבית K proteinase ב 95 מעלות צלזיוס למשך 10 דקות.
  6. השתמש 1 μl של המדגם עבור PCR כמותי assay (qPCR). חשב את כייל.
    1. הפעל PCR כמותית (QPCR) עם פריימרים המיועדים בשלב 4.1.1 באמצעות fr דגימותאום צעד 4.1.4 (ודגימות תקניות) ומן שלב 4.5 (דגימות כדי להימדד).
      1. עבור כל תגובה, לערבב 10 μl של תמהיל מאסטר גרין 2x (המכיל פולימראז תקי, תמהיל dNTP, חיץ, MgCl 2, וצבע ירוק), 0.5 μl של פריימר קדימה (5 מיקרומטר), 0.5 μl של פריימר הפוכה (5 מיקרומטר), 8 μl של H 2 O, ו 1 μl של המדגם כדי להימדד. בצע qPCR עם התנאים הבאים: להחזיק את הדגימות ב 50 מעלות צלזיוס למשך 2 דקות ו -95 מעלות צלזיוס במשך 10 דקות; לבצע 40 מחזורים ב 95 מעלות צלזיוס למשך 15 שניות ב 60 מעלות צלזיוס במשך 1 דקות; לשלב להמיס, דגירה דגימות ב 95 מעלות צלזיוס למשך 30 שניות ו- C 60 מעלות במשך 15 שניות. צור את עקומת סטנדרט המבוססים על המספרים C T של דגימות תקן (איור 3).
    2. חשבתי את כייל ריכוז / המולקולרי של מדגם AAV נגד עקומת הסטנדרט. RAAV9 יש הגנום דנ"א חד-גדיל, כך הריכוז המולקולרי יהיה פי 2 גבוהים יותרערך מחושב (כוח 2x (10, y), איור 3 ב). בנוסף, כייל של rAAV9 המטוהר יהיה פי 20 גבוהים יותר ממה מתקבל בחישוב בשל 1:20 הדילול של הנגיף בתגובות DNAse ו proteinase K (5 μl 100 סך μl).

5. הזרקה rAAV9 עכברים נאונטליים מבחני ביטוי גנים שבלב

  1. הכינו פתרונות rAAV9 עובד בפתרון PBS לחסום קופולימר polyoxyethylene-polyoxypropylene. הפוך את המניות וירוס עם titers של 1-7 x 10 12 חלקיקים / מ"ל.
    הערה: לספק 50-70 μl של פתרון rAAV9 לתוך כל עכבר יום לאחר הלידה 0.5-1.5 בזריקה תת עורית. כדי להשיג ביטוי יתר או מציאת גן יעיל, מומלץ לבצע בדיקת פיילוט כל מחקר כדי לייעל את כמות AAV המוזרק. משתמשים באותה כמות של rAAV9.cTNT :: לוק או rAAV9.U6 :: שולטת לטרוף עבור כל מחקר כדי למזער את ההטיה.
    הערה: השתמשנו 1-1.510 x 11 חלקיקים / גור עבור ביטוי יתר ו -2.5 - 5 x 10 11 חלקיקים / גור עבור מציאה ב ביום לידת 0.5-1.5 מיל לסה"נ).
  2. פנקו עכברים בילוד עם rAAV9 ב-P2.5 P0.5 בזריקה תת עורית.
    1. טרום למלא 29G1 / 2, 0.33 x 12.7 מ"מ מזרק אינסולין עם הפתרון rAAV9. היזהר כדי להסיר בועות אוויר.
    2. החזק את הגור הרדים-קריו ביד אחת בעזרת אגודל ואצבע מורה. לפני הזריקה, לגנוב את העור האחורי של הגור עם מקל ספוגית רווי 70% אלכוהול איזופרופיל כדי לשמור על מצב סטרילי. הכנס את מחט המזרק לתוך subcutis-הגבה הקדמי של החיה בזווית של 5 עד 10 °. להזריק 50-70 μl של פתרון rAAV9 באמצעות מזרק אינסולין.
      הערה: rAAV9 יכול גם להיות מועבר אל העכבר באמצעות זריקת intraperitoneal או תוך ורידי 26,27. ביטוי יעיל של הגנים נמסרו בלב ניתן להשיג. עם זאת, להזריק intraperitonealיון לפעמים עלול לגרום ביטוי דולף בכבד. לאחר ההזרקה, התנאי של הגורים היה פיקוח בכל יום.
  3. רמת ביטוי גנים בלב יכול להיות במעקב עם qPCR, immunofluorescence, או כתם המערבי (תוצאות נציג מוצגים איורים 4 ו -5) 25,26.
    הערה: עכברים היו מורדמים על ידי ה- CO 2 נמסר ממקור גז דחוס. דגימות רקמה נאספו לאחר המאשר כי קצב הלב, תנועה, נשימה של חיות חדלו. מכרסמים ילודים עמידים ל- CO 2 המתת חסד היו מורדמים על ידי עריפת ראש באמצעות מספריים חדים. השיטה עולה בקנה אחד עם המלצות של הפנל על המתת חסד של האגודה האמריקאית לרפואה וטרינרית.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

האסטרטגיות לבנייה rAAV9 של rAAV9.cTNT :: GFP או rAAV9.U6 :: פלסמידים shRNA מוצגים איורים 1 ו -2, בהתאמה. כמו בדוגמאות, וקטור rAAV9 נוצר כדי overexpress הגן GFP בלבבות עכבר. הפלסמיד שהתקבל מכיל את קלטת GFP :: cTNT ולצדו שני ITR אתרים (איור 1). וקטור rAAV9.U6 :: shRNA נבנה מציאה Trbp mRNA (איור 2)

עקומת התקן עבור טיטרציה rAAV9 נוצרה עם נתוני qPCR על ידי רגרסיה ליניארית. ה- y משתנה מניפולציות מייצג את הערך 10 יומן של ריכוז מולקולרי DNA של מדגם זה רגיל, ואת x משתנה המתאים מייצג את הערך C T. 10 יומן (ריכוז) ערכים (Y) ומספרים C T (x) להפגין קשר לינארי נחמד (R 2 = 0.9971) ו עולה בקנה אחד עם המשוואה y = -0.2832x + 14.616 (איור 3 א). כותרות של דגימות rAAV9 חושבו על בסיס המשוואה ליניארית (איור 3 ב). בשיטה המתוארת בפרוטוקול (שלב 4.6.2 ואיור 3B), כייל גבוה של וקטורים rAAV9 (50-200 μL,> 6 x 10 13 חלקיקים / מ"ל) הושג במחקר נציג.

כדי לפקח על סגוליות יעילות ורקמות של וקטורים rAAV9.cTNT, גורים P0.5 טופלו אותה כמות (1 x 10 11 חלקיקים / גור) של rAAV9.cTNT :: בלוציפראז (AAV-לוק) או rAAV9.cTNT :: GFP (AAV-GFP) על ידי הזרקה תת עורית. שבועות לאחר ההזרקה, אות GFP הייתה פיקוח ברקמות שונות של העכברים. ביטוי חזק של GFP זוהה בלב, אבל לא באיברים אחרים (איור 4, n> 3). לפיכך, יעיל ביטוי גנים ספציפי לב הושג עם וקטור rAAV9.cTNT.

jove_content "FO: keep-together.within-page =" 1 "> כדי לפקח על יעילות מציאה וספציפיות רקמות של וקטורים rAAV9.U6, עכברים P0.5 טופלו אותה כמות (3 x 10 11 חלקיקים / גור) של rAAV9 .U6 :: לטרוף (AAV-לטרוף) או rAAV9.U6 :: Trbp shRNA (AAV-shTrbp) על ידי הזרקה תת עורית. שבועיים לאחר ההזרקה, ביטוי Trbp ברקמות שונות של היה פיקוח על ידי qPCR (איור 5, n = 3 ). רמת ה- mRNA של Trbp בלב הופחת באופן משמעותי על ידי rAAV9.U6 :: shTrbp (68% downregulation, P = 0.0004452). למטה הסדרת Trbp גם זוהה ברקמת הכבד מפני rAAV9.U6 :: shTrbp שטופלו עכברים. עם זאת, השינוי הוא הרבה יותר נמוך.

איור 1
איור 1: אסטרטגיות כדי לבנות את rAAV9.cTNT :: GFP פלסמיד. (א) תוכנית של הקלטת GFP :: cTNT. (B TNNT2 (rAAV9.cTNT) ואחריו שני אתרי ההגבלה הייחודיים (NheI ו KpnI). מסגרת קריאה פתוחה GFP שובט לתוך וקטור rAAV9.cTNT ידי קשירת בתיווך אתר הגבלה על מנת ליצור את הפלסמיד rAAV9.cTNT :: GFP. (ב) פלסמיד rAAV9.cTNT :: GFP ניתן לבנות על ידי הרכבת גיבסון. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 2
איור 2: אסטרטגיות כדי לבנות את rAAV9.U6 :: shRNA פלסמיד. (א) תוכנית של U6 :: קלטת shRNA מוצג. ביטוי של shRNA הוא מונע על ידי אמרגן U6 (הכחול). (B) קלטות rAAV9-U6-shRNA יכול להיווצר על ידי חישול oligos DNA ligating מכיליםרצפי ing shRNA לתוך וקטורי rAAV9 אנזים-מתעכל הגבלת מחסה אמרגן U6. (C) rAAV9.U6 :: קלטות shRNA יכולות להיוצר על ידי PCR ארוך טווח תוך מולקולרי בניית "ללא תפר" גיבסון מבוסס הרכבה. 5 'הזרוע, הלולאה, ו 3' זרוע של shRNA מוצגים ירוק, כתום ואדום, בהתאמה. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 3
איור 3: חישוב כייל rAAV9. (א) עקומת תקן עבור טיטרציה rAAV9 נוצר על ידי תוקפנות ליניארי באמצעות הנתונים qPCR. ה- y משתנה המניפולציות מייצגת את ערך 10 יומן של ריכוז מולקולרי DNA של מדגם זה רגיל, ואת x משתנית המתאימהמייצג את ערך C T. (ב) titers של דגימות rAAV9 מחושבים על בסיס משוואה ליניארית של עקומת סטנדרט. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 4
איור 4: דפוס הביטוי של rAAV9.cTNT :: GFP ברקמות עכברים. גורי P0.5 טופלו אותה הכמות (1 x 10 11 חלקיקים / גור) של rAAV9.cTNT :: בלוציפראז (AAV-לוק, שליטה שלילית) או rAAV9.cTNT :: GFP (AAV-GFP) על ידי הזרקה תת עורית. שבועות לאחר ההזרקה, דגימות הרקמה נבצרו. הביטוי של ה- GFP היה פיקוח תחת בהיקף לנתיחה ניאון. שני תמונות שדה הקרינה בהירות מוצגות. הניסויים כבר חזרו יותר מ -3 פעמים (n> 3).סרגל קנה מידה = 2.0 מ"מ. SKM, שרירי השלד. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 5
איור 5: ביטוי גנים מציאה עם-shRNA AAV. עכברים P0.5 טופלו עם אותה כמות (3 x 10 11 חלקיקים / גור) של rAAV9.U6 :: לטרוף (AAV-לטרוף) או rAAV9.U6 :: Trbp shRNA (AAV-shTrbp) על ידי הזרקה תת עורית. שבועיים לאחר ההזרקה, רמות ה- mRNA של Trbp ברקמות שונות נוטרו על ידי qPCR (n = 3). הנתונים מוצגים כממוצע ± SEM. ערך P החתוך הוא 0.05. NS, P> 0.05, לא משמעותי. **, P <0.01. SKM, שרירי השלד. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

חשוב למזער רקומבינציה ITR הרצויה במהלך בניית פלסמיד. לפני יצירת הווירוס, אחד חייב תמיד לפקח על שלמות ITR של פלסמידים AAV באמצעות עיכול הגבלה ו ג'ל אלקטרופורזה agarose. אי אפשר להשיג 100% פלסמידים ללא פגע, אך יחס רקומבינציה יש לצמצם ככל האפשר. פחות מ -20% מקובלים לאריזת rAAV9 מוצלחת. ראוי לציין, culturing החיידקים בטמפרטורה נמוכה (30 מעלות צלזיוס) עם מהירות רועד נמוך (180-200 סל"ד) יכול להפחית את הסיכוי רקומבינציה ITR.

זה חיוני כדי להבטיח כי התאים HEK293 הם בריאים transfection מוצלח ואריזה rAAV9. "בריאים" תאים הם בדרך כלל מאוד שגשוג ולגדול במהירות. עם זאת, התפשטות מהירה וצמיחה של תאים HEK293 אינה מבטיחה בהכרח את היעילות הגבוהה של אריזה rAAV9. לכן, חשוב להתחיל את הניסויים עם תאים טריים. זהמומלץ להשתמש בתאי HEK293-מעבר נמוך (<10 קטעים, התאים passaged כל 2-3 ימים) עבור אריזה rAAV9. מן ראוי לציין כי קפסיד אחר של rAAV ייתכן שיהיה צורך מטוהר באמצעות הליכים שונים 32.

החוקר מוענק גמישות בדור של פלסמידים rAAV9. כך או הגבלה באתר בתיווך קשירה או הרכבת גיבסון יכולה לשמש 30. לבניית rAAV9.U6 :: shRNA, אסטרטגית התוך מולקולרית גיבסון מבוסס ההרכבה היא שיטה יעילה (איורים 1 ו -2). פלסמידים AAV-shRNA מרובים או ונקווה AAV-shRNAs ניתן לבנות במהירות. כדי overexpress גנים באמצעות rAAV9, קיים הגבלת גודל עבור רצפי cDNA מוכנס. באופן כללי, שבר גודל בין ITRS צריך להיות קטן מ 5 kb 33. שחבור חלבון Intein-זרז ניתן להשתמש כדי לעקוף את מגבלת גודל האריזה של וקטורים rAAV9 34.

מערכת ויראליות אחרותs, כולל רטרו-וירוס, lentivirus ו אדנו, גם פותח ולאפשר מניפולצית גן גמישה. לעומת אלה סוגים שונים של וקטורים ויראליים, יש rAAV יתרונות ספציפיים: יעילות גבוהה, גבוה סגולי, שיעור אינטגרציה הגנומי נמוך, מינימאליים immunogenicity, ו פתוגניות מינימלי. לפיכך, הנדסה הגנום מבוססת rAAV מתגלה כלי אידיאלי עבור מניפולצית גן vivo.

מחקרים קודמים הראו כי מערכת rAAV9 מאפשרת ביטוי היעיל של גנים נמסרו in vivo. עם אמרגן cTNT (עוף TnnT2), ביטוי גנים ספציפי לב הושג (איור 4) 25,26. למרות אמרגן U6 פעיל בכל מקום בגוף ברקמות עכבר, עיכוב הבולט ביותר של היעד mRNA (Trbp) על ידי rAAV9.U6 :: shRNA נצפתה בלב, אבל לא באיברים אחרים (איור 5). הכבד הוא האיבר הנפוץ ביותר transduced ידי קפסיד שונה שלrAAV 35,36. עם זאת, את יעילות המציאה (36% בהורדת רמת ה- mRNA) בכבד היא נמוכה בהרבה מזה בלב (68% בהורדת רמת ה- mRNA). זה עולה בקנה אחד עם המחקר קודם שהראה כי למרות נוכחות הגנום נגיפית גבוהה בכבד, משלוח מערכתי של shRNA ידי rAAV9 מספק גן יעיל יותר מציאה בלב 35. יתכן כי hepatocytes יותר שגשוג מ cardiomyocytes והם באופן פעיל יותר בתהליך חלוקת התא לאחר מתן rAAV9 בגילאים בילוד, שתוצאתה דילול הגנום וקטור משמעותי ברקמת הכבד. עם זאת, זה גם מצביע על כך סרוטיפ של rAAV9 עשוי בצורה יעילה יותר transduce cardiomyocytes בהשוואה לסוגי תאים אחרים. כפי שהוכח על ידי ואח Lovric., ב מיוציטים הבדיל, התגובה DNA נזק חלבונים מורכבים אהפוך מודחקים. חלבונים מורכבים תהפוך לאגד הגנום AAV ומעכבות תמרת AAV באמצעות השתקת תעתיק. לפיכך, לכלmissivity התמרה AAV יכול להיגרם על ידי בידול הטרמינל של cardiomyocytes 36, מה שהופך את המערכת rAAV9, בהשוואה וקטורים ויראליים אחרים, מאוד מתאים מניפולציה גן בלב. כדי לצמצם עוד יותר את השפעות המציאה הרצויות באיברים אחרים (למשל, הכבד), אפשר גם להשתמש cTNT לב ספציפי אמרגן מונחה miR-30a מבוסס shmiR להדחיק את הגנים של עניין בלב 29. כתב יד זה מספק את הקורא עם הטכניקות הספציפיות להיוון על טכנולוגית rAAV9 בחקירות לב וכלי דם.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Polyethylenimine, Linear (MW 25,000) Polysciences, Inc.  #23966-2
Tube, Polypropylene, 36.2 ml, 25 x 87 mm, (qty. 56) Beckman Coulter, Inc # 362183
Nuclease, ultrapure SIGMA #E8263-25KU
Density Gradient Medium(Iodixanol) SIGMA #D1556-250ML
Centrifugal Filter Unit with Ultracel-100 membrane EMD Millipore Corporation #UFC910008
Laboratory pipetting needle with 90° blunt ends,gauge 14, L 6 in., nickel plated hub SIGMA #CAD7942-12EA
Poloxamer 188 solution (Pluronic® F-68 solution) SIGMA P5556-100ML
Proteinase K SIGMA 3115828001
DNase I Roche 10104159001
Centrifuge machine Thermo Scientific 75004260
Centrifuge System Beckman Coulter 363118
Ultracentrifuge Beckman Coulter
DMEM medium Fisher Scientific SH30243FS
Fetal Bovine Serum  Atlanta Biologicals               S11150
rAAV9 vector Penn Vector Core P1967

DOWNLOAD MATERIALS LIST

References

  1. Primrose, S. B., Twyman, R. Principles of gene manipulation and genomics. John Wiley & Sons. (2013).
  2. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, 1258096 (2014).
  3. Gaj, T., Gersbach, C. A., Barbas, C. F. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. 31, 397-405 (2013).
  4. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  5. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat. Biotechnol. 32, 347-355 (2014).
  6. Szulc, J., Wiznerowicz, M., Sauvain, M. -O., Trono, D., Aebischer, P. A versatile tool for conditional gene expression and knockdown. Nat. Methods. 3, 109-116 (2006).
  7. Nimesh, S., Halappanavar, S., Kaushik, N. K., Kumar, P. Advances in Gene Delivery Systems. BioMed Res. Int. 2015, 610342 (2015).
  8. Kamimura, K., Suda, T., Zhang, G., Liu, D. Advances in gene delivery systems. Pharm. Med. 25, 293-306 (2011).
  9. Thomas, C. E., Ehrhardt, A., Kay, M. A. Progress and problems with the use of viral vectors for gene therapy. Nat. Rev. Genet. 4, 346-358 (2003).
  10. Giacca, M., Zacchigna, S. Virus-mediated gene delivery for human gene therapy. J. Control Release. 161, 377-388 (2012).
  11. Witlox, M., Lamfers, M., Wuisman, P., Curiel, D., Siegal, G. Evolving gene therapy approaches for osteosarcoma using viral vectors: review. Bone. 40, 797-812 (2007).
  12. De Miguel, M. P., Cheng, L., Holland, E. C., Federspiel, M. J., Donovan, P. J. Dissection of the c-Kit signaling pathway in mouse primordial germ cells by retroviral-mediated gene transfer. Proc. Natl. Acad. Sci. USA. 99, 10458-10463 (2002).
  13. Nagano, M., Shinohara, T., Avarbock, M. R., Brinster, R. L. Retrovirus-mediated gene delivery into male germ line stem cells. FEBS Lett. 475, 7-10 (2000).
  14. Scharfmann, R., Axelrod, J. H., Verma, I. M. Long-term in vivo expression of retrovirus-mediated gene transfer in mouse fibroblast implants. Proc. Natl. Acad. Sci. USA. 88, 4626-4630 (1991).
  15. Katz, R. A., Greger, J. G., Skalka, A. M. Effects of cell cycle status on early events in retroviral replication. J. Cell. Biochem. 94, 880-889 (2005).
  16. Escors, D., Breckpot, K. Lentiviral vectors in gene therapy: their current status and future potential. Arch. Immunol. Ther. Exp. 58, 107-119 (2010).
  17. Mátrai, J., Chuah, M. K., VandenDriessche, T. Recent advances in lentiviral vector development and applications. Mol. Ther. 18, 477-490 (2010).
  18. Miyazaki, Y., Miyake, A., Nomaguchi, M., Adachi, A. Structural dynamics of retroviral genome and the packaging. Front. Microbiol. 2, 1-9 (2011).
  19. Douglas, J. T. Adenovirus-Mediated Gene Delivery. Gene Delivery to Mammalian Cells: Volume 2: Viral Gene Transfer Techniques. 3-14 (2004).
  20. Armendáriz-Borunda, J., et al. Production of first generation adenoviral vectors for preclinical protocols: amplification, purification and functional titration. J. Biosci. Bioeng. 112, 415-421 (2011).
  21. Snyder, R. O. Adeno-associated virus-mediated gene delivery. J Gene Med. 1, 166-175 (1999).
  22. Samulski, R. J., Muzyczka, N. AAV-mediated gene therapy for research and therapeutic purposes. Annu. Rev. Virol. 1, 427-451 (2014).
  23. Kaplitt, M. G., et al. Long-term gene transfer in porcine myocardium after coronary infusion of an adeno-associated virus vector. Ann. Thorac. Surg. 62, 1669-1676 (1996).
  24. Kaspar, B. K., et al. Myocardial gene transfer and long-term expression following intracoronary delivery of adeno-associated virus. J. Gene. Med. 7, 316-324 (2005).
  25. Ding, J., et al. Trbp regulates heart function through microRNA-mediated Sox6 repression. Nat. Genet. 47, 776-783 (2015).
  26. Lin, Z., et al. Cardiac-specific YAP activation improves cardiac function and survival in an experimental murine MI model. Circ. Res. 115, 354-363 (2014).
  27. Wahlquist, C., et al. Inhibition of miR-25 improves cardiac contractility in the failing heart. Nature. 508, 531-535 (2014).
  28. Carroll, K. J., et al. A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9. Proc. Natl. Acad. Sci. USA. 113, 338-343 (2016).
  29. Jiang, J., Wakimoto, H., Seidman, J., Seidman, C. E. Allele-specific silencing of mutant Myh6 transcripts in mice suppresses hypertrophic cardiomyopathy. Science. 342, 111-114 (2013).
  30. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods. 6, 343-345 (2009).
  31. Rychlik, W., Spencer, W., Rhoads, R. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Allocca, M., et al. Serotype-dependent packaging of large genes in adeno-associated viral vectors results in effective gene delivery in mice. J. Clin. Invest. 118, 1955-1964 (2008).
  33. Wu, Z., Yang, H., Colosi, P. Effect of genome size on AAV vector packaging. Mol. Ther. 18, 80-86 (2010).
  34. Li, J., Sun, W., Wang, B., Xiao, X., Liu, X. -Q. Protein trans-splicing as a means for viral vector-mediated in vivo gene therapy. Hum. Gene Ther. 19, 958-964 (2008).
  35. Piras, B. A., O'Connor, D. M., French, B. A. Systemic delivery of shRNA by AAV9 provides highly efficient knockdown of ubiquitously expressed GFP in mouse heart, but not liver. PLoS One. 8, e75894 (2013).
  36. Lovric, J., et al. Terminal differentiation of cardiac and skeletal myocytes induces permissivity to AAV transduction by relieving inhibition imposed by DNA damage response proteins. Mol. Ther. 20, 2087-2097 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics