Forberedelse av rAAV9 å overuttrykker eller Knockdown Gener i Muse Hjerter

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Ding, J., Lin, Z. Q., Jiang, J. M., Seidman, C. E., Seidman, J. G., Pu, W. T., Wang, D. Z. Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts. J. Vis. Exp. (118), e54787, doi:10.3791/54787 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Regulering av ekspresjonen eller aktiviteten av spesifikke gener gjennom myokardialt levering av genetisk materiale i murine modeller tillater undersøkelse av genfunksjoner. Deres terapeutiske potensial i hjertet kan også bestemmes. Det er begrenset tilnærminger for in vivo molekylær intervensjon i mus hjerte. Rekombinant adeno-assosiert virus (rAAV) -basert genom engineering har blitt brukt som et viktig verktøy for in vivo hjerte genmanipulering. De spesifikke fordelene med denne teknologien har høy effektivitet, høy spesifisitet, lav genomisk integrasjon hastighet, minimal immunogenisitet, og minimal patogenitet. Her er en detaljert fremgangsmåte for å konstruere, pakke, og rense rAAV9 vektorer beskrevet. Subkutan injeksjon av rAAV9 inn i neonatale unger resulterer i sterk ekspresjon eller effektiv knockdown av genet (er) av interesse i mus hjertet, men ikke i leveren og andre vev. Bruk av hjerte-spesific TnnT2 promoter, høy ekspresjon av GFP-genet i hjertet ble oppnådd. I tillegg målrette mRNA ble hemmet i hjertet når en rAAV9-U6-shRNA ble benyttet. Kjennskap til rAAV9 teknologi kan være nyttig for kardiovaskulære undersøkelser.

Introduction

Kontrollere ekspresjonen eller aktiviteten av spesifikke gener i forskjellige biologiske systemer har blitt en verdifull strategi i studier av genfunksjon 1. En direkte måte å oppnå dette målet er å manipulere nukleotidsekvenser og generere mutante alleler. Selv om å lage nøyaktige, målrettet endres til genomet av levende celler er fremdeles en tidkrevende og arbeidskrevende praksis, har utviklingen av de kraftige Talen og Crispr / Cas9 verktøy åpnet en ny æra av genom redigering 2-5. En mer rutinemessig laboratoriemetode for genmanipulering har fokusert på innføring av genetisk materiale (DNA-er og RNA-er inneholdende kodende sekvenser eller sirnas / shRNAs) inn i cellene for å uttrykke eller knockdown genet (r) av interesse 1,6.

I mange tilfeller er det vesentlig flaskehals for genmanipulering er levering av DNA, RNA eller protein inn i cellene. Med hensyn til in vitro-studier effektiv transfectipå systemer har vært etablert i mange dyrkede cellelinjer. Men i musemodellen i særdeleshet, er in vivo genavlevering mer utfordrende. Det finnes en rekke ekstra- og intracellulære hindringer som må omgås for å oppnå effektiv cellulært opptak av de eksogene reagenser. Andre hindringer inkluderer rask rydding og den korte varigheten av den leverte materialer 7,8. En strategi for å omgå disse problemene er å bruke virale vektorer som "bærere" eller "kjøretøy" for in vivo genet levering. De naturlig utviklede transduksjon egenskaper av virus tillater effektiv levering av et gen av interesse til cellene 7,9,10. Tallrike typer av virale vektorer er blitt utviklet og muliggjør fleksibel in vivo genmanipulering i forskjellige celletyper og organer hos mus.

Den mest vanlig brukte virale systemer omfatter Retrovirus, Lentivirus, Adenovirus, og adenoassosiert virus (AAV) 12-14. Men mange typer av retrovirus bare infisere delende celler, og deres effekt i ikke-delende celler er meget lav 15. Dette begrenser deres nytte for genet levering. Lentivirus er en slekt av den Retroviridae familien. Forskjellig fra andre retrovirus, kan Lentivirus infisere både dele og ikke-delende celler og har vært mye brukt for genoverføring inn i post-mitotisk og høyt differensierte celler 16. Livssyklusen til Lentivirus innebærer også integrasjon av vektor-DNA i vertsgenomet. Således Lentivirus-genavlevering muliggjør stabil og lang varighet ekspresjon av de transduserte genetiske elementer 16-18. Imidlertid kan denne funksjonen representerer en dobbel-edged sverd i bruken av disse virus for å manipulere genekspresjon, som integrering av vektor DNA kan føre til insertional mutagenese i vertscellene og kan føre til gjenstands effekter. Adenovirus er en annen mye brukt genavleveringssystem. I motsetning til retrovirus og lentivirus, adenovirus er ikke-integrert og forstyrrer ikke den genomiske integriteten av vertsceller 8,10,11,19. I tillegg kan adenovirus transfektere DNA inn i mange celletyper, og infeksjon er ikke avhengig av aktiv celledeling 19. En annen viktig egenskap av adenovirus er den enkle vektor rensing, så de virale vektorene har evnen til å bli replikert 19,20. Imidlertid, den store forbeholdet ved dette system er at adenovirus-infeksjon kan utløse sterke immunresponser hos målceller og organer 19, som begrenser dens anvendelse i mange undersøkelser, spesielt i genterapi studier.

Sammenlignet med disse ulike types av virale vektorer, rekombinant Adeno-assosiert virus (rAAV) synes å være den ideelle genavleveringssystemet 21,22. Det viser minimal immunogenisitet og patogenitet 23,24. I tillegg rAAV infiserer et bredt spekter av celletyper, inkludert både delende og ikke-delende celler. I de fleste tilfeller betyr rAAV ikke integreres i verts genomer; således er risikoen for uønskede genetiske eller genomiske forandringer i målcellene er lav 22.

Nylig har rAAV systemer blitt brukt for in vivo levering av DNA som koder for proteiner, mirnas, shRNAs, og Crispr-gRNAs inn mus hjertemuskelen 23,25-29. Denne metodikken har tilrettelagt grunnleggende undersøkelser og genterapistudier innen kardiovaskulær forskning. Her, til detaljert prosedyre generere rAAV9 vektorer som effektivt overuttrykker eller knockdown gener av interesse i mus hjerter ble beskrevet. Protokollen tilveiebringer en enkel og effektiv metode formanipulere kardial genekspresjon i murine eksperimentelle modeller.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle beskrevne fremgangsmåten ble utført under protokoller godkjent av biosikkerhet komité og Institutional Animal Care og bruk komité Boston barnesykehus. Boston Children Hospital har patogenfrie mus fasiliteter med regulerte lys / mørke sykluser og klimaanlegg. Veterinær og dyrepleie ansatte endrings bur og sikre helsen musene. Fasilitetene er AAALAC sertifisert og har aktiv Animal Welfare Assurance sertifisering (AAALAC Akkreditering Riktignok på 2/24/1992 Animal Welfare Assurance nummer. A3303-01). Musene ble avlivet av CO 2 levert fra en komprimert gass kilde. Vevsprøver ble samlet etter å ha bekreftet at hjertefrekvensen, bevegelse og pust av dyr hadde opphørt. Neonatal gnagere er resistente til CO 2 dødshjelp og ble avlivet ved halshogging hjelp skarp saks. Disse metodene er i tråd med anbefalingene fra panelet på Avliving av American Veterinary Medical Association.

1. generasjon rAAV9 konstruksjoner av Kloning en cDNA eller shRNA Expression kassetten inn i Plasmid Backbone

MERK: rAAV9 plasmid, som inneholder de inverterte terminal repetisjoner (Itrs) av AAV2, som brukes til genet overekspresjon har blitt modifisert til båtplass kylling TNNT2 promoter (rAAV9.cTNT), som gjør det mulig kardiomyocytt spesifikke uttrykk for omsatte gener 25,26,29. Unik NheI og KpnI-setene er blitt innført i plasmidet, nedstrøms for promoteren. CDNA-fragmenter som koder for gener av interesse kan bli klonet inn i rAAV9 ryggraden ved hjelp av disse to restriksjonsseter 25,26,29. Her, som et eksempel, ble den rAAV9 vektor for overekspresjon av GFP-genet i mus hjerter generert. Det resulterende plasmidet inneholder cTNT :: GFP kassett flankert av to ITR områder (figur 1). rAAV9.U6 :: shRNA konstruerer ble brukt for genet knockdown 25. Design shRNAs hjelponline shRNA utforming servere. rAAV9.U6 :: shRNA kan genereres enten ved gløding og ligere DNA oligonukleotider holdige shRNA sekvenser inn i restriksjonsenzym fordøyd rAAV9 vektorer som bærer U6 promoter, eller ved langtrekkende PCR og intra-molekylær Gibson montasje-baserte "sømløs" konstruksjon 30. Det resulterende plasmid bør inneholde U6-shRNA kassett flankert av to ITR sider (figur 2). Her, som et eksempel, ble rAAV9.U6 :: shRNA vektor konstruert for å knockdown Trbp mRNA (Trbp shRNA sekvens: GCAGTGATGGATATGCATCTTCTCGAGAAGATGCATATCCATCACTCG). En rykke shRNA ble brukt som en negativ kontroll (CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG).

  1. Klone cDNA eller shRNA uttrykk kassetten inn i rAAV9 plasmid ryggrad. Transform DNA inn i kompetente E. coli-celler 25.
    MERK: Bruk stbl2 eller stbl3 E. coli-celler for rAAV9 DNA transformasjon for å redusere uønsket ITR rekombinasjon.
  2. Plukk opppositiv klon fra de transformerte E. coli-celler. Forsterke kulturen i 500 ml Lilly-Barnett medium og trekke ut rAAV9 plasmid fra bakterieceller 25-30.
    MERK: Midi / Maxi prep rAAV9 plasmid å få en høy mengde DNA (> 100 mikrogram). Før generering av viruset, alltid analysere sekvensen integriteten av AAV plasmider ved restriksjonsspaltning og agarosegel-elektroforese, som tidligere beskrevet (http://www.vvf.uzh.ch/cloningservice/11bpdeletion/itrintegrity.html).

2. Transfeksjon av HEK293 Celler med rAAV9 Plasmider

  1. Forbered en ug / ul av lineær polyetylenimin (PEI) løsning. Oppløs PEI pulver i endotoksin-fri dH 2 O som er blitt oppvarmet til 70-80 ° C. Etterkjølings ned til RT, nøytralisere oppløsningen til pH 7,0 med 1 M HCl. Filter sterilisere (0,22 um) oppløsningen. Delmengde av en ug / ul PEI stamløsningen (1400 ul / rør) og lagre solution ved -20 ° C.
  2. Kultur HEK293 celler i Dulbeccos modifiserte Eagle-medium (DMEM) med 10% føtalt bovint serum (FBS) og 1% penicillin / streptomycin. Kultur cellene i en 37 ° C inkubator med 5 ± 0,5% karbondioksid (CO 2).
  3. På dag 0, platen HEK293-celler i ti 150-mm skåler 18-20 timer før transfeksjon av knuse> 90% konfluente celler i en 1: 2 fortynning.
    MERK: På dagen ett, bør cellene når 90% samløpet.
  4. På dag 1, transfektere HEK293 celler med rAAV9 plasmid (f.eks rAAV9.cTNT :: GFP eller rAAV6.U6 :: shRNA konstruerer), Ad-Hjelper plasmid, og AAV-Rep / Cap plasmid hjelp PEI 25,26,29.
    1. For 10 retter av celler på 90% samløpet, bland 70 ug AAV-Rep / Cap plasmid, 70 ug pf rAAV9 plasmid, og 200 mikrogram av Ad-Hjelper plasmid i en 50-ml sentrifugerør.
    2. Hvis cellene er mindre konfluent, justerer DNA mengde proporsjonalt. For eksempel, hvis cellene er ved 75% konfluent, redusereDNA mengde proporsjonalt (75/90 av den vist i trinn 2.4.1 mengde): bland 70 x 75/90 = 58,3 ug av AAV-Rep / Cap-plasmid, 70 x 75/90 = 58,3 ug av plasmid rAAV9, og 200 x 75/90 = 166,7 mikrogram av Ad-Helper plasmid i en 50-ml sentrifugerør.
    3. Legg 49 ml RT DMEM (uten FBS) til 50-ml tube og bland godt.
    4. Legg 1,360 mL av PEI-løsning for å gjøre den PEI: DNA-forhold (v / w) være 4: 1. Bland godt. Inkuber ved RT i 15 - 30 min.
    5. Tilsett 5 ml av blandingen fremstilt i trinn 2.4.4 til hver 150 mm skål (50 ml av blandingen i ti 150-mm skåler).
  5. Kultur cellene i en 37 ° C inkubator med 5 ± 0,5% CO 2 for 60-72 timer.

3. Harvests av transfekterte HEK293 celler og rensing av rAAV9 vektorer

  1. Høste celler 60-72 timer etter transfeksjon. Løsne og suspendere cellene i rettene ved å pipettere opp og ned sammen med kulturmediet. Overføre alle cellesuspensjoner til sterile50 ml rør.
  2. Sentrifuger cellene ved 500 xg i 5 minutter. Resuspender cellepelleten med 5 ml PBS i hvert rør og kombinere alle cellesuspensjoner inn i en 50 ml tube.
  3. Sentrifuger cellene ved 500 xg i 5 minutter. Kast supernatanten. På dette trinnet å lagre cellepelleten ved -80 ° C eller umiddelbart rense AAV fra pelleten, som beskrevet i trinn 3.4-3.15.
  4. Klargjør lyseringsbuffer: 150 mM NaCl og 20 mM Tris-HCl, pH 8,0. Filter sterilisere (0,22 mm). Oppbevar buffer ved 4 ° C.
  5. Resuspender pelleten med 10 ml lyseringsbuffer.
  6. Fryse løsningen ved -80 ° C eller i tørris / etanol-bad, deretter tine det ved 37 ° C. Vortex i 1 min. Fryse og tine lysat 3 ganger.
  7. Legg MgCI2 løsning på tint lysat (gjøre den endelige konsentrasjonen av MgCl2 i lysatet være 1 mM). Legg nukleasen til en sluttkonsentrasjon på 250 U / ml. Inkuber ved 37 ° C i 15 min for å oppløse DNA / protein-aggregation.
    MERK: Hvis DNA / protein aggregering ikke blir oppløst etter nuklease eller endonuklease behandling, dounce homogenlysatene 20 ganger.
  8. Sentrifuger prøven ved 4800 xg i 20 min ved 4 ° C. Samle supernatanten.
  9. I mellomtiden forbereder Iodixanol gradient løsningen:
    1. Klargjør 17% av gradienten oppløsning ved å blande 5 ml 10 x PBS, 0,05 ml av 1 M MgCl2, 0,125 ml av 1 M KCl, 10 ml 5 M NaCl, og 12,5 ml ofdensity gradient medium. Juster det totale volumet til 50 ml ved hjelp av H-2 O.
    2. Fremstille 25% oppløsning ved å blande 5 ml 10 x PBS, 0,05 ml av 1 M MgCl2, 0,125 ml av 1 M KCl, 20 ml av densitetsgradient medium, og 0,2 ml 0,5% (w / v) fenolrødt. Juster det totale volumet til 50 ml ved hjelp av H-2 O.
    3. Fremstille 40% løsning ved å blande 5 ml 10 x PBS, 0,05 ml av 1 M MgCl2, 0,125 ml av 1 M KCl, og 33,3 ml av densitetsgradienten medium. Juster det totale volumet til 50 ml ved hjelpH 2 O.
    4. Fremstille 60% løsning ved å blande 0,05 ml av 1 M MgCl2, 0,125 ml av 1 M KCl, 50 ml densitetsgradient medium, og 0,1 ml 0,5% (w / v) fenolrødt.
  10. Med en nål og sprøyte, laste Iodixanol gradient oppløsningen inn i polypropylenrør i størrelsesorden av 5 ml av 17%, 5 ml 25%, 5 ml 40%, og 5 ml av 60%, med start fra bunnen. Last alle lysat oppnådd fra trinn 3.8 (14-16 ml) på toppen av graderingen. Gradienten, listet fra bunnen til toppen, er 60%, 40%, 25%, 17%, og lysatet lag. Fyll røret med lysebuffer og dekke den med korken.
  11. Sentrifuger ved 185 000 xg i 90 min ved 16 ° C.
  12. Høste viral fraksjon (40% lag) med en sprøyte. Sett nål (21 gauge) i skjæringspunktet mellom fraksjonene 40% og 60%, bare aspirering av 40% laget.
    MERK: Unngå å aspirere noen av de 25% lag.
  13. Bland viral fraksjonen med sterilisert polyoksyetylen-polyoxypropylene blokk-kopolymer PBS-løsning (10% polyoksyetylen-polyoksypropylen-blokk-kopolymer lager 1: 10000 fortynnet i PBS) opp til et totalt volum på 15 ml. Installering av blandingen inn i filterrøret (cut-off molekylvekt = 100 kD). Sentrifuger ved 2000 xg i 30 min ved 4 ° C.
  14. Kast løsningen ved bunnen. Fyll opp filterrøret med polyoksyetylen-polyoksypropylen-blokk-kopolymer PBS-løsning til et totalt volum på 15 ml. Sentrifuger ved 2000 xg i 20 min ved 4 ° C. Gjenta dette trinnet to ganger til. Samle den rensede rAAV9 virus (brøkdel over filter).
  15. Overfør den rensede rAAV9 i filterrøret til 1,7 ml rør. Alikvot renset rAAV9 (100-400 ul / rør, avhengig av volumet og titer av AAV) og lagre viruset ved -80 ° C.
    MERK: Unngå gjentatte fryse-tiner.

4. Måling av Titer av rAAV9

  1. Forbered standard DNA-prøver.
    1. Utforme spesifikke og effektiv PCRprimere for rAAV9 vektorer og optimalisere PCR tilstand.
      MERK: Primere som brukes i denne studien er "Forward: TCGGGATAAAAGCAGTCTGG; Omvendt: TCGGACGGAGATACGTGAGT". PCR-reaksjonen ble utført med følgende betingelser: innledende denaturering ved 95 ° C i 3 minutter; 35 sykluser av 95 ° C i 20 sekunder, 60 ° C i 15 sek, og 72 ° C i 10 sekunder; og den endelige forlengelse ved 72 ° C i 10 min. Men de optimaliserte primere og PCR-forhold er plasmid-spesifikke, som det innfelte sekvens i vektoren rAAV9 kan påvirke spesifisiteten og effektiviteten av PCR-31.
    2. Utfør PCR reaksjon med de betingelser som er vist i trinn 4.1.1. Rens PCR-produkt med en gel ekstraksjon kit.
    3. Måle konsentrasjonen av renset DNA ved å bruke et spektrofotometer. Beregne konsentrasjonen i DNA-molekyl tall basert på molekylvekt / lengden av PCR-produktet.
      1. Beregn den molekylære konsentrasjon ved anvendelse av følgende ligning: molecular konsentrasjon (DNA-molekyler eller fragmenter / ml) = 6,23 x 10 23 mol -1 x Con. x 10 -6 / MW. Merknad: (6,23 x 10 23 mol -1 er Avagadro største nummer, Con .: DNA-konsentrasjon i ug / ml, MW .: molekylvekt i g / mol). For eksempel, hvis den oppnådde konsentrasjon av PCR-produktet er 100 ug / ml, og dens lengde er 200 bp, molekylvekten av den dobbelt-trådet DNA er 2 x 200 x 310 = 124 000 (gjennomsnittsmolekylvekt av hvert nukleotid i enkelt-trådet DNA er omtrent 310 g / mol). Den molekylære konsentrasjon (DNA-molekyler / ml) = 6,23 X 10 23 mol -1 x 100 ug / ml x 10 -6 / 124000 g / mol = 5,18 x 10 14 DNA-molekyler / ml.
      2. Foreta en fortynning serie av DNA-fragmentet og fremstilling av standard prøver, med konsentrasjoner på 10 13 molekyler / ml, 10 12 molekyler / ml, 10 11 molekyler / ml, 10 10 molekyler / ml, 10 9 molekyler / ml, 10 7 / ml molekyler. Bruke 1 pl av oppløsningen for hver standardprøve for kvantitativ PCR (qPCR, i trinn 4.6).
  2. Bland 5 ul renset rAAV9 oppløsning med 5 ul av 10 x DNAse-buffer, 1 pl DNAse (10 000 U / ml), og 39 ul av DDH 2 O. Det totale volumet bør være 50 ul.
  3. Inkuber flasken ved 37 ° C i 30 min for å fjerne gjenværende uemballert plasmid DNA.
  4. Inaktivere DNAse ved 95 ° C i 10 min. Kjøl ned løsningen, legger 44 mL H 2 O, 5 mL av 10x DNAse buffer, og en fil av proteinase K lager (10 mg / ml).
  5. Inkuber oppløsningen ved 50 ° C i 2 timer. Stoppe reaksjonen og inaktivere proteinase K ved 95 ° C i 10 min.
  6. Bruke 1 pl av prøven for kvantitativ PCR (qPCR) assay. Beregn titer.
    1. Kjør kvantitativ PCR (qPCR) med primere utformet i trinn 4.1.1 ved hjelp av eksempler from trinn 4.1.4 (standardprøver) og fra trinn 4,5 (prøvene som skal måles).
      1. For hver reaksjon, bland 10 ul av 2x Grønn konsentrat-blanding (inneholdende Taq-polymerase, dNTP miks, buffer, MgCl2, og grønne fargestoff), 0,5 ul av forover primer (5 uM), 0,5 ul av revers primer (5 uM), 8 ul H2O og 1 pl av prøven som skal måles. Utføre qPCR med følgende betingelser: holde prøvene ved 50 ° C i 2 minutter og 95 ° C i 10 min; utføre 40 sykluser ved 95 ° C i 15 sek og ved 60 ° C i 1 min; for smeltetrinnet, inkubere prøvene ved 95 ° C i 30 sekunder og 60 ° C i 15 sek. Generer standardkurve basert på C-t antall av standardprøvene (figur 3).
    2. Beregn den molekylære konsentrasjon / titer av AAV prøven mot standardkurven. Den rAAV9 har en enkeltkjedet DNA-genom, slik at det molekylære konsentrasjon vil være to ganger høyere enn denberegnet verdi (2x strøm (10, y), figur 3B). I tillegg vil titer av det rensede rAAV9 være 20 ganger høyere enn det som blir oppnådd fra beregningen på grunn av 1:20 fortynning av viruset i DNase og Proteinase K reaksjonene (5 ul i 100 ul totalt).

5. rAAV9 Injeksjon i Neonatal Mus og genekspresjon Analyser i hjertet

  1. Fremstille rAAV9 arbeidsløsninger i polyoksyetylen-polyoksypropylen-blokk-kopolymer PBS-oppløsning. Gjør viruset lager med titer av 1-7 x 10 12 partikler / ml.
    MERK: Lever 50-70 ul rAAV9 løsning i hver postnatal dag 0,5-1,5 mus ved subkutan injeksjon. For å oppnå effektiv genet overekspresjon eller knockdown, anbefales det å utføre en pilottest for hver studie for å optimalisere mengden av injiserte AAV. Bruk samme mengde rAAV9.cTNT :: Luc eller rAAV9.U6 :: krafse kontroller for hver studie for å minimere bias.
    MERK: Vi brukte 1-1,5x 10 11 partikler / valp for overekspresjon og 2,5 til 5 x 10 11 partikler / valpen for knockdown i postnatal dag 0,5-1,5 mi ce).
  2. Unn neonatal mus med rAAV9 på P0.5-P2.5 ved subkutan injeksjon.
    1. Pre-fylle en 29G1 / 2, 0,33 x 12,7 mm insulinsprøyte med rAAV9 løsning. Vær nøye med å fjerne luftbobler.
    2. Hold cryo-bedøvet valp i den ene hånden med tommel og pekefinger. Før injeksjon swipe tilbake huden på valpen med en bomullspinne stick mettet med 70% isopropylalkohol for å opprettholde den sterile tilstand. Sett nålen inn i anterior-rygghuden på dyret i en vinkel på 5 til 10 °. Injisere 50-70 mL av rAAV9 løsning ved hjelp av insulinsprøyte.
      MERK: rAAV9 kan også leveres til musen via intraperitoneal eller intravenøs injeksjon 26,27. Effektiv ekspresjon av de leverte gener i hjertet kan oppnås. Men intraperitoneal injisererion noen ganger kan føre til lekk ekspresjon i leveren. Etter injeksjon, ble tilstanden til valpene overvåkes hver dag.
  3. Nivået av genekspresjon i hjertet kan overvåkes med qPCR, immunfluorescens, eller western blot (representative resultater er vist i figurene 4 og 5) 25,26.
    MERK: Mus ble avlivet av CO 2 levert fra en komprimert gass kilde. Vevsprøver ble samlet etter å ha bekreftet at hjertefrekvensen, bevegelse og pust av dyrene hadde opphørt. Neonatal gnagere er resistente til CO 2 dødshjelp og ble avlivet ved halshogging hjelp skarp saks. Metoden er i tråd med anbefalingene fra panelet på Avliving av American Veterinary Medical Association.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Strategiene for rAAV9 bygging av rAAV9.cTNT :: GFP eller rAAV9.U6 :: shRNA plasmider er vist i figurene 1 og 2, respektivt. Som eksemplene, ble det rAAV9 vektoren som genereres for å overuttrykker GFP-genet i mus hjerter. Det resulterende plasmidet inneholder cTNT :: GFP kassett flankert av to ITR områder (figur 1). Den rAAV9.U6 :: shRNA vektor ble konstruert for å knockdown Trbp mRNA (figur 2)

Standardkurven for rAAV9 titrering ble generert med qPCR data ved lineær regresjon. Den manipulerte variable y representerer loggen 10 verdien av DNA-molekyl konsentrasjonen av hver standardprøve, og den tilsvarende variable x representerer den C-T-verdi. The Log 10 (konsentrasjon) verdier (y) og C T tall (x) utviser en fin lineær korrelasjon (R 2 = 0,9971) og passe med ligningen y = -0.2832x + 14,616 (figur 3A). Titere av rAAV9 prøver ble beregnet på grunnlag av den lineære ligningen (figur 3B). Med fremgangsmåten som er beskrevet i protokollen (trinn 4.6.2 og figur 3B), en høy titer av rAAV9 vektorer (50-200 ul,> 6 x 10 13 partikler / ml) ble oppnådd i den representative studien.

For å overvåke effektiviteten og vev spesifisitet rAAV9.cTNT vektorer, ble P0.5 valper behandlet med samme mengde (1 x 10 11 partikler / valp) av rAAV9.cTNT :: Luciferase (AAV-Luc) eller rAAV9.cTNT :: GFP (AAV-GFP) ved subkutan injeksjon. To uker etter injeksjonen ble GFP signal overvåkes i forskjellige vev hos musene. Robust ekspresjon av GFP ble påvist i hjertet, men ikke i andre organer (figur 4, n> 3). Således var effektiv og hjerte-spesifikk genekspresjon oppnås med rAAV9.cTNT vektoren.

jove_content "fo: keep-together.within-page =" 1 "> For å overvåke knockdown effektivitet og vev spesifisitet rAAV9.U6 vektorer, ble P0.5 mus behandlet med samme beløp (3 x 10 11 partikler / valp) av rAAV9 .U6 :: Scramble (AAV-Scramble) eller rAAV9.U6 :: Trbp shRNA (AAV-shTrbp) ved subkutan injeksjon. To uker etter injeksjon, uttrykk for Trbp i ulike vev ble overvåket av qPCR (figur 5, n = 3 ). mRNA nivået av Trbp i hjertet ble vesentlig redusert ved rAAV9.U6 :: shTrbp (68% nedregulering, P = 0,0004452). nedregulering av Trbp ble også detektert i levervev fra rAAV9.U6 :: shTrbp-behandlede mus. imidlertid er forandringen mye lavere.

Figur 1
Figur 1: Strategier for å Konstruer rAAV9.cTNT :: GFP Plasmid. (A) Ordningen av cTNT :: GFP kassett. (B TNNT2 promoter (rAAV9.cTNT) etterfulgt av to unike restriksjonsseter (NheI og KpnI). GFP åpne leserammen ble klonet inn i rAAV9.cTNT vektoren ved restriksjonssete-mediert ligering for å generere rAAV9.cTNT :: GFP plasmid. (B) Den rAAV9.cTNT :: GFP plasmid kan konstrueres ved Gibson montering. Klikk her for å se en større versjon av dette tallet.

Figur 2
Figur 2: Strategier for å Konstruer rAAV9.U6 :: shRNA Plasmid. (A) Ordningen av U6 :: shRNA kassett vises. Uttrykk for shRNA er drevet av U6 promoter (blå). (B) rAAV9-U6-shRNA kassetter kan genereres ved å varmebehandle og legere DNA-oligoer inneholdeing shRNA sekvenser inn i restriksjonsenzym fordøyd rAAV9 vektorer som bærer U6 arrangøren. (C) rAAV9.U6 :: shRNA kassetter kan genereres av lang PCR og intra-molekylær Gibson montasje-baserte "sømløs" konstruksjon. 5 'arm, loop, og 3' arm av shRNA vises i grønt, oransje og rødt, henholdsvis. Klikk her for å se en større versjon av dette tallet.

Figur 3
Figur 3: Beregning av rAAV9 Titer. (A) Standardkurven for rAAV9 titrering ble generert ved lineær aggresjon hjelp av qPCR-data. Den manipulerte variable y representerer loggen 10 verdien av DNA-molekyl konsentrasjonen av hver standardprøve, og den tilsvarende variable xrepresenterer C T verdi. (B) Titere av rAAV9 prøver er beregnet basert på den lineære ligning av standardkurven. Klikk her for å se en større versjon av dette tallet.

Figur 4
Figur 4: Expression Pattern of rAAV9.cTNT :: GFP i Mus vev. P0.5 valper ble behandlet med samme mengde (1 x 10 11 partikler / valp) av rAAV9.cTNT :: Luciferase (AAV-Luc, negativ kontroll) eller rAAV9.cTNT :: GFP (AAV-GFP) ved subkutan injeksjon. To uker etter injeksjon ble vevsprøver høstet. Uttrykk for GFP ble overvåket under en fluorescerende disseksjon omfang. Både lyse felt og fluorescens bildene blir presentert. Forsøkene er gjentatt mer enn 3 ganger (n> 3).Scale bar = 2,0 mm. SKM, skjelettmuskulatur. Klikk her for å se en større versjon av dette tallet.

Figur 5
Figur 5: knockdown Gene Expression med AAV-shRNA. P0.5 mus ble behandlet med samme beløp (3 x 10 11 partikler / valp) av rAAV9.U6 :: Scramble (AAV-Scramble) eller rAAV9.U6 :: Trbp shRNA (AAV-shTrbp) ved subkutan injeksjon. To uker etter injeksjon ble mRNA-nivåer av Trbp i forskjellige vev overvåket ved qPCR (n = 3). Data er presentert som gjennomsnitt ± SEM. Cut-off P-verdi er 0,05. NS, P> 0,05, ikke signifikant. ** P <0,01. SKM, skjelettmuskulatur. Klikk her for å se en større versjon av dette tallet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Det er viktig å minimere uønsket ITR rekombinasjon i løpet av plasmid konstruksjon. Før generering av viruset, må man alltid overvåke ITR integriteten av AAV plasmider ved hjelp av restriksjons spaltning og agarose gelelektroforese. Det er umulig å oppnå 100% intakte plasmidene, men den rekombinasjon forholdet bør minimaliseres så mye som mulig. Mindre enn 20% er akseptabelt for vellykket rAAV9 emballasje. Av notatet, kan dyrking bakterier ved lavere temperatur (30 ° C) med en lavere ristehastigheten (180-200 rpm) redusere sjansen for ITR rekombinasjon.

Det er viktig å sikre at HEK293 celler er sunt for vellykket transfeksjon og rAAV9 emballasje. "Sunn" celler er vanligvis svært proliferativ og vokser raskt. Imidlertid ikke rask spredning og vekst av HEK293 celler ikke nødvendigvis å garantere den høye effektiviteten til rAAV9 emballasje. Derfor er det viktig å starte forsøkene med friske celler. DenDet anbefales å bruke lav-passasje HEK293-celler (<10 passasjer, blir cellene passeres hver 2-3 dager) for rAAV9 emballasje. Av notatet, kan andre serotyper av rAAV trenger å bli renset ved hjelp av ulike prosedyrer 32.

Etterforskeren gis fleksibilitet i produksjon av rAAV9 plasmider. Enten restriksjonssete-mediert ligering eller Gibson sammenstilling kan benyttes 30. For rAAV9.U6 :: shRNA konstruksjon, er intra-molekylær Gibson montasje-basert strategi en effektiv metode (figur 1 og 2). Flere AAV-shRNA plasmider eller sammenslåtte kan AAV-shRNAs bli raskt konstruert. Å overuttrykker gener ved hjelp rAAV9, eksisterer det en størrelsesbegrensning for innsatte cDNA sekvenser. Vanligvis må størrelsen fragmentet mellom Itrs til å være mindre enn 5 kb 33. Intein-katalysert protein spleising kan brukes til å omgå emballasjen størrelsesgrensen for rAAV9 vektorer 34.

Andre virus systems, inkludert retrovirus, lentivirus og adenovirus, har også blitt utviklet og muliggjør fleksibel genmanipulering. Sammenlignet med disse ulike typer virale vektorer, har rAAV spesifikke fordeler: høy effektivitet, høy spesifisitet, lav genomisk integrasjon hastighet, minimal immunogenisitet, og minimal patogenitet. Dermed er rAAV baserte genom ingeniørfremstår som et ideelt verktøy for in vivo genmanipulering.

Tidligere studier har vist at rAAV9 systemet muliggjør effektiv ekspresjon av leverte gener in vivo. Med cTNT (kylling TnnT2) promoter, ble hjertespesifikke genuttrykk innhentet (figur 4) 25,26. Selv om U6-promoteren er aktiv allestedsnærværende i musevev, en mest slående inhibering av mål-mRNA (Trbp) ved rAAV9.U6 :: shRNA ble observert i hjertet, men ikke i andre organer (figur 5). Leveren er det mest vanlige organ transdusert ved forskjellige serotyper avrAAV 35,36. Imidlertid knockdown effektivitet (36% reduksjon av mRNA-nivå) i leveren er mye lavere enn det i hjerte (68% reduksjon av mRNA-nivå). Dette er i overensstemmelse med den tidligere undersøkelse som viser at, til tross for høyere virale genomet nærvær i leveren, systemisk levering av shRNA ved rAAV9 gir mer effektiv gen knockdown i hjertet 35. Det er mulig at hepatocytter er mer proliferativ enn cardiomyocytes og er mer aktivt under celledeling etter rAAV9 administrasjon på neonatal aldre, noe som resulterer i betydelig vektorgenomet fortynning i leveren vev. Imidlertid antyder dette også at serotype av rAAV9 kan mer effektivt transdusere kardiomyocytter i forhold til andre celletyper. Som demonstrert ved Lovric et al., I differensierte myocytter, blir DNA-skade respons MRN komplekse proteiner fortrengt. MRN komplekse proteiner binde AAV genomer og hemme AAV transduksjon gjennom transkripsjonen lyddemping. Dermed permissivity til AAV transduksjon kan induseres ved terminalen differensiering av cardiomyocytes 36, noe som gjør rAAV9 system, sammenlignet med andre virale vektorer, svært godt egnet for genmanipulering i hjertet. For ytterligere å redusere de uønskede knockdown effekter i andre organer (for eksempel leveren), en også kan bruke hjertespesifikke cTNT promoter-drevet MIR-30a-baserte shmiR å undertrykke gener av interesse i hjertet 29. Dette manuskriptet gir leseren med de spesifikke teknikker for å utnytte på rAAV9 teknologi i kardiovaskulære undersøkelser.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Polyethylenimine, Linear (MW 25,000) Polysciences, Inc.  #23966-2
Tube, Polypropylene, 36.2 ml, 25 x 87 mm, (qty. 56) Beckman Coulter, Inc # 362183
Nuclease, ultrapure SIGMA #E8263-25KU
Density Gradient Medium(Iodixanol) SIGMA #D1556-250ML
Centrifugal Filter Unit with Ultracel-100 membrane EMD Millipore Corporation #UFC910008
Laboratory pipetting needle with 90° blunt ends,gauge 14, L 6 in., nickel plated hub SIGMA #CAD7942-12EA
Poloxamer 188 solution (Pluronic® F-68 solution) SIGMA P5556-100ML
Proteinase K SIGMA 3115828001
DNase I Roche 10104159001
Centrifuge machine Thermo Scientific 75004260
Centrifuge System Beckman Coulter 363118
Ultracentrifuge Beckman Coulter
DMEM medium Fisher Scientific SH30243FS
Fetal Bovine Serum  Atlanta Biologicals               S11150
rAAV9 vector Penn Vector Core P1967

DOWNLOAD MATERIALS LIST

References

  1. Primrose, S. B., Twyman, R. Principles of gene manipulation and genomics. John Wiley & Sons. (2013).
  2. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, 1258096 (2014).
  3. Gaj, T., Gersbach, C. A., Barbas, C. F. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. 31, 397-405 (2013).
  4. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  5. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat. Biotechnol. 32, 347-355 (2014).
  6. Szulc, J., Wiznerowicz, M., Sauvain, M. -O., Trono, D., Aebischer, P. A versatile tool for conditional gene expression and knockdown. Nat. Methods. 3, 109-116 (2006).
  7. Nimesh, S., Halappanavar, S., Kaushik, N. K., Kumar, P. Advances in Gene Delivery Systems. BioMed Res. Int. 2015, 610342 (2015).
  8. Kamimura, K., Suda, T., Zhang, G., Liu, D. Advances in gene delivery systems. Pharm. Med. 25, 293-306 (2011).
  9. Thomas, C. E., Ehrhardt, A., Kay, M. A. Progress and problems with the use of viral vectors for gene therapy. Nat. Rev. Genet. 4, 346-358 (2003).
  10. Giacca, M., Zacchigna, S. Virus-mediated gene delivery for human gene therapy. J. Control Release. 161, 377-388 (2012).
  11. Witlox, M., Lamfers, M., Wuisman, P., Curiel, D., Siegal, G. Evolving gene therapy approaches for osteosarcoma using viral vectors: review. Bone. 40, 797-812 (2007).
  12. De Miguel, M. P., Cheng, L., Holland, E. C., Federspiel, M. J., Donovan, P. J. Dissection of the c-Kit signaling pathway in mouse primordial germ cells by retroviral-mediated gene transfer. Proc. Natl. Acad. Sci. USA. 99, 10458-10463 (2002).
  13. Nagano, M., Shinohara, T., Avarbock, M. R., Brinster, R. L. Retrovirus-mediated gene delivery into male germ line stem cells. FEBS Lett. 475, 7-10 (2000).
  14. Scharfmann, R., Axelrod, J. H., Verma, I. M. Long-term in vivo expression of retrovirus-mediated gene transfer in mouse fibroblast implants. Proc. Natl. Acad. Sci. USA. 88, 4626-4630 (1991).
  15. Katz, R. A., Greger, J. G., Skalka, A. M. Effects of cell cycle status on early events in retroviral replication. J. Cell. Biochem. 94, 880-889 (2005).
  16. Escors, D., Breckpot, K. Lentiviral vectors in gene therapy: their current status and future potential. Arch. Immunol. Ther. Exp. 58, 107-119 (2010).
  17. Mátrai, J., Chuah, M. K., VandenDriessche, T. Recent advances in lentiviral vector development and applications. Mol. Ther. 18, 477-490 (2010).
  18. Miyazaki, Y., Miyake, A., Nomaguchi, M., Adachi, A. Structural dynamics of retroviral genome and the packaging. Front. Microbiol. 2, 1-9 (2011).
  19. Douglas, J. T. Adenovirus-Mediated Gene Delivery. Gene Delivery to Mammalian Cells: Volume 2: Viral Gene Transfer Techniques. 3-14 (2004).
  20. Armendáriz-Borunda, J., et al. Production of first generation adenoviral vectors for preclinical protocols: amplification, purification and functional titration. J. Biosci. Bioeng. 112, 415-421 (2011).
  21. Snyder, R. O. Adeno-associated virus-mediated gene delivery. J Gene Med. 1, 166-175 (1999).
  22. Samulski, R. J., Muzyczka, N. AAV-mediated gene therapy for research and therapeutic purposes. Annu. Rev. Virol. 1, 427-451 (2014).
  23. Kaplitt, M. G., et al. Long-term gene transfer in porcine myocardium after coronary infusion of an adeno-associated virus vector. Ann. Thorac. Surg. 62, 1669-1676 (1996).
  24. Kaspar, B. K., et al. Myocardial gene transfer and long-term expression following intracoronary delivery of adeno-associated virus. J. Gene. Med. 7, 316-324 (2005).
  25. Ding, J., et al. Trbp regulates heart function through microRNA-mediated Sox6 repression. Nat. Genet. 47, 776-783 (2015).
  26. Lin, Z., et al. Cardiac-specific YAP activation improves cardiac function and survival in an experimental murine MI model. Circ. Res. 115, 354-363 (2014).
  27. Wahlquist, C., et al. Inhibition of miR-25 improves cardiac contractility in the failing heart. Nature. 508, 531-535 (2014).
  28. Carroll, K. J., et al. A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9. Proc. Natl. Acad. Sci. USA. 113, 338-343 (2016).
  29. Jiang, J., Wakimoto, H., Seidman, J., Seidman, C. E. Allele-specific silencing of mutant Myh6 transcripts in mice suppresses hypertrophic cardiomyopathy. Science. 342, 111-114 (2013).
  30. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods. 6, 343-345 (2009).
  31. Rychlik, W., Spencer, W., Rhoads, R. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Allocca, M., et al. Serotype-dependent packaging of large genes in adeno-associated viral vectors results in effective gene delivery in mice. J. Clin. Invest. 118, 1955-1964 (2008).
  33. Wu, Z., Yang, H., Colosi, P. Effect of genome size on AAV vector packaging. Mol. Ther. 18, 80-86 (2010).
  34. Li, J., Sun, W., Wang, B., Xiao, X., Liu, X. -Q. Protein trans-splicing as a means for viral vector-mediated in vivo gene therapy. Hum. Gene Ther. 19, 958-964 (2008).
  35. Piras, B. A., O'Connor, D. M., French, B. A. Systemic delivery of shRNA by AAV9 provides highly efficient knockdown of ubiquitously expressed GFP in mouse heart, but not liver. PLoS One. 8, e75894 (2013).
  36. Lovric, J., et al. Terminal differentiation of cardiac and skeletal myocytes induces permissivity to AAV transduction by relieving inhibition imposed by DNA damage response proteins. Mol. Ther. 20, 2087-2097 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics